ID: 935011631

View in Genome Browser
Species Human (GRCh38)
Location 2:99141431-99141453
Sequence GCTCGACCTTCCTTCTCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 29}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935011619_935011631 14 Left 935011619 2:99141394-99141416 CCCGCTCGCCCCCAGGCCCGGTG 0: 1
1: 0
2: 1
3: 21
4: 263
Right 935011631 2:99141431-99141453 GCTCGACCTTCCTTCTCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 29
935011624_935011631 3 Left 935011624 2:99141405-99141427 CCAGGCCCGGTGCGCACGCGTAC 0: 1
1: 0
2: 0
3: 6
4: 47
Right 935011631 2:99141431-99141453 GCTCGACCTTCCTTCTCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 29
935011621_935011631 6 Left 935011621 2:99141402-99141424 CCCCCAGGCCCGGTGCGCACGCG 0: 1
1: 0
2: 3
3: 12
4: 112
Right 935011631 2:99141431-99141453 GCTCGACCTTCCTTCTCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 29
935011617_935011631 18 Left 935011617 2:99141390-99141412 CCGTCCCGCTCGCCCCCAGGCCC 0: 1
1: 1
2: 29
3: 70
4: 666
Right 935011631 2:99141431-99141453 GCTCGACCTTCCTTCTCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 29
935011615_935011631 30 Left 935011615 2:99141378-99141400 CCAGCTTTGCTTCCGTCCCGCTC 0: 1
1: 0
2: 0
3: 6
4: 151
Right 935011631 2:99141431-99141453 GCTCGACCTTCCTTCTCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 29
935011622_935011631 5 Left 935011622 2:99141403-99141425 CCCCAGGCCCGGTGCGCACGCGT 0: 1
1: 0
2: 3
3: 15
4: 61
Right 935011631 2:99141431-99141453 GCTCGACCTTCCTTCTCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 29
935011627_935011631 -3 Left 935011627 2:99141411-99141433 CCGGTGCGCACGCGTACCTGGCT 0: 1
1: 0
2: 1
3: 2
4: 42
Right 935011631 2:99141431-99141453 GCTCGACCTTCCTTCTCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 29
935011623_935011631 4 Left 935011623 2:99141404-99141426 CCCAGGCCCGGTGCGCACGCGTA 0: 1
1: 0
2: 1
3: 2
4: 25
Right 935011631 2:99141431-99141453 GCTCGACCTTCCTTCTCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 29
935011626_935011631 -2 Left 935011626 2:99141410-99141432 CCCGGTGCGCACGCGTACCTGGC 0: 1
1: 0
2: 0
3: 2
4: 45
Right 935011631 2:99141431-99141453 GCTCGACCTTCCTTCTCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 29
935011620_935011631 13 Left 935011620 2:99141395-99141417 CCGCTCGCCCCCAGGCCCGGTGC 0: 1
1: 0
2: 1
3: 29
4: 302
Right 935011631 2:99141431-99141453 GCTCGACCTTCCTTCTCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935011631 Original CRISPR GCTCGACCTTCCTTCTCGCG GGG Intronic