ID: 935014200

View in Genome Browser
Species Human (GRCh38)
Location 2:99164478-99164500
Sequence ACTCATAAACAGAGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935014200_935014204 10 Left 935014200 2:99164478-99164500 CCCAGCTCCCTCTGTTTATGAGT 0: 1
1: 0
2: 0
3: 15
4: 174
Right 935014204 2:99164511-99164533 TAATATATCTCAGTAGTTCCAGG 0: 1
1: 0
2: 1
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935014200 Original CRISPR ACTCATAAACAGAGGGAGCT GGG (reversed) Intronic
900757227 1:4444646-4444668 ACTGACAACCTGAGGGAGCTTGG + Intergenic
901122315 1:6905823-6905845 CCTCATATACAGAGTGTGCTCGG + Intronic
902708576 1:18223193-18223215 AACCATAAACAGAGAGACCTGGG - Intronic
906281608 1:44558289-44558311 ACGCATATACAGTGGGGGCTGGG - Intronic
908953631 1:69593954-69593976 ACTCATAAGCTGAGAGACCTTGG + Intronic
912455559 1:109794515-109794537 ACCCATAATCAGAGAGTGCTTGG - Intergenic
917786959 1:178469312-178469334 AGTCTTAAGCAGAGGGAGCTTGG + Intronic
921426545 1:215008486-215008508 ACTTATAAACAGAGTGACTTTGG + Intronic
922009188 1:221564010-221564032 ACTCATAAACTGAGGAGGCCAGG + Intergenic
922507299 1:226133962-226133984 ACTCACAAACACAGGGATCCAGG + Intergenic
922912271 1:229227573-229227595 ACTCATTAACAGAAGTACCTGGG + Intergenic
924141250 1:241026202-241026224 CCTCACACACAGAGGGAACTCGG + Intronic
1063198530 10:3765510-3765532 ACTCAGAAACAGAAAGATCTGGG - Intergenic
1063705943 10:8430911-8430933 AGTCCTTAACAGAGGGAGGTGGG - Intergenic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1064724814 10:18268066-18268088 ACTCAGATGCAGAGGGAGGTGGG - Intronic
1068148032 10:53096699-53096721 ACTCATTAACAGAAAGAGGTTGG + Intergenic
1071284447 10:84131653-84131675 ACTCTAACACAGAAGGAGCTAGG - Intergenic
1071892650 10:90028436-90028458 ACTCAGGCACAGAGGGAGCAGGG - Intergenic
1074913893 10:117937701-117937723 ACACAGAAAGAGAGGGAGCTGGG + Intergenic
1076282327 10:129258809-129258831 CCTCATAAACAGAGGGCCATCGG + Intergenic
1077338551 11:2016104-2016126 ACACAGAAGCAGAGGGAGATGGG - Intergenic
1078490087 11:11760439-11760461 ACTCAGAAACTCAGGGAGATTGG - Intergenic
1079946964 11:26755858-26755880 ACTCATGAACAGAGGGAAGGGGG + Intergenic
1080141842 11:28931077-28931099 ACTCAAACACAGAGGGAGATGGG - Intergenic
1080595532 11:33771186-33771208 AGTCATAAACAAAGGGACTTGGG + Intronic
1083916592 11:65748962-65748984 TCTCATCAACAAATGGAGCTAGG - Intergenic
1084629255 11:70335378-70335400 ACTCATGGACACAGGGAGCACGG - Intronic
1086420935 11:86636392-86636414 ACTCATGAAGAGAGGGAGTGAGG + Intronic
1088842559 11:113639149-113639171 ATTCACAAACAGAGGGAATTTGG + Intergenic
1090889097 11:130907216-130907238 ACTCATAAGCAGAGGTATCATGG + Intronic
1091060695 11:132458875-132458897 CCTCATAAAGTGAGGGAGTTAGG + Intronic
1091242031 11:134059492-134059514 ACTCAGCACCAGAGAGAGCTTGG - Intergenic
1202821535 11_KI270721v1_random:71286-71308 ACACAGAAGCAGAGGGAGATGGG - Intergenic
1091901380 12:4146810-4146832 ACGCATATGCAGAGGGAGTTGGG - Intergenic
1097413092 12:59279836-59279858 ACTCAAAAGCAAAGAGAGCTTGG - Intergenic
1097649073 12:62273370-62273392 ACTCTTGAACAAAGGGACCTTGG + Intronic
1099503909 12:83448564-83448586 CCTCATAACCAGTGGGAGATAGG + Intergenic
1101294892 12:103411871-103411893 ACACATACACAGAGGGAGACAGG + Intronic
1106711124 13:32334257-32334279 ACTCATAAACATTCAGAGCTTGG + Intronic
1112711901 13:102138712-102138734 CCTCCTGAACAGAAGGAGCTGGG + Intronic
1113025572 13:105937581-105937603 ACCCATAAACAGAGTGCACTGGG + Intergenic
1113613505 13:111664698-111664720 CCTTATAAAAAGAGGGAGTTTGG + Intronic
1114067099 14:19070173-19070195 ACTCAGAGCCAGATGGAGCTAGG + Intergenic
1114095166 14:19329855-19329877 ACTCAGAGCCAGATGGAGCTAGG - Intergenic
1115314903 14:32015276-32015298 CCTCATAAACAGAGTGACCAAGG + Intronic
1115518855 14:34212818-34212840 ATTCATAAACCCTGGGAGCTGGG + Intronic
1116892136 14:50279366-50279388 ACTCTTAAACTGTGGGGGCTGGG + Intronic
1119607514 14:76033422-76033444 CCTCCAAAACAGACGGAGCTTGG + Intronic
1121208895 14:92191665-92191687 ACCCATAAACAGAGGAAGTGGGG - Intergenic
1121778272 14:96605350-96605372 ACTGATACACAGAGGGAATTGGG + Intergenic
1122867358 14:104613268-104613290 TCTCCTCCACAGAGGGAGCTGGG - Intergenic
1123579338 15:21702656-21702678 ACTTATAAAAAGAGTCAGCTAGG + Intergenic
1123615965 15:22145167-22145189 ACTTATAAAAAGAGTCAGCTAGG + Intergenic
1124445109 15:29723354-29723376 ACTTTTAAACAGACAGAGCTTGG - Intronic
1128740290 15:70079039-70079061 CCTCATAACCAGAGTGAGCTGGG - Intronic
1129566136 15:76625317-76625339 ACCCATATGCAGAGGCAGCTGGG + Intronic
1202988208 15_KI270727v1_random:436901-436923 ACTTATAAAAAGAGTCAGCTAGG + Intergenic
1135004667 16:18809149-18809171 ACTCAGAAACAGAGAAAACTGGG - Exonic
1136599298 16:31273812-31273834 CCTCAGAAACAGAGAGAGCCTGG - Intronic
1138116865 16:54367800-54367822 ACTCATAGAAAGAGGCTGCTAGG - Intergenic
1138648362 16:58441858-58441880 ACTCAGGCACAGAGGGAGGTAGG + Intergenic
1139110145 16:63880532-63880554 ACACATAAACAGAGTGGCCTGGG + Intergenic
1140204691 16:72924263-72924285 CCTGTTTAACAGAGGGAGCTGGG - Intronic
1140741746 16:77947754-77947776 CCTCAAAAACAGAGGGAGGTAGG - Intronic
1143311864 17:5998727-5998749 ACTCACTCACAGAGGCAGCTGGG + Intronic
1143695098 17:8608782-8608804 AATCATAGACAGAGGAAGATGGG - Intronic
1144848209 17:18230942-18230964 ACTCACCAACAGAGGCCGCTGGG - Intronic
1146780195 17:35663786-35663808 ACTCATATACTCAGGGACCTGGG - Intronic
1148797092 17:50202123-50202145 TCTCCAAAACAGAGGAAGCTGGG + Intergenic
1149236595 17:54598231-54598253 ACACAGAAACAGAGGGGGTTGGG + Intergenic
1150599653 17:66639699-66639721 ATTAATAAACAGAGGAGGCTGGG + Intronic
1151868807 17:76822616-76822638 GCTCATACCCAGAGGGTGCTAGG - Intergenic
1153184507 18:2471545-2471567 ACTCATGAACAAAGGGACCATGG + Intergenic
1153628187 18:7041832-7041854 ACTCATGAATGGAGGGAGATGGG - Intronic
1156536868 18:37872713-37872735 AGTCAGAAAGACAGGGAGCTAGG + Intergenic
1157774142 18:50377989-50378011 ACTCATGAGCTGAGGGACCTGGG - Intronic
1157994149 18:52535006-52535028 ACTCATTGACAGGGGGAGATGGG - Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158256352 18:55553568-55553590 ATACATAAACACAGGGAGTTGGG - Intronic
1161525483 19:4752400-4752422 GCTGAAAAACAGAGGGAGTTTGG - Intergenic
1164838280 19:31372922-31372944 ACCACAAAACAGAGGGAGCTTGG + Intergenic
925841660 2:7997779-7997801 CCTCATAAACTGACAGAGCTGGG + Intergenic
928418135 2:31113799-31113821 ACTCAGGCACAGAGGGAGGTGGG + Intronic
931573826 2:63698734-63698756 ACTCAGAAAAAGAGGGAGGGGGG + Intronic
931848140 2:66225675-66225697 ACACATAGACAGTGGGAGTTGGG - Intergenic
935014200 2:99164478-99164500 ACTCATAAACAGAGGGAGCTGGG - Intronic
935811360 2:106800652-106800674 ACTCAGAGACAGCAGGAGCTAGG - Intergenic
936786906 2:116104302-116104324 CCTCATTAAAAGTGGGAGCTGGG - Intergenic
937497284 2:122434442-122434464 AGCCATGAACAGAGGGAGATGGG - Intergenic
942594372 2:177578934-177578956 TCTCAAAAGCAGAGGCAGCTAGG - Intergenic
946619164 2:221542437-221542459 ACTCATAAAGAAAGGGAATTAGG + Intronic
948313284 2:237006058-237006080 TCTCTTTCACAGAGGGAGCTTGG + Intergenic
948330646 2:237161667-237161689 ACTAATGAACAATGGGAGCTGGG + Intergenic
948785545 2:240350573-240350595 ACTCAGAGAGAGAGGGTGCTGGG + Intergenic
1169030036 20:2399934-2399956 AATGAGAGACAGAGGGAGCTAGG - Intronic
1169949943 20:11032787-11032809 ACTCACAGAGAGAGGGCGCTAGG + Intergenic
1170535707 20:17338684-17338706 ACTCAGAAACAGAGTGAGAGAGG + Intronic
1173706353 20:45113228-45113250 TCTTATAAACAGAGGCGGCTGGG + Intronic
1178121388 21:29473719-29473741 GCTCACAGACAGAGGGAGCAGGG - Intronic
1180485576 22:15792757-15792779 ACTCAGAGCCAGATGGAGCTAGG + Intergenic
1183275445 22:36894205-36894227 GCTCATAAACAGAGAAAACTAGG + Intergenic
1184123597 22:42471023-42471045 CCTGAGATACAGAGGGAGCTGGG - Intergenic
950092148 3:10303653-10303675 ACCCATAAACAGAAGAAGATTGG - Intronic
950191716 3:10981219-10981241 ACTCAAGGAGAGAGGGAGCTGGG - Intergenic
954379696 3:50213028-50213050 CCTCATAACCAGAGGTGGCTGGG - Intronic
954895300 3:53970145-53970167 AATAATAAACAAAGGGACCTCGG + Intergenic
954940865 3:54371980-54372002 ACTCATACACAGAGAGGTCTGGG - Intronic
958258435 3:91351742-91351764 ACTCAAAAAGAGAGGAAGTTTGG + Intergenic
961043784 3:123695063-123695085 ACTCAGAAAAGGAGAGAGCTGGG - Intronic
962490344 3:135887522-135887544 ACTCACAAACAGATGGGACTAGG + Intergenic
963037296 3:141042788-141042810 AATCATACAAAGAGGGTGCTCGG + Intergenic
963586191 3:147192261-147192283 ACTGAGAAAAAGAGAGAGCTTGG - Intergenic
963907158 3:150782346-150782368 ACTCATAGACAGTGGGATATAGG + Intergenic
964408980 3:156378863-156378885 ACCCAAAAACAGAGGGAGGAGGG + Intronic
966007445 3:175033223-175033245 CCTCAGAAAAGGAGGGAGCTAGG - Intronic
967393408 3:188979742-188979764 ATTCATAATCAGAGGGAGGAGGG - Intronic
970977770 4:22060523-22060545 ACAGAAAAACAGAAGGAGCTGGG - Intergenic
971256883 4:25022545-25022567 ACACAAACACAGAGGGAGCGAGG - Intronic
972525180 4:39903028-39903050 ATTCCTAAACACAGGGTGCTAGG + Intronic
972922567 4:43962024-43962046 ACTCATAGACTGAGTGAGATGGG + Intergenic
978283399 4:107044689-107044711 ACTCAGAAACAGAGGCAGGTAGG + Intronic
980011157 4:127596220-127596242 TCTCATAAACTGAGGAAGTTTGG + Intergenic
980953944 4:139409332-139409354 ATTCATAAGCAGTGGGGGCTGGG + Intronic
982217040 4:153091439-153091461 ACTCATCAACTGGGGGACCTAGG + Intergenic
983721907 4:170865689-170865711 CCTCAGAAACACAGGGAGCAAGG - Intergenic
985975102 5:3413098-3413120 AGACATACACAGAGAGAGCTGGG - Intergenic
986643543 5:9894431-9894453 ACACACAAACAGAGGCAGCAGGG + Intergenic
987120501 5:14762410-14762432 ACTCTGAAACCAAGGGAGCTAGG - Intronic
987680210 5:21125751-21125773 TCTCATGAAGGGAGGGAGCTTGG + Intergenic
990123037 5:52479536-52479558 AGGCATAAACAAAGGCAGCTTGG + Intergenic
995062043 5:107821709-107821731 TCTCATGCACAGAGGGTGCTTGG + Intergenic
996854664 5:127991947-127991969 ACTCATAAACAAGGGAAGCTAGG - Intergenic
1000105922 5:158058664-158058686 TCGCATAAAAAGAGGAAGCTAGG + Intergenic
1001227005 5:169953398-169953420 TCTCAGAAATAGAGGAAGCTAGG - Intronic
1002076917 5:176713762-176713784 ACAGATAAACAGAAGGAGCCTGG - Intergenic
1002858812 6:1061693-1061715 GCTCTTCAGCAGAGGGAGCTAGG + Intergenic
1004173020 6:13313561-13313583 ACGCATACACACAGGGAGCCTGG + Intronic
1007162622 6:39804125-39804147 TCCCATAAACAGAGGAGGCTGGG - Intronic
1008996826 6:57668945-57668967 ACTCAAAAAGAGAGGAAGTTTGG - Intergenic
1009185341 6:60568279-60568301 ACTCAAAAAGAGAGGAAGTTTGG - Intergenic
1011880867 6:92024357-92024379 CATCATAAACAGAGGAATCTTGG + Intergenic
1013942786 6:115685045-115685067 ACACATGAACACAGGGAACTTGG - Intergenic
1014479869 6:121922465-121922487 ACTCAAGCACAGAGGGAGCTAGG + Intergenic
1015845359 6:137514753-137514775 TCTCAAGAACAGAGGCAGCTGGG - Intergenic
1016860772 6:148716601-148716623 ACTCATATAGAGAGGGAGCAGGG - Intergenic
1017411062 6:154168434-154168456 CCTCATAAATAGGGGGAGTTTGG - Intronic
1017547847 6:155470560-155470582 ACTCATTAACAGAGGCTGCCTGG - Intergenic
1021803107 7:24327809-24327831 ACTCATAAACAGGAGCAGCCCGG - Intergenic
1028061225 7:86319262-86319284 ACTACTAAACAGAGGGAGGAAGG + Intergenic
1034715657 7:153239044-153239066 ACTCATTACCAGTGGGAGGTAGG + Intergenic
1035629498 8:1097169-1097191 TCTCCTGAGCAGAGGGAGCTGGG - Intergenic
1035629519 8:1097259-1097281 TCTCCTGAGCAGAGGGAGCTGGG - Intergenic
1035629614 8:1097619-1097641 TCTCCTGAGCAGAGGGAGCTGGG - Intergenic
1035629635 8:1097709-1097731 TCTCCTGAGCAGAGGGAGCTGGG - Intergenic
1037871621 8:22502824-22502846 AATCATTAACAGTGGGAGGTTGG + Intronic
1038461521 8:27721113-27721135 ACTCATGAAATGAGGGAGGTGGG - Intergenic
1038655250 8:29444897-29444919 ATCCCTAAAGAGAGGGAGCTTGG - Intergenic
1038737819 8:30188299-30188321 TCTCAGAAACTGAGTGAGCTGGG + Intergenic
1042091291 8:65162487-65162509 ACTCCTGATCAGAGGGAGCCTGG + Intergenic
1044235689 8:89827313-89827335 ACTCAAAAACTAATGGAGCTGGG - Intergenic
1044599692 8:93991477-93991499 AGTCGTCAACAGAGGGAGCTGGG + Intergenic
1044650538 8:94489850-94489872 TATCATATACAGAGGGGGCTAGG - Intronic
1044715508 8:95096027-95096049 ACTTAAAAACTGAAGGAGCTAGG - Intronic
1047021664 8:120781657-120781679 ATTCATAAAAAGAGGTAGGTTGG - Intronic
1047040474 8:120989201-120989223 ACACATAAACAGAGGGATTATGG + Intergenic
1048494779 8:134925973-134925995 AATCATAAACAAAGGGAGACAGG - Intergenic
1049424498 8:142532125-142532147 CCTCCTACACAGGGGGAGCTGGG - Intronic
1052644174 9:31211144-31211166 ACTCATAAAAAGAGGAATTTTGG + Intergenic
1059780554 9:117521873-117521895 AGCCATAAACAGAGGAAGCTGGG - Intergenic
1059939052 9:119339998-119340020 ACTGAAACACAGGGGGAGCTTGG - Intronic
1060401622 9:123353071-123353093 ACTCAGACACAGAGGGAGCAGGG + Intergenic
1061524659 9:131149455-131149477 ACTGTTAAAGAGAGGGATCTAGG - Intronic
1061998620 9:134204289-134204311 AATCAGAAACAGAAGGAGCAGGG - Intergenic
1185847123 X:3447974-3447996 AGTCATAAACAGAGGGTTCTGGG + Intergenic
1185860522 X:3574452-3574474 AATCACACACAGAGAGAGCTGGG + Intergenic
1186040038 X:5465907-5465929 ACTGAACAACAGAGGGATCTGGG - Intergenic
1187493541 X:19774991-19775013 ACTACTAAACAGAGAGGGCTTGG - Intronic
1189201477 X:39199659-39199681 CCTCATAAACAGAGGAAGTCAGG - Intergenic
1190394925 X:49972350-49972372 ACACAAAAACAGAGGGAGGAAGG - Intronic
1190636307 X:52437423-52437445 AATCATAAACAGAGGGAGGCTGG + Intergenic
1192016442 X:67336548-67336570 ACTTATAAAAAGAAGGAGTTGGG + Intergenic
1195773879 X:108381927-108381949 AGTCATAAAGAGAGAGAGATAGG - Intronic
1195925789 X:110023283-110023305 AGTCATAAACACACTGAGCTTGG - Intronic
1197563804 X:128056033-128056055 AGTCATAGAAAGAGGTAGCTGGG + Intergenic
1198058678 X:133021329-133021351 ACTCAGGAACAGAGGGAGTCAGG + Intergenic
1199700097 X:150369241-150369263 ACTAATTAACAGAGTGATCTTGG + Intronic
1200804493 Y:7418945-7418967 AACCACACACAGAGGGAGCTGGG - Intergenic
1200817363 Y:7547663-7547685 AGTCATAAACAGAGGGTTCTGGG - Intergenic
1201546950 Y:15175752-15175774 ACTGAACAACAGAGGGATCTGGG + Intergenic