ID: 934996618

View in Genome Browser
Species Human (GRCh38)
Location 2:98967454-98967476
Sequence GGGTGCTGGTGGGCTGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934996606_934996618 0 Left 934996606 2:98967431-98967453 CCAGCCTCCCTGGTGCAGGGCTG No data
Right 934996618 2:98967454-98967476 GGGTGCTGGTGGGCTGGGACTGG No data
934996612_934996618 -8 Left 934996612 2:98967439-98967461 CCTGGTGCAGGGCTGGGGTGCTG No data
Right 934996618 2:98967454-98967476 GGGTGCTGGTGGGCTGGGACTGG No data
934996611_934996618 -7 Left 934996611 2:98967438-98967460 CCCTGGTGCAGGGCTGGGGTGCT No data
Right 934996618 2:98967454-98967476 GGGTGCTGGTGGGCTGGGACTGG No data
934996602_934996618 12 Left 934996602 2:98967419-98967441 CCTAGTTTTGTGCCAGCCTCCCT No data
Right 934996618 2:98967454-98967476 GGGTGCTGGTGGGCTGGGACTGG No data
934996610_934996618 -4 Left 934996610 2:98967435-98967457 CCTCCCTGGTGCAGGGCTGGGGT No data
Right 934996618 2:98967454-98967476 GGGTGCTGGTGGGCTGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934996618 Original CRISPR GGGTGCTGGTGGGCTGGGAC TGG Intergenic
No off target data available for this crispr