ID: 935012438

View in Genome Browser
Species Human (GRCh38)
Location 2:99148078-99148100
Sequence GAACTGTTTCAGATTAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 3, 2: 24, 3: 65, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935012438_935012442 18 Left 935012438 2:99148078-99148100 CCTCCTTTAATCTGAAACAGTTC 0: 1
1: 3
2: 24
3: 65
4: 227
Right 935012442 2:99148119-99148141 TTCATAACATTGACATTTTTAGG 0: 1
1: 1
2: 7
3: 49
4: 494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935012438 Original CRISPR GAACTGTTTCAGATTAAAGG AGG (reversed) Intronic
900963675 1:5942611-5942633 GAACTGTTCCAGAATTAAGGAGG + Intronic
902099510 1:13974326-13974348 GAACTGTTTAAGATGTAAGTTGG + Intergenic
903051002 1:20601044-20601066 GAACTATTTTAGACAAAAGGAGG + Intronic
904772770 1:32889805-32889827 GAGCTATTCCAGATTAAAGGGGG - Intronic
906264827 1:44420611-44420633 AAGGTGTTTCAGATCAAAGGTGG + Intronic
906954929 1:50366276-50366298 GAACTGCTACAGATTAAAAGAGG + Intergenic
907036272 1:51219120-51219142 CGACTGTTACAGATTAAAGATGG - Intergenic
907052739 1:51340645-51340667 GAGCTTTTTCAGACTAAAGCTGG + Intronic
908009441 1:59761095-59761117 GAGCTGTTGTAGATTAAATGTGG - Intronic
908414152 1:63896438-63896460 GAAATCTTTCAGAGTAAAGGAGG - Intronic
908961414 1:69700765-69700787 GAACTGAGTCATATTAATGGTGG - Intronic
909288521 1:73852692-73852714 GACCTGTTTCCGAATGAAGGAGG + Intergenic
909804152 1:79854034-79854056 GAACTGTATCAGATCCAGGGAGG - Intergenic
911068583 1:93813890-93813912 GAACTGTTCCAGGTTAAAGGAGG - Intronic
911132397 1:94402716-94402738 GAAATGTTCCAGATTAAAGGAGG - Intergenic
911946764 1:104120443-104120465 TAACTGTCCCAGTTTAAAGGAGG - Intergenic
912296064 1:108472104-108472126 GAAATGTGTCAGGTTAAAAGGGG - Intergenic
913177805 1:116291155-116291177 CAACTGTTTCAGTTTCAAGTGGG - Intergenic
913209016 1:116568077-116568099 CAACAGTTTTAGGTTAAAGGGGG + Intronic
914697264 1:150096223-150096245 GAACTGCTCCAGATTAAACATGG + Intronic
915864475 1:159484191-159484213 GAAATGTTACAGTTTCAAGGTGG - Intergenic
916454714 1:164958948-164958970 TAACATTTTCAGATTAAAGGGGG + Intergenic
916474015 1:165151132-165151154 GAAATGTTTCAGGTGAAAGGAGG - Intergenic
917045620 1:170856787-170856809 GAACAGTTCCAGATTACATGAGG + Intergenic
917048633 1:170892415-170892437 AAACTGTTTCAGGTAATAGGAGG + Intergenic
917136541 1:171793430-171793452 AAAATGTTTCAGATTACTGGAGG + Intronic
917323713 1:173810546-173810568 GACATGATTCAGATTAAAGGAGG + Intronic
918594832 1:186280863-186280885 AAACTGTTCCAGATTTGAGGAGG - Intergenic
918996714 1:191771394-191771416 CATCTCTTTCAGATTACAGGTGG + Intergenic
920577626 1:207073122-207073144 GAACTGTTTCTCATGAAAGGAGG - Exonic
921061640 1:211590219-211590241 GAAATGTTCCAGATTAAAGGAGG - Intergenic
921260436 1:213381406-213381428 GAACTAGATCAGATTAATGGGGG - Intergenic
921819964 1:219606032-219606054 CAAATGTTTCAGATTGAAGTGGG - Intergenic
921940812 1:220837481-220837503 AAACTGTTCCAAATTAAAGGAGG + Intergenic
922139024 1:222862917-222862939 GTACTGTTCCAGATTAAAGAAGG - Intergenic
923335266 1:232964142-232964164 GAAATGTTCCAAATTAACGGAGG - Intronic
924371544 1:243356136-243356158 GACATGTTTCATTTTAAAGGCGG + Intronic
1063408656 10:5819614-5819636 GTACTGTGGCAGATTAAAGATGG - Intronic
1063445136 10:6108762-6108784 GACCTGTATCAGAATAAAAGAGG - Intronic
1064622724 10:17230638-17230660 CAACTGTTTCAGATTGCAGGAGG + Exonic
1064881621 10:20061263-20061285 GAATTCTTACAGATTGAAGGAGG - Intronic
1065147924 10:22790711-22790733 AAAAAGTTCCAGATTAAAGGAGG - Intergenic
1065904051 10:30232849-30232871 GAAATGGTACAGATTCAAGGTGG - Intergenic
1068288129 10:54965706-54965728 GAAATGTTTCAAATTAAATGTGG - Intronic
1068982955 10:63080743-63080765 GATTTGTTCCAGATTGAAGGAGG + Intergenic
1069471154 10:68690855-68690877 GAACTTTTTAAGATAAAATGGGG - Exonic
1069971155 10:72170643-72170665 GAAATGTTCCAGATTCAAGGAGG + Intronic
1070274612 10:74993671-74993693 GTACTATTCCAGATTAAAGGAGG - Intronic
1071714007 10:88076927-88076949 GAAATTTTTGAGAATAAAGGGGG - Intergenic
1071883348 10:89923245-89923267 GAACTTTTTCAGACTGGAGGAGG - Intergenic
1072356163 10:94613410-94613432 GAAATGTTTAAGATGAAAGCAGG - Intronic
1078181098 11:9011526-9011548 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1078429547 11:11278227-11278249 GATCTGTCTAACATTAAAGGTGG - Intronic
1080604500 11:33853543-33853565 GGAATGTTTCAGGTTAAAGAAGG - Intergenic
1081511895 11:43783098-43783120 AGACTGTTCCAGATTGAAGGAGG + Intronic
1084788258 11:71456673-71456695 GACCTGTTTCATTTTAAAAGTGG + Intronic
1086066579 11:82751504-82751526 GCACTGCTTCAAATTTAAGGTGG - Intergenic
1088384086 11:109233247-109233269 GATATGTTTCAGATTAAAAGAGG - Intergenic
1089673972 11:120076987-120077009 GGGATGTTTCAGATTAAAGGAGG + Intergenic
1092242667 12:6845078-6845100 AAACAGTTCCAGTTTAAAGGTGG - Intronic
1093162029 12:15758580-15758602 GCACTGGTACAGATTAAAGAAGG + Intronic
1093650652 12:21641467-21641489 AAACTGTTCCAGAATGAAGGAGG + Intronic
1099109014 12:78533463-78533485 TAACTGTTACAGACTAATGGAGG - Intergenic
1100203931 12:92328059-92328081 GACTTGTTTCAGAAAAAAGGAGG - Intergenic
1100837673 12:98582363-98582385 GAACTGCTTCAGACTGAAGAAGG + Intergenic
1104425704 12:128676176-128676198 GACTTGCTTCAGCTTAAAGGAGG - Intronic
1105223594 13:18357489-18357511 GCATTGTTTCAGGTGAAAGGTGG + Intergenic
1105749971 13:23413939-23413961 GAAATGTTTAAAATTAAAAGAGG + Intronic
1106150370 13:27094762-27094784 TAAATGTTTCAGGTTAAAGAAGG + Intronic
1106237855 13:27880117-27880139 GGAATGTTTCAGATTAAAGGAGG + Intergenic
1106489905 13:30211560-30211582 GAACTGTTTTAGATGAAAGAAGG - Intronic
1108028240 13:46201073-46201095 GAACTGTCCCAGATTAATGGAGG - Intronic
1108078428 13:46707182-46707204 GAAATGTTCCAGATAAAAGAAGG - Intronic
1109108489 13:58286044-58286066 GCACAGTCTCAGATTCAAGGTGG - Intergenic
1109698998 13:66001016-66001038 AAACTGTTCTAGATTAAATGTGG - Intergenic
1110216852 13:73033195-73033217 GAACTATTCTAGATTAAAGAAGG - Intergenic
1110346466 13:74453371-74453393 GAACAGAATCAGAATAAAGGTGG + Intergenic
1110438963 13:75506973-75506995 GAACTGTTCCAGATTAAACAAGG + Intergenic
1111668442 13:91299183-91299205 GAAATGTTTCAGATTAAAGAAGG - Intergenic
1111935605 13:94554071-94554093 GAACTGTTCCATATGCAAGGAGG + Intergenic
1112567908 13:100566916-100566938 GAATTGTTCCAGATGGAAGGAGG - Intronic
1115983777 14:39082897-39082919 GAACTGTTCCAGGATGAAGGAGG + Intronic
1118182052 14:63503531-63503553 CAACTGTTCCAGAGCAAAGGAGG + Intronic
1118306683 14:64660908-64660930 GAACTGTTCTAGATTGAGGGAGG + Intergenic
1118485729 14:66213005-66213027 GAAGTGATTCAGCTTACAGGAGG - Intergenic
1119995816 14:79252611-79252633 AAACTGTTTCAGATCTAAGAGGG + Intronic
1122147712 14:99702962-99702984 GAACTGTTCTAGAATAAAGGGGG - Intronic
1122176250 14:99921648-99921670 GAACTGCTTCAGAATATGGGAGG - Intronic
1125644271 15:41258500-41258522 GAAATGTTCCAGATTAAAGGAGG - Intronic
1126320805 15:47420666-47420688 GAATTGTTTTAGATAAAAAGAGG - Intronic
1126446387 15:48749753-48749775 GAAATGTTCTAGATTAAAGGAGG + Intronic
1128883541 15:71264974-71264996 GAACTAATTAAGATTAAATGAGG + Intronic
1130747253 15:86668542-86668564 GAAATATTGCAGATAAAAGGGGG - Intronic
1133654213 16:7844041-7844063 AAAAGGTTTCAGATTAAAAGGGG + Intergenic
1134033416 16:11010794-11010816 GAAATGTTCCGGAGTAAAGGAGG - Intronic
1137451322 16:48577460-48577482 GAAATGTTAGAGGTTAAAGGTGG - Intronic
1139792121 16:69446805-69446827 AAACTGTTCCAGATTGAAGGAGG - Intronic
1140699223 16:77566041-77566063 CAACAGTTTCAGATTAACGTAGG + Intergenic
1142819417 17:2453344-2453366 GAACTATTCCAGATTGAAGGAGG - Intronic
1146703725 17:34984252-34984274 GAAATATTTCAGATTAAAGGAGG - Intronic
1150831848 17:68528737-68528759 GTAGTGTCTCAGATTAAAAGTGG - Intronic
1150935593 17:69631886-69631908 GAAATGTTTCAGATTATAAGAGG + Intergenic
1156247050 18:35311082-35311104 AAAGAGTTTCAGATTAAAAGGGG + Intergenic
1158059477 18:53321176-53321198 GCACTATTTCAGATGAATGGGGG + Intronic
1158454977 18:57598028-57598050 CAACTCGTTCAGATTAAAGCAGG + Intergenic
1158497826 18:57972661-57972683 GAAATGCTCCAGACTAAAGGAGG - Intergenic
1160349677 18:78165821-78165843 GAACTGCTTCTGGTTACAGGAGG - Intergenic
1162148277 19:8627079-8627101 CAACTGTATCATATTACAGGTGG + Intergenic
1162221542 19:9181416-9181438 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1164924182 19:32113995-32114017 TAACTGTTCCAGATTAACGATGG + Intergenic
1167651271 19:50730733-50730755 GAAATGTTCCAGATTCAAGGAGG - Intergenic
1168490643 19:56805766-56805788 GAGGTTTTCCAGATTAAAGGAGG + Intronic
925559570 2:5175523-5175545 GATCTGTTTCAGATTCAACTGGG - Intergenic
925620610 2:5788818-5788840 GAACTTTCTCAAATTGAAGGAGG + Intergenic
925946261 2:8866723-8866745 AAGCTGTTACAGATTAAAAGAGG - Intronic
926583897 2:14663914-14663936 GAACGGTTTGGCATTAAAGGAGG + Intergenic
926770662 2:16371612-16371634 AAACTGTTACAGATCAGAGGAGG - Intergenic
928076631 2:28271146-28271168 GCAGTGTTTGAGATAAAAGGAGG + Intronic
928662773 2:33520352-33520374 GAGCGGTTTTAGATTGAAGGAGG + Intronic
929622945 2:43375977-43375999 AAGCTGTTTCAGACTAAAAGGGG + Intronic
930371267 2:50504099-50504121 GAAATGTTCTAGATTAAAGGAGG + Intronic
930726264 2:54684786-54684808 GAACTGTTCCAGATGAAAGGAGG + Intergenic
931726021 2:65111484-65111506 AAACTGTCACAGATTGAAGGTGG + Intronic
932402787 2:71493340-71493362 GAAACGTTCCAGATTAAAGGAGG - Intronic
932726201 2:74181899-74181921 GAACTGTGTGTGATGAAAGGCGG - Intergenic
932921377 2:75918496-75918518 GATATGTTTCAGAATAAAAGTGG + Intergenic
933790157 2:85877354-85877376 GAACGGTTTCAGATTAAAGAAGG - Intronic
934049845 2:88200867-88200889 GAACTTTCACAGATTAAAGTGGG + Intergenic
935012438 2:99148078-99148100 GAACTGTTTCAGATTAAAGGAGG - Intronic
935933874 2:108159912-108159934 GAAATGTTCCAGATAAAAGAAGG + Intergenic
936461510 2:112717819-112717841 GAAATGTTCCAGATTACAGGAGG - Intergenic
936799257 2:116246548-116246570 TAACTGTTTCATATTAAAAGAGG + Intergenic
937661293 2:124432474-124432496 GAACTGACTCAGTTCAAAGGGGG - Intronic
937781233 2:125840464-125840486 GAAGTTTTTCAGATAGAAGGTGG + Intergenic
938714261 2:134004892-134004914 AAAAAGTTCCAGATTAAAGGAGG + Intergenic
938802200 2:134773784-134773806 AAACTGTTTCAGACAAAATGGGG + Intergenic
940613180 2:156016430-156016452 GAAGTGATTAAGATTAAATGAGG - Intergenic
940673379 2:156698203-156698225 GAGCTGTTCTAGATTAAAGCAGG - Intergenic
941590959 2:167419783-167419805 GGACTGTTTCTGAATAAAGGTGG - Intergenic
944785354 2:203064689-203064711 GAAATGTTTCAGATTAAAAGAGG + Intronic
1168775326 20:442478-442500 GAACTGTTCCAGATTAAAAATGG + Intronic
1169750186 20:8984196-8984218 GCAGTGTTCCAGATCAAAGGAGG - Intergenic
1170408455 20:16063960-16063982 GAACTGTCCCAGATTAAAGGAGG + Intergenic
1171026102 20:21632018-21632040 GAACTGTTCTAGAATAGAGGAGG - Intergenic
1171038057 20:21732776-21732798 GAACTGTTCCAGATGAAAGGAGG - Intergenic
1171283780 20:23921716-23921738 GAGCTGATGCAGGTTAAAGGAGG + Intergenic
1172362144 20:34320506-34320528 GAACTGTTTTAGGGTAAAGATGG + Intergenic
1173148002 20:40542021-40542043 GAAATATTTTAGCTTAAAGGAGG - Intergenic
1173358739 20:42320371-42320393 GAACTGTTACTGATGGAAGGAGG - Intronic
1173450161 20:43156864-43156886 GAACATTTTGAGATTCAAGGAGG + Intronic
1174334504 20:49849362-49849384 GCAGTGTTTCAGATGAAAGATGG + Intronic
1175142029 20:56867796-56867818 GAACAGTTGCAGATCCAAGGAGG + Intergenic
1175398738 20:58686755-58686777 GGACTGTTCTGGATTAAAGGAGG + Intronic
1176732137 21:10509870-10509892 GCATTGTTTCAGGTGAAAGGTGG + Intergenic
1176962841 21:15179045-15179067 GAAATATATCAGATTAAAGTTGG - Intergenic
1177160312 21:17540199-17540221 GAAGTGATTAAGATTAAATGAGG - Intronic
1178464861 21:32838504-32838526 GAGCTTTTTTAGACTAAAGGGGG - Intergenic
1178613282 21:34106878-34106900 GAAGTAGTCCAGATTAAAGGGGG - Intronic
1179216259 21:39369612-39369634 GAAATGTTTCAGATTAAAGGAGG + Intergenic
1181347799 22:22233021-22233043 GAACTGATTCAGATGGAAGATGG + Intergenic
1182390334 22:29989197-29989219 AAAATGTTCCAGATTAAAGAAGG - Intronic
1182701498 22:32243316-32243338 GAAATGTTCCAGATGAAAGGAGG + Intronic
949557159 3:5164843-5164865 GAAATGTTTCAGACTAACAGAGG - Intronic
950107297 3:10396419-10396441 GCACTGTTTCAGCTTAGAAGAGG - Intronic
950911601 3:16600827-16600849 AAACTGTGTCAGATTATAAGAGG + Intronic
951229728 3:20164031-20164053 AAACTGTTTCAGAAAAGAGGAGG + Intronic
951319909 3:21231913-21231935 GAACTATTTCAGTGTAAAAGTGG - Intergenic
951954275 3:28237639-28237661 GAACTGAGTCAGATTAAAACAGG + Intergenic
952100761 3:30010465-30010487 GCACTGTTCCAGATTAAAGGTGG - Intergenic
952144061 3:30512509-30512531 GATGTGTTTCTGATTAAAGCTGG + Intergenic
952273509 3:31855339-31855361 GAAGTGTTCCAGATTAAATGAGG - Intronic
952952391 3:38535515-38535537 GAACTCTCCCAGATTAAAGGAGG - Intronic
953400191 3:42607525-42607547 AGACTGTTTTAGATTAAAAGAGG + Intronic
953593483 3:44284055-44284077 GAAATGTTCTAGATTAAAGGAGG - Intronic
953661161 3:44892763-44892785 AAATTGTTCCAGATTAAAGGAGG - Intronic
954839841 3:53500960-53500982 TAACTGTTTCAGATTAGAGCCGG - Intronic
955018738 3:55097810-55097832 AAGCTGTTTCAGATTAGAAGGGG + Intergenic
955237597 3:57153483-57153505 GAACTGTTCTGTATTAAAGGAGG + Intronic
955349952 3:58185953-58185975 GAACTGTTTCCGAGAGAAGGAGG - Intergenic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
956631338 3:71319733-71319755 GAACTGTTTGAGAAGAAGGGAGG - Intronic
958270045 3:91488298-91488320 GAACTCATTAAGATTAAAGGAGG + Intergenic
958858980 3:99422090-99422112 GAACTACTTTAGATTAAAGGGGG + Intergenic
959455207 3:106551268-106551290 GAACTCTTTCATTTTGAAGGAGG + Intergenic
959863118 3:111237590-111237612 AAACAGTTACAGATTAAAGAGGG + Intronic
960353012 3:116616687-116616709 GAAATATTTCAGAATCAAGGAGG + Intronic
961430562 3:126879580-126879602 GGAATGCTTTAGATTAAAGGAGG + Intronic
961583182 3:127900231-127900253 GAACTGTTCCTGATGAAAGAAGG + Intergenic
963299301 3:143581120-143581142 GTACTATTTTAGAATAAAGGAGG + Intronic
963650254 3:147970446-147970468 AACCTGTTTCAGAATAACGGGGG - Intergenic
963861303 3:150313341-150313363 CTACTGTTTCCGATTATAGGCGG + Intergenic
964465760 3:156990077-156990099 GAAATATTCTAGATTAAAGGAGG - Intronic
964602783 3:158520691-158520713 GAAATGTTTCAAATTAATTGTGG + Intronic
965068571 3:163885739-163885761 TAACTGTTCCAGATTAAAGTAGG - Intergenic
965168566 3:165229286-165229308 GAACTGTTACAGATTTTTGGTGG - Intergenic
965196058 3:165596406-165596428 GAAAAGTTGCAGGTTAAAGGAGG + Intergenic
965782244 3:172298047-172298069 GAATTGTTCCAAATTAAAGAAGG - Intronic
969324909 4:6437419-6437441 CAACTGTTTCATTTTAAAGATGG + Intronic
972089991 4:35269420-35269442 GATGTGTTTCAGATTATAGGAGG - Intergenic
973706360 4:53584783-53584805 GAAGTGTTTCAGATAGAAGCTGG - Intronic
976428879 4:84939105-84939127 GAAGTGTTCCAAATTAAAGGAGG - Intronic
976489754 4:85656324-85656346 GAAATGTTTCAGCTTAATGTTGG - Intronic
978058125 4:104298872-104298894 GAACACTTTCAGATTCATGGTGG + Intergenic
979134861 4:117097642-117097664 GAACTGTTTAAAATTAAACATGG - Intergenic
980189509 4:129505972-129505994 GAACTGTTTCTGAATAAATGTGG - Intergenic
980948124 4:139343475-139343497 AAACTGTTTCAGATTAAAAGAGG - Intronic
982547885 4:156758549-156758571 GAGCTGTTGCAGGATAAAGGCGG + Intergenic
983125203 4:163942887-163942909 GTACAGTTTCACATTGAAGGGGG - Intronic
984002999 4:174273362-174273384 GAACAGTTTTGGATTAAAAGAGG + Intronic
984156981 4:176205818-176205840 GAATTGTTTCAGATCTCAGGAGG - Intergenic
986555969 5:9009754-9009776 GAACAGTTAAAGGTTAAAGGTGG - Intergenic
986625372 5:9718918-9718940 GAATTGTTCTAGATTAAAGTAGG + Intergenic
988516670 5:31910941-31910963 GAACTGGTTTAAAATAAAGGGGG - Intronic
989341832 5:40384841-40384863 GTACTTTTTCAGATTTAAGAGGG + Intergenic
989946982 5:50248027-50248049 GAACTGTGTGAGATGAATGGAGG + Intergenic
990109001 5:52300015-52300037 GAGCATTTTCAGTTTAAAGGTGG + Intergenic
990488462 5:56281200-56281222 GAACTGAATAAGTTTAAAGGGGG + Intergenic
991218654 5:64186215-64186237 GAAAGGATTCAGATGAAAGGTGG - Intronic
992010707 5:72524252-72524274 GAAATGTTACACATTAGAGGTGG + Intergenic
992123634 5:73619537-73619559 GAACTGTTTCAGAATAACCCAGG - Intergenic
992766622 5:80006730-80006752 GAGCTGGTTTAGAATAAAGGGGG + Intronic
992788667 5:80194044-80194066 GAAGTTTTTGAGATTAAAAGTGG - Intronic
995368282 5:111388491-111388513 GAAATTTTTCAGATGCAAGGAGG - Intronic
995446769 5:112253438-112253460 AAAGTGTTCCAGATTAAAGGAGG + Intronic
996511902 5:124325894-124325916 GGACTGTTCCAGATTAAAAGTGG + Intergenic
997117771 5:131144385-131144407 GAACTGTTCTAGATTAAAAGAGG - Intergenic
998195775 5:140069455-140069477 GAAATGTTCCAGATTTAAGGTGG + Intergenic
998276313 5:140757328-140757350 GAACCATTTCAGATTAAATAGGG - Intergenic
998305986 5:141077682-141077704 GAAATGTTCCAGCCTAAAGGGGG + Intergenic
998727706 5:145036710-145036732 GAGCAGTTTCAGATGAATGGTGG - Intergenic
1000832029 5:166114461-166114483 GAAATGCTCCAGGTTAAAGGAGG - Intergenic
1002423388 5:179162221-179162243 GGTCTGACTCAGATTAAAGGAGG - Intronic
1002669470 5:180854842-180854864 CAAATGTTCCAGATTAAAGAAGG + Intronic
1003041289 6:2689986-2690008 TCACTGTTTCAGATTAATAGAGG + Intronic
1003556303 6:7142564-7142586 GAACTGTCTCAGACTAAGGCAGG - Intronic
1003789581 6:9528630-9528652 GAACTATTCCAAATTGAAGGAGG + Intergenic
1003956289 6:11168443-11168465 GGAATGTTTCTGATTAAAGGAGG - Intergenic
1005851562 6:29827282-29827304 CAACTTTTCCAGATTTAAGGGGG + Intronic
1008279547 6:49579475-49579497 GAATTGTTCTAGATTAAAGGAGG + Intergenic
1008910588 6:56728397-56728419 AAACTGTTTCCAATTAAAGCAGG + Intronic
1008985118 6:57533044-57533066 GAACTCATTAAGATTAAAGGAGG - Intronic
1009173152 6:60425999-60426021 GAACTCATTAAGATTAAAGGAGG - Intergenic
1009565675 6:65308555-65308577 CAAATGTTTCAGATTGAAGTGGG + Intronic
1010740509 6:79497587-79497609 GAAATGGTCCAGATAAAAGGAGG + Intronic
1010931114 6:81804461-81804483 GAAATGTTGCAGATTAATTGGGG - Intergenic
1011258469 6:85448556-85448578 AAACTGTCACAGATTAGAGGAGG + Intergenic
1011855161 6:91680812-91680834 GAACTGCATCAGAATAAAAGAGG - Intergenic
1012426930 6:99124958-99124980 GAAATGCTCCAGATTAAAGGAGG + Intergenic
1012518501 6:100092229-100092251 GAACTGTAGTAGAGTAAAGGAGG + Intergenic
1014317161 6:119882375-119882397 GACTGGTTCCAGATTAAAGGAGG - Intergenic
1014353504 6:120374187-120374209 GAACACTTTCAGAGAAAAGGAGG - Intergenic
1014822864 6:126012531-126012553 GAAGTGTTACAAATTAAAGGAGG - Intronic
1014981520 6:127951332-127951354 GAATTGTTTCATATTAAAAGAGG - Intergenic
1015244237 6:131059889-131059911 GAAATGTTTCTAAATAAAGGTGG + Intronic
1017202287 6:151768405-151768427 GAACAGTTCCAGACCAAAGGAGG + Intronic
1017572753 6:155764926-155764948 GAGCTGTTTCAGTTTCATGGTGG + Intergenic
1017655232 6:156621164-156621186 GAACTGTTGCAAATTAAAGGAGG + Intergenic
1017993949 6:159514648-159514670 GAACCGTTCCAGATTAGAAGAGG + Intergenic
1021063398 7:16142384-16142406 AAACTGTTTCACATTAAGTGTGG - Intronic
1021855723 7:24853483-24853505 GAACTGTTCCCAATTAAAGGAGG + Intronic
1022022256 7:26412117-26412139 GAAGTGATTAAGGTTAAAGGAGG + Intergenic
1022520093 7:31000590-31000612 GAGCTGTGTGAGATTAGAGGAGG + Intergenic
1024696750 7:51865765-51865787 GGAATGTTTCAGAAGAAAGGTGG - Intergenic
1026181667 7:68046747-68046769 GCACTGTTTCTGAGAAAAGGAGG - Intergenic
1026811200 7:73467296-73467318 GAGATGTTTCAGGTTAAAGTGGG - Intronic
1027698867 7:81443884-81443906 GAAATGTTTAAGATTACACGTGG - Intergenic
1027781474 7:82525865-82525887 GAACTCTTCCATACTAAAGGAGG + Intergenic
1030671578 7:112344032-112344054 AAACTATTTCAGATTAAAGGTGG + Intergenic
1030938504 7:115616212-115616234 GAAGTAATTAAGATTAAAGGAGG + Intergenic
1034597446 7:152211534-152211556 GCATTGTTTCAGGTGAAAGGTGG - Intronic
1037572357 8:20169250-20169272 GAACTTTTCCAGATTAAAAGAGG + Intronic
1038254046 8:25934422-25934444 GCAGTGTTTCAGAATAAATGAGG - Intronic
1038976835 8:32707425-32707447 GAACTGTTTCAGAGCAATTGAGG + Intronic
1039243016 8:35577330-35577352 GAACTTATCCAGATTAAAGAAGG - Intronic
1039515132 8:38126309-38126331 GAACTGTTTGAGATTGGAAGAGG + Intronic
1043571871 8:81613146-81613168 GAAATGTTCCAGATCAAAGGAGG + Intergenic
1043577104 8:81670619-81670641 GAAATGTTCCAGATCAAAGAAGG + Intronic
1044708738 8:95034494-95034516 GAAATGTTCCAGAATAAAGGAGG - Intronic
1046734233 8:117759220-117759242 GAAATGTTTCAGATAAAAGGAGG + Intergenic
1047221662 8:122923599-122923621 ACACTGTGGCAGATTAAAGGTGG - Intronic
1047363056 8:124186634-124186656 GAACTATTCAAGATGAAAGGAGG + Intergenic
1047596665 8:126384904-126384926 AAACTGTTGTAGATTAAAGGAGG + Intergenic
1047748931 8:127865708-127865730 GAACTGTATCATAATAAATGTGG + Intergenic
1047959918 8:130003811-130003833 GACCTGTCTCAGAATAAATGAGG - Intronic
1048491585 8:134898758-134898780 GAAGTGTCTCAGATTAAAGGAGG - Intergenic
1049113224 8:140662935-140662957 GAGCTGTTTCAGATGAAAGGAGG + Intronic
1049385758 8:142342177-142342199 GGACTGTTTCAGCTTGAGGGAGG - Intronic
1050726850 9:8659736-8659758 GATCTGTTTGAGAATAAAGAAGG + Intronic
1051263234 9:15286273-15286295 AAAATGTTTCAGATTAAAGGAGG - Intronic
1051581312 9:18678773-18678795 GGCCTGATTCAGATTAAAGTTGG - Intronic
1055440189 9:76329477-76329499 GAAACATTTCATATTAAAGGAGG - Intronic
1055657704 9:78468516-78468538 AAACTCTTGTAGATTAAAGGAGG + Intergenic
1056372458 9:85970755-85970777 GAAATGCTCCAGATTAAAGGAGG + Intronic
1057093415 9:92281894-92281916 GAGCTCTTTAAGATTAAAGAAGG + Intronic
1060227393 9:121801888-121801910 AAAATGTTCCAGATTAAAAGAGG - Intergenic
1060429008 9:123532408-123532430 GAACTATTCTAGATTAAAGGAGG - Intronic
1062275578 9:135728812-135728834 GAGCTGTTCCAGATTAAAAAGGG - Intronic
1186932092 X:14405074-14405096 AAACAGCTTCAGAATAAAGGAGG - Intergenic
1187552536 X:20320498-20320520 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1187886827 X:23896624-23896646 GATCTGTTTCACAGCAAAGGAGG + Intronic
1189009601 X:37034003-37034025 GAACTAGTCCATATTAAAGGAGG - Intergenic
1189487655 X:41445551-41445573 GAAATGTTTCAGTTCACAGGTGG + Intergenic
1190386182 X:49884224-49884246 GAAATGTTCCAGATTAAAGGAGG - Intergenic
1191692609 X:63956570-63956592 GAAATGTTTCAGATATAATGAGG - Intergenic
1193698719 X:84739302-84739324 GAACTTCTCCAGAATAAAGGAGG - Intergenic
1194695804 X:97048274-97048296 GAAATGTTCCACATTAAATGAGG - Intronic
1194738979 X:97549745-97549767 GAACTGTTCCAGATTAAAGGAGG - Intronic
1194763426 X:97821165-97821187 AAACTGTTTCAAATTAAAGAAGG - Intergenic
1194812903 X:98407605-98407627 GGCCTGTTTCAGAAGAAAGGGGG - Intergenic
1195798347 X:108678889-108678911 GAACTGTTTCAGATTAAAGAAGG - Intronic
1195977763 X:110546185-110546207 AAACTGTTCCAGAGTAAAGAAGG - Intergenic
1196198674 X:112861390-112861412 GAAATGTTCCAGATAAAATGGGG + Intergenic
1196940139 X:120767706-120767728 GAAATGTTCCAGATTAAAAGAGG - Intergenic
1196960531 X:120995247-120995269 GAACTGCTTCAGATAAAATGCGG + Intergenic
1197186694 X:123595327-123595349 GAACTGCTACAGATTAAAGAAGG + Intergenic
1197989387 X:132300870-132300892 GAACTGATTTAAATTATAGGAGG + Intergenic
1198011307 X:132557904-132557926 GGAATGTTTCAGAATAAAAGAGG + Intergenic
1198399268 X:136253492-136253514 GAAGTGTTCCAGATCACAGGAGG + Intronic
1199253042 X:145686520-145686542 GAATTGTTTCTGACTAAAGAAGG - Intergenic
1200832041 Y:7695701-7695723 GAACTATGTCAGGTTACAGGTGG + Intergenic