ID: 935005310

View in Genome Browser
Species Human (GRCh38)
Location 2:99068804-99068826
Sequence GTTGGTATACTCAGAACGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935005310 Original CRISPR GTTGGTATACTCAGAACGAC AGG (reversed) Intronic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
919129024 1:193431197-193431219 GAAGGTAAACTCAGAAAGACAGG - Intergenic
924761648 1:246992967-246992989 GATGGTATACTTTGACCGACAGG + Intronic
1066396549 10:35029614-35029636 GCTGGTAAACTCATAACCACAGG + Exonic
1069008419 10:63344332-63344354 GTTTGTAGCCTCAGAACAACAGG + Intronic
1074225759 10:111482660-111482682 GTTATTATAATCAGAATGACAGG - Intergenic
1084063942 11:66692813-66692835 GTTGGGAGACTCAGAGGGACAGG - Intronic
1104067430 12:125317239-125317261 GTTGGTATACTCAAAGCGATTGG + Intronic
1116970714 14:51062257-51062279 GTTGGTATTATCAGACAGACAGG - Intronic
1119573913 14:75701229-75701251 ATTGGTATCCTCAGAAGGAAAGG - Intronic
1119893003 14:78197140-78197162 GTTGGTATTCACAGAGCCACGGG - Intergenic
1122767684 14:104083029-104083051 GCTGGTACACTCAGAAGGACGGG + Intergenic
1127559873 15:60125592-60125614 GTTGGTAATCCCAGAACTACGGG + Intergenic
1137569316 16:49554545-49554567 GTTGGCATTTTCAGAACAACTGG - Intronic
1137727723 16:50668272-50668294 TTTGATTTACTCAGAAGGACTGG - Intronic
1144514960 17:15910973-15910995 GTTGGTTGACTCAGAATGTCTGG + Intergenic
1148596798 17:48862993-48863015 GTTGGGATACTCAGAGAGAGTGG - Exonic
929997998 2:46841071-46841093 GGTGGTATACTGAAAATGACAGG + Intronic
935005310 2:99068804-99068826 GTTGGTATACTCAGAACGACAGG - Intronic
940797793 2:158098820-158098842 GTGCGTATACTGAGAAAGACTGG + Intronic
941027853 2:160478215-160478237 GTTGGGATACACAGAAGGAAAGG - Intronic
1168811419 20:707012-707034 GTAGGTAAACTGAGAACGAAAGG - Intergenic
950366218 3:12486116-12486138 CTTGGTATCCACAGAAGGACTGG - Intronic
956860324 3:73316948-73316970 CTTGGAAAACTCAGAACGTCTGG + Intergenic
957507853 3:81148264-81148286 GTTGGTATTTTGAGAATGACAGG - Intergenic
961361653 3:126371776-126371798 GTTGGTATTCTCAGAGCAACGGG + Intergenic
967605811 3:191445018-191445040 GTTAGTGTATTCAGAACAACTGG + Intergenic
976822232 4:89219531-89219553 GTTAATAAACTCAGAACAACGGG - Intergenic
983722632 4:170875364-170875386 GTTGATCCACTCAGAACCACAGG + Intergenic
994037487 5:95218789-95218811 GTTGGTAGCCTCAGAGCAACAGG - Intronic
1001075854 5:168627554-168627576 GCAGGTATACACAGAACGCCTGG - Intergenic
1037150758 8:15632745-15632767 GTTGGAATACTCAAAACAAAAGG - Intronic
1040486959 8:47882743-47882765 GTTTGCATAGTCAGAATGACAGG - Intronic
1049714579 8:144083793-144083815 GTTGGTAGAGTCAGAGCCACAGG - Exonic
1050192830 9:3046370-3046392 CTTGGCATACTCAGCAAGACAGG - Intergenic
1190315208 X:49146221-49146243 ATTGATATAATCAGAACCACGGG - Intergenic
1195487575 X:105426622-105426644 ATTGTTATATTCATAACGACTGG + Intronic
1201554835 Y:15257011-15257033 GTTGTTATAATCAGAGCAACAGG + Intergenic
1202036982 Y:20645951-20645973 ATTGATATAATCAGAACCACAGG + Intergenic