ID: 935011624

View in Genome Browser
Species Human (GRCh38)
Location 2:99141405-99141427
Sequence GTACGCGTGCGCACCGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935011624_935011630 2 Left 935011624 2:99141405-99141427 CCAGGCCCGGTGCGCACGCGTAC 0: 1
1: 0
2: 0
3: 6
4: 47
Right 935011630 2:99141430-99141452 GGCTCGACCTTCCTTCTCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 60
935011624_935011631 3 Left 935011624 2:99141405-99141427 CCAGGCCCGGTGCGCACGCGTAC 0: 1
1: 0
2: 0
3: 6
4: 47
Right 935011631 2:99141431-99141453 GCTCGACCTTCCTTCTCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 29
935011624_935011629 1 Left 935011624 2:99141405-99141427 CCAGGCCCGGTGCGCACGCGTAC 0: 1
1: 0
2: 0
3: 6
4: 47
Right 935011629 2:99141429-99141451 TGGCTCGACCTTCCTTCTCGCGG 0: 1
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935011624 Original CRISPR GTACGCGTGCGCACCGGGCC TGG (reversed) Intronic