ID: 935014635

View in Genome Browser
Species Human (GRCh38)
Location 2:99168993-99169015
Sequence TTAAAGAGACAGATGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 376}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935014635_935014638 11 Left 935014635 2:99168993-99169015 CCAAGCTCCATCTGTCTCTTTAA 0: 1
1: 0
2: 1
3: 37
4: 376
Right 935014638 2:99169027-99169049 TCCATGGTGTCTTTCCCTCCTGG 0: 1
1: 1
2: 0
3: 13
4: 206
935014635_935014643 29 Left 935014635 2:99168993-99169015 CCAAGCTCCATCTGTCTCTTTAA 0: 1
1: 0
2: 1
3: 37
4: 376
Right 935014643 2:99169045-99169067 CCTGGACTTAAAACTCCCACAGG 0: 1
1: 0
2: 0
3: 8
4: 137
935014635_935014637 -5 Left 935014635 2:99168993-99169015 CCAAGCTCCATCTGTCTCTTTAA 0: 1
1: 0
2: 1
3: 37
4: 376
Right 935014637 2:99169011-99169033 TTTAAAAGCACTCTAATCCATGG 0: 1
1: 0
2: 1
3: 19
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935014635 Original CRISPR TTAAAGAGACAGATGGAGCT TGG (reversed) Intronic
901672564 1:10864797-10864819 TTACAGAAACACAAGGAGCTAGG + Intergenic
902239985 1:15081963-15081985 TGAAAGAGAAAGAGGGAGGTAGG + Intronic
902279193 1:15362016-15362038 AGAAAGAGAGAGATTGAGCTGGG + Intronic
902997194 1:20235720-20235742 TTAAAGAGATAGATGGCCCTTGG - Intergenic
903991687 1:27275633-27275655 ATAAAGAAAAAGATGGAGCGGGG + Intronic
904132949 1:28288842-28288864 TTGTAGGGACAGAAGGAGCTGGG + Intergenic
904275664 1:29382632-29382654 TAAAAGTGAGAGATGGAGATGGG - Intergenic
904381769 1:30116207-30116229 TAAGAGAGGTAGATGGAGCTGGG - Intergenic
904443415 1:30548199-30548221 TTAATGTGACAGATACAGCTGGG - Intergenic
904490240 1:30854138-30854160 TTAACAAGACAGAAGGAACTTGG - Intergenic
904722979 1:32524581-32524603 TTAAAGAGACAGAGTTGGCTGGG - Intronic
905218716 1:36429088-36429110 TCAAAGAGAAAGGTGAAGCTGGG + Intronic
906474601 1:46160449-46160471 TTAAAAAGACAGTTTGAGCTAGG - Intronic
906712096 1:47938342-47938364 CTCCAGAGACAGATAGAGCTGGG - Intronic
906799615 1:48724816-48724838 TGAAACAGAAAGATGGGGCTTGG - Intronic
907227014 1:52957222-52957244 TTAAATAGACAGAAGGGGCCAGG - Intronic
907411550 1:54287121-54287143 TTAAAGAGAGGGTTGGAGCGGGG - Intronic
907780234 1:57559954-57559976 TGCAAAAGACAGATGGATCTTGG + Intronic
909274296 1:73665449-73665471 TGAAAGTGACAAATGGAACTGGG + Intergenic
909358843 1:74739496-74739518 TTAAAGGAACAGAAAGAGCTAGG + Intronic
909531110 1:76682664-76682686 TTAAAGAGCCAGATGGTGCATGG + Intergenic
909891270 1:81010171-81010193 TTAAAAAGACAGAAGGAGCAAGG + Intergenic
910315484 1:85877656-85877678 TTAAAAACACACATGAAGCTGGG - Intronic
910585390 1:88873633-88873655 TCAAAAAGATAGAAGGAGCTTGG - Intronic
910624477 1:89291908-89291930 TCAAATTGAAAGATGGAGCTGGG + Intergenic
911720598 1:101187119-101187141 GAAAAGAGTCAGATAGAGCTGGG - Intergenic
912204690 1:107496781-107496803 TTAAAGACACAGGGGGAGCTGGG + Intergenic
912554940 1:110509032-110509054 TTAAAGAGATAGATGAAACAAGG - Intergenic
915971117 1:160355973-160355995 GTAAATAGAAAGAAGGAGCTAGG - Intronic
916619134 1:166476743-166476765 TTAAAGAGATAAATGCAGCTTGG + Intergenic
916986997 1:170202328-170202350 TTGAAAAGGCAGAGGGAGCTTGG - Intergenic
917736940 1:177929989-177930011 TTGATTGGACAGATGGAGCTAGG + Intronic
919776564 1:201198107-201198129 TAAGAGAGGCAGATGGACCTGGG - Intronic
920498222 1:206470391-206470413 TTAAAGAGACAGAGGCAACTCGG - Intergenic
920557396 1:206914161-206914183 TTGGAGAGACGGCTGGAGCTGGG - Intronic
920639763 1:207741016-207741038 TTACAGAGACAGAGGGAGGGGGG - Intergenic
920767760 1:208849919-208849941 ATAAAGTCACAAATGGAGCTAGG - Intergenic
921252132 1:213308014-213308036 TTAAAGAGAAAGAAGAGGCTGGG + Intergenic
921874485 1:220178833-220178855 TAAAAGACACAGAGTGAGCTGGG + Intronic
922614521 1:226953853-226953875 CTAAAGAGACTCATGGAGTTTGG + Intronic
922770221 1:228177732-228177754 TTAAAGACACAGAAGAGGCTGGG - Exonic
922813668 1:228433630-228433652 TTAAGGAGACAAAAGCAGCTAGG - Intergenic
923636376 1:235701332-235701354 TTAAAGTGACAGATTGGGCTGGG + Intronic
924431760 1:244003453-244003475 TTAAAGAGACGGGAGGTGCTAGG + Intergenic
924576142 1:245282732-245282754 GTATAGAGACAGAGGGAGCGGGG - Intronic
1063936809 10:11086870-11086892 TTAAAGGGACAGGAGGAGATGGG + Intronic
1064149912 10:12854056-12854078 TTAAAGAGAGATAGGAAGCTAGG + Intergenic
1064417089 10:15159279-15159301 TTAGAAAGACAGATGGACCTTGG + Intronic
1065550041 10:26860895-26860917 TTAAAGAGACAGAGGCAGCAAGG + Exonic
1065880341 10:30032047-30032069 TTAAAAATACAGATGGAGCCGGG - Intronic
1065960957 10:30733947-30733969 TTAAAAAGACATTTGGGGCTGGG + Intergenic
1066186576 10:33015141-33015163 TTTAAGAGACAGAGTCAGCTGGG - Intergenic
1066493020 10:35912884-35912906 TTTAAAAAACAGATGGAGATGGG + Intergenic
1068704709 10:60061750-60061772 TTTAAGAGACAGACAGTGCTTGG + Intronic
1068743871 10:60506398-60506420 TTAAAGAGAAAGATGTGGCTGGG + Intronic
1069024722 10:63527339-63527361 CTAAAGAGACAGAGGGAAATGGG - Intronic
1069735452 10:70650988-70651010 TTAGAAAGACTGATGGAACTTGG + Intergenic
1069790947 10:71020451-71020473 TGAAAAAGACAGATAGATCTTGG - Intergenic
1070614493 10:77958932-77958954 TTTTAGAGTCAGATGGAGCAGGG + Intergenic
1070914676 10:80145155-80145177 TTATAGGGGCAGATGGAGCAGGG + Exonic
1071950913 10:90701808-90701830 TAAAGAAGACAGATGGATCTTGG - Intergenic
1073018176 10:100418824-100418846 TTAAGTACACACATGGAGCTGGG + Intergenic
1073300326 10:102467329-102467351 TTAAAAAGACATATGGGGCTGGG - Intronic
1075018555 10:118929415-118929437 TTTAAAAGACAGTTGGGGCTGGG + Intergenic
1075040138 10:119101618-119101640 TGTCACAGACAGATGGAGCTGGG - Intergenic
1075386507 10:122059210-122059232 TTAAAAACACAGATGGAGCCCGG - Intronic
1076294352 10:129373102-129373124 ATGAAGAGACAGACTGAGCTTGG - Intergenic
1077236732 11:1485520-1485542 ATGAAGAGAAAGATGGAGCCGGG + Intronic
1078248620 11:9599053-9599075 TTAAAGAGACCTATGCAGCCAGG + Intergenic
1079202464 11:18387312-18387334 TCTGAGAGACAGATGGGGCTTGG + Intergenic
1079513229 11:21235501-21235523 CTATAGAGACTGATGGAGCGGGG + Intronic
1079664834 11:23092410-23092432 GTAATGAGACAGATGGAGAGTGG + Intergenic
1080020242 11:27552558-27552580 TGCAGAAGACAGATGGAGCTTGG - Intergenic
1080118575 11:28648120-28648142 TTGAAGAGCCAGATGGGGCAAGG + Intergenic
1080772321 11:35353217-35353239 TGATAGAGACAGATGGGGTTGGG + Intronic
1081310106 11:41560417-41560439 TTATAGAGACAAATGGACTTGGG + Intergenic
1082843679 11:57710446-57710468 TTAGGGAGAGAGATGAAGCTGGG - Intronic
1083043279 11:59708708-59708730 TTAGAAAGAGAGATGGAGATAGG - Intergenic
1084496428 11:69506522-69506544 TTAAAAAGGCAGATGGTGTTAGG - Intergenic
1085434437 11:76486980-76487002 TTAATAAGACAGATGAGGCTGGG + Intronic
1085877055 11:80421103-80421125 TTAAAGAGAGAGAAAGAGGTTGG + Intergenic
1086600038 11:88622358-88622380 TGAAAGAGTCAGATTGAACTGGG - Intronic
1086952284 11:92903576-92903598 ATAAACACACAGATGGAGATGGG + Intergenic
1088981672 11:114870178-114870200 TTAAGGGGACAGATGGTGCAGGG + Intergenic
1089172080 11:116519211-116519233 CTAAAAAGACACATAGAGCTAGG + Intergenic
1090703339 11:129315426-129315448 TCACAGGGACAGATGGAGCAGGG + Intergenic
1091470592 12:723090-723112 TTAAAGACACAGATGAATTTAGG - Intergenic
1091490921 12:931959-931981 CTAAAGACAAAGATGGAGTTTGG + Intronic
1091763996 12:3106472-3106494 TTAAAAAGAAAGATGGGACTGGG + Intronic
1094346313 12:29473277-29473299 TAAAAGAGCCAGATGGAACAGGG - Intronic
1094614361 12:32022810-32022832 GTAAAGAGACAGAGGGAGGGGGG - Intergenic
1095713194 12:45312374-45312396 TTAAAGAGAAAGACAGAACTTGG + Intronic
1095856343 12:46864567-46864589 TACAAAAGACAGATGGATCTTGG - Intergenic
1095888850 12:47216833-47216855 CTAAAGAGACAACTGGTGCTTGG + Intronic
1096277771 12:50225195-50225217 TTAAAGAGACAGTTGGGGCCAGG - Intronic
1096553417 12:52389032-52389054 TTTTAGAGTCAGATGGACCTGGG + Intergenic
1096604104 12:52752741-52752763 CTCAGGACACAGATGGAGCTGGG - Intergenic
1098167478 12:67713231-67713253 GTACAGAGACAGAAGGAGCAGGG - Intergenic
1098578779 12:72074321-72074343 TTCTGGAGACAGATGGACCTGGG + Intronic
1098672929 12:73253343-73253365 TGAAGAAGACAGATGGATCTTGG + Intergenic
1098733200 12:74064737-74064759 TGAAGAAGACAGATGGATCTTGG + Intergenic
1101532976 12:105591305-105591327 TGAAAGAGAAAGATGAACCTGGG + Intergenic
1101542968 12:105681770-105681792 TGCAAAAGACAGATGGATCTTGG + Intergenic
1101814481 12:108135344-108135366 TTATGGAGGCAGATGAAGCTGGG + Intronic
1102363897 12:112314487-112314509 TTACAGAAACAGACGGATCTAGG - Exonic
1102793787 12:115671106-115671128 CAAATGAGACAGAAGGAGCTAGG + Intergenic
1103053155 12:117798335-117798357 CTAAAGAAACAGAGGAAGCTGGG + Intronic
1103959815 12:124602358-124602380 TTAAAAAGTCACATGTAGCTGGG - Intergenic
1105582114 13:21707999-21708021 CTAAAAGGACTGATGGAGCTTGG + Intergenic
1106114893 13:26808997-26809019 TGAAAGAGACATATGGGGCAAGG + Intergenic
1106390403 13:29329907-29329929 TTATAAAGACACATGCAGCTAGG - Intronic
1106869553 13:34003871-34003893 TTAAATCTACAGATGGATCTTGG + Intergenic
1107403307 13:40090286-40090308 TAGAAGTGACAGAAGGAGCTGGG - Intergenic
1108381640 13:49860317-49860339 TAAAAGAAATAGATGGGGCTTGG + Intergenic
1108680611 13:52777125-52777147 GGAAAGAGACAGAAGGACCTGGG + Intergenic
1108853969 13:54770938-54770960 TTAAAGTGGCAGATGGACTTAGG - Intergenic
1109080253 13:57890552-57890574 AAAAAAAGAAAGATGGAGCTGGG - Intergenic
1109241344 13:59893483-59893505 TAAAAGGGAAAGCTGGAGCTGGG + Intronic
1109304990 13:60628560-60628582 TTTAAGTTACAGAAGGAGCTCGG - Intergenic
1109950255 13:69492546-69492568 TTAAAAATACATACGGAGCTCGG + Intergenic
1110131894 13:72020403-72020425 TTAAAAAGCCTGATGGAACTTGG + Intergenic
1110900354 13:80814828-80814850 TCTAAGAAACAGATGGAGTTTGG + Intergenic
1110953456 13:81522753-81522775 GTAAAGAGACAGAGGGAGGGGGG + Intergenic
1113008717 13:105738803-105738825 TTAGAGAGGTAGATGGAGTTTGG - Intergenic
1113471548 13:110550261-110550283 ATGAAGAGACACATGGAGCAAGG - Intronic
1114556770 14:23566744-23566766 TTAAAGAGGAAGATGGAACAGGG - Intronic
1114701523 14:24683259-24683281 ATAAAGAGACAGACTGAGCCTGG - Intergenic
1115475578 14:33810158-33810180 TGAAAGAGGCAGGTGGAGGTGGG + Intergenic
1115547825 14:34479003-34479025 TTAAAGAGACAGAAGCAGGCTGG - Intergenic
1116258852 14:42595382-42595404 ATAAAAAGGCAGAGGGAGCTTGG - Intergenic
1116774693 14:49166239-49166261 TTACAGAGGGAGATAGAGCTTGG + Intergenic
1116943690 14:50816043-50816065 TGCAAGACATAGATGGAGCTGGG + Intronic
1118008369 14:61585643-61585665 TTAAAGAAAAAGATGTAGGTAGG + Intronic
1119553088 14:75530807-75530829 TTAAAAACACAGAAGGGGCTGGG - Intronic
1119698149 14:76730556-76730578 CTAAAGAGACAGATGGCTATTGG + Intergenic
1120331776 14:83102541-83102563 TCAGGGACACAGATGGAGCTGGG + Intergenic
1120477463 14:85006324-85006346 TCAAAGAGACAGAGAGGGCTGGG + Intergenic
1121786349 14:96663938-96663960 TAAGAAAGACAGAAGGAGCTTGG + Intergenic
1125736876 15:41933144-41933166 TTAGAAAGACAGAGGGAGGTGGG - Intronic
1126279138 15:46922630-46922652 TTAAAGGGACTGAGGTAGCTGGG - Intergenic
1128367979 15:67018267-67018289 GTAAAGAGACAGGTTGATCTGGG - Intergenic
1129179898 15:73867469-73867491 TGGAAGAGACAGACGAAGCTGGG - Intergenic
1129526485 15:76219234-76219256 TTGAACAGATAGATGGTGCTGGG + Intronic
1131281413 15:91024355-91024377 TTTAAGAGACAGATCGGGCCAGG - Intergenic
1132662528 16:1068030-1068052 GTCCAGAGACAGAGGGAGCTGGG - Intergenic
1133087514 16:3376261-3376283 TTAAAAAGAAAGAAAGAGCTAGG - Intronic
1133189046 16:4119874-4119896 TTAAAGAAACAGATGGCGGCTGG - Intergenic
1133741268 16:8653339-8653361 TGAAAGAGACCTATGGAGTTGGG + Intergenic
1133848121 16:9476256-9476278 TTTAAGAGTCAAATTGAGCTGGG + Intergenic
1134252650 16:12585376-12585398 GTAAAGAGACAGATAGAACCTGG + Intergenic
1134781172 16:16896766-16896788 AGAAACAGACAGAAGGAGCTCGG + Intergenic
1134792293 16:16999990-17000012 TTAAAAAGACAGATATAGTTTGG + Intergenic
1135250732 16:20899801-20899823 TTAAAGAGAACGATGGGGGTGGG + Intronic
1136469901 16:30473134-30473156 TTAAAAAGACAGATAGGGCCAGG + Intronic
1137744672 16:50812087-50812109 TTAAAAAGAAAGATTGAGCTGGG - Intergenic
1138737380 16:59266065-59266087 TGACAGGGTCAGATGGAGCTAGG - Intergenic
1140306233 16:73805808-73805830 GTAAAGAGACAGAGGGTGATGGG + Intergenic
1140374148 16:74431400-74431422 GTAAACAGACACAAGGAGCTCGG - Intergenic
1140735697 16:77895982-77896004 TTGGAGAGAAAGATGGAGGTTGG + Intronic
1141107576 16:81246123-81246145 TTAAAGATAGAGATGGAGGCCGG - Intronic
1141848044 16:86624364-86624386 ATAAAGAAAAAGATGCAGCTAGG - Intergenic
1142976570 17:3648240-3648262 GTGCAGAGACAGAAGGAGCTGGG - Intronic
1143355970 17:6328837-6328859 TTCAAGAGATAGATGGTGGTGGG + Intergenic
1143999790 17:11042214-11042236 TCAAACAGACAGAGGGAGCAAGG - Intergenic
1144117032 17:12105859-12105881 TAAAAGAGAAAGATGGACATGGG - Intronic
1144870669 17:18368438-18368460 TAAAAGAGAGAGATTGGGCTGGG - Intergenic
1146782734 17:35689456-35689478 TTAAAGACACATACTGAGCTGGG - Intronic
1148067345 17:44881831-44881853 TTAAAGAGAGAGAGAGAGCAGGG + Intronic
1148848953 17:50545192-50545214 TGAAAGACACAGATGGAGGCAGG - Intronic
1149674242 17:58445282-58445304 TCAAAGAGATAGTTGGAGCCAGG + Intronic
1149735133 17:58986803-58986825 TTAAGATGACAGATGGGGCTGGG - Intronic
1149782713 17:59410608-59410630 TTCAAGTGAGAGATGGAGGTGGG + Intergenic
1150413478 17:64966953-64966975 AAAAAGAGACTGATGGAGCATGG - Intergenic
1150645718 17:66976416-66976438 TTAGAGAGAGGGATGGAGGTGGG - Intronic
1150798342 17:68258281-68258303 AAAAAGAGACTGATGGAGCATGG + Intergenic
1150963917 17:69946238-69946260 GTAAAGATACAGTTGGATCTGGG - Intergenic
1151879243 17:76885265-76885287 TGAGGGAGAAAGATGGAGCTGGG - Intronic
1153905696 18:9659481-9659503 TTAAAAGGACAGATGGCACTGGG + Intergenic
1153931807 18:9885726-9885748 GTAAAGAGAATGTTGGAGCTGGG + Intronic
1155063468 18:22248612-22248634 TTTAAGAGACAAATGGGGATGGG + Intergenic
1155349707 18:24894559-24894581 TGAAAGAGACAGATAGAGCCTGG + Intergenic
1155411101 18:25546128-25546150 CTAAAGAAAGAGATAGAGCTGGG + Intergenic
1155816175 18:30313873-30313895 TCAATGAGAAAGATGGTGCTAGG + Intergenic
1156491208 18:37497356-37497378 TAAAAGAGACAATTGGTGCTGGG + Intronic
1156919072 18:42497317-42497339 TTAAAGAGAGAGATTGAGGTTGG - Intergenic
1157714041 18:49870202-49870224 TTAAAAAGTCAAATGGTGCTGGG + Intronic
1157817208 18:50738307-50738329 TCCAAGAGACATGTGGAGCTGGG + Intergenic
1157843383 18:50980040-50980062 TTAAATAAACAGTTGGAGTTGGG + Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158278773 18:55797821-55797843 TTTAAAAAACAGATGGAGCAAGG - Intergenic
1158620327 18:59027277-59027299 AAAAAGGGACAGCTGGAGCTGGG - Intergenic
1162206088 19:9057184-9057206 TAGAAGAGAGAGATGGAGCTGGG - Intergenic
1162776667 19:12983886-12983908 TGAAAGAGACAGAAGGAGGAAGG + Intergenic
1163831560 19:19549556-19549578 TGAGAGAGACAGACGGGGCTAGG - Intergenic
1165440581 19:35824775-35824797 TTCAATAGAAAGATGGAGCCAGG + Intergenic
1165581547 19:36869301-36869323 GTAAAGAGACACATAGAGCAAGG + Intronic
1167686793 19:50961619-50961641 TTACAGAGACAGATAGAGACAGG - Intronic
925103212 2:1267064-1267086 GTGAAGAGAAAGATGAAGCTGGG - Intronic
925419696 2:3702486-3702508 CTCAGGAGGCAGATGGAGCTGGG - Exonic
927205356 2:20605616-20605638 TTAAAGAGACAGAAGAAGGTAGG - Intronic
927212063 2:20645114-20645136 CTAAAGAGACAGATACAGATGGG - Intronic
927361272 2:22236982-22237004 TTGAATAGAAAGATGGAGATGGG - Intergenic
928125792 2:28614894-28614916 TTAACCAGACAGATGGATCCCGG + Intronic
928308513 2:30191079-30191101 TTACAGAGACAGAGGGAGGGGGG - Intergenic
929534606 2:42773153-42773175 TTATAGAGAAATATGGAGTTAGG - Intronic
931562582 2:63578649-63578671 TTAGAGAGACAGAGGTAGATTGG - Intronic
932427690 2:71651532-71651554 TCAAAGAGAGAGCTGGAGCCAGG + Intronic
932480254 2:72034881-72034903 TGCCAGAGACAGGTGGAGCTGGG + Intergenic
933296670 2:80498699-80498721 TTTAAGAGAGAGATGGGGCATGG - Intronic
934163657 2:89274967-89274989 TTAAAGACACAGGTGCCGCTGGG - Intergenic
934203615 2:89907557-89907579 TTAAAGACACAGGTGCCGCTGGG + Intergenic
935014635 2:99168993-99169015 TTAAAGAGACAGATGGAGCTTGG - Intronic
935076006 2:99744575-99744597 TCCAAGAGACAGATGGAAATTGG - Intronic
936106115 2:109626076-109626098 TTAAAATGACAGGTGGACCTTGG + Intergenic
937035690 2:118779816-118779838 TTCAGGAGTCAGATAGAGCTGGG + Intergenic
937169722 2:119853967-119853989 ATAGAGAGACAGAGGGAGCGGGG + Intronic
937852672 2:126649623-126649645 TGCAGAAGACAGATGGAGCTTGG - Intergenic
938265048 2:129922698-129922720 TTATAGGGGCAGATGGAGCAGGG - Intergenic
939429847 2:142089153-142089175 TTGAAGGGACATATGGAGCCAGG + Intronic
941415987 2:165222229-165222251 TTAAAGAGAAAAATGTAGTTAGG - Intergenic
946475542 2:220003363-220003385 TTAAATAGCCACATGTAGCTAGG + Intergenic
946527974 2:220540871-220540893 TGCAAAAGACAGATGGATCTTGG - Intergenic
946746788 2:222854324-222854346 GCAAAGAGACAGGAGGAGCTGGG + Intergenic
946885019 2:224214488-224214510 TTAAAGAGATAGATGGGGCTGGG - Intergenic
947183797 2:227436439-227436461 TTAAAGACATAAATGGATCTGGG + Intergenic
947278082 2:228417293-228417315 TAAGAGAGAGAGAGGGAGCTGGG + Intergenic
948088179 2:235267783-235267805 TTAAAGGGACAGATGAGGCCTGG - Intergenic
948751282 2:240134831-240134853 TGAATGAGGCAGATGGAGGTAGG - Intronic
1171165421 20:22966226-22966248 GGAAAGAGAAAGCTGGAGCTAGG - Intergenic
1172228715 20:33322754-33322776 ATAAAGAGACAGAGGCAGGTGGG + Intergenic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1174974309 20:55314435-55314457 TTAAGGACACAGGTGAAGCTTGG - Intergenic
1175287354 20:57845776-57845798 TTCAAGAGAGAGAAGGAGCGGGG + Intergenic
1175965720 20:62659260-62659282 AGACAGAGACAGATGGAGATGGG + Intronic
1176247754 20:64105485-64105507 TGAAAGAGACAGCCGGAACTGGG + Intergenic
1177173589 21:17680321-17680343 TTAAAGAGCCAGATAGGACTGGG + Intergenic
1178074903 21:29005946-29005968 TTAAAGATACATATGCAGCTAGG - Exonic
1178713073 21:34937266-34937288 TTAAAAACACAGATGGACCTGGG + Intronic
1178986405 21:37307423-37307445 TAAAAAAGACAGAGGAAGCTAGG + Intergenic
1179602345 21:42488361-42488383 TTCAAGCTACACATGGAGCTGGG + Intronic
1180129727 21:45819842-45819864 TTAACATGACAGACGGAGCTTGG - Intronic
1181851878 22:25755175-25755197 TTAAAAAGACACAAGAAGCTGGG - Intronic
1182558983 22:31144164-31144186 TAAAAGAGACAGAGAGAGATGGG + Intergenic
1182702504 22:32251932-32251954 GAAAATAGACAGATGTAGCTGGG + Intronic
1182902138 22:33907440-33907462 TTAAAGAGCCAGATGCAGAATGG - Intronic
1182951447 22:34380073-34380095 ATCATGAGACAGATGGAGCTTGG - Intergenic
1183257471 22:36771599-36771621 TTGAAGAGACCCAGGGAGCTGGG - Intronic
1183269415 22:36851306-36851328 TTAAAGTGACAGCTCTAGCTGGG + Intergenic
949711362 3:6874616-6874638 TTAGTGAGAGAGACGGAGCTAGG + Intronic
950079713 3:10212715-10212737 AGCAAGATACAGATGGAGCTGGG + Intronic
950251165 3:11466832-11466854 TTAAAAATAATGATGGAGCTGGG + Intronic
950723294 3:14899773-14899795 TTAAGGAGACAGAGGGAACAGGG + Intronic
950805384 3:15598699-15598721 ATAAAGAGAAAGATGTAGTTGGG - Intronic
951214910 3:20014703-20014725 TTGAAGAGAGAGATGTGGCTGGG - Intergenic
952511179 3:34057669-34057691 ATAAAGAAAGAAATGGAGCTAGG - Intergenic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
953167717 3:40480244-40480266 TTAAATAGGCACATGTAGCTAGG - Intronic
953847650 3:46440813-46440835 CTAAGGAGACAGATGCAGATTGG + Intronic
954032276 3:47828161-47828183 TTAAAGATAAAGATGGGGCCTGG + Intronic
954046088 3:47931788-47931810 TTAAAAATACAGATGGAGCCAGG - Intronic
954085378 3:48240099-48240121 ATACAGAGACAGAGGGAGCGGGG + Intergenic
955160065 3:56456502-56456524 TTAAAGAGCAAGATGGAATTTGG - Intronic
955795966 3:62637285-62637307 GCTAAGAGTCAGATGGAGCTGGG - Intronic
955980030 3:64515515-64515537 TTCTAGAGACAGATGGGGATGGG - Intergenic
956219868 3:66890971-66890993 TTAAAGAGCCACATGTGGCTAGG + Intergenic
956460550 3:69467341-69467363 TTTAAGAGGCAGATGGATTTGGG - Intronic
956842120 3:73150306-73150328 CTAAAGAAACAGGTGGGGCTGGG - Intergenic
957416250 3:79909297-79909319 AAAAAGACACAGATGTAGCTAGG + Intergenic
958935810 3:100254299-100254321 TTTAAGGGACATAAGGAGCTTGG + Intergenic
959455605 3:106557182-106557204 ATAAAGAGAAAAATGGAGATTGG + Intergenic
960204423 3:114877985-114878007 TAAAAGAGAAAGAGGGAGCCTGG - Intronic
960831534 3:121854509-121854531 TAAAAAAGACAGATGAAGATAGG - Intronic
961034379 3:123632226-123632248 TCACAGAGACAGAGAGAGCTGGG - Intronic
961523752 3:127483637-127483659 CTAAGGAGAAAAATGGAGCTGGG - Intergenic
962490949 3:135893718-135893740 TTAATGAGACACATGCTGCTGGG - Intergenic
962615314 3:137120553-137120575 TTAAAGATACAGATTGGGCCGGG - Intergenic
963353517 3:144181329-144181351 CTAAATAGACAGAAGGAACTTGG - Intergenic
963973347 3:151453570-151453592 TCAAAGAGACAAATGTATCTGGG + Exonic
964370062 3:155991011-155991033 TTGAAGAGGCAGATGGTGGTTGG + Intergenic
967569244 3:191009095-191009117 GAAAAGAGACATATGAAGCTAGG + Intergenic
967949162 3:194827317-194827339 TTAAAAAGACAGATGCAGCCGGG - Intergenic
968395417 4:231910-231932 TCAAAGAGAAAGATGAAGGTAGG + Intergenic
969499592 4:7544659-7544681 AACAAGAGACAGAGGGAGCTGGG + Intronic
970903434 4:21186933-21186955 TTAAATAAAAAGATTGAGCTGGG - Intronic
971540354 4:27808424-27808446 ATAAAGGGACAGCTGGGGCTGGG - Intergenic
973272502 4:48276003-48276025 ACAAAAAGACAGAAGGAGCTGGG - Intergenic
973964378 4:56146574-56146596 TTAAAGAGATACATGGCGGTGGG - Intergenic
975391189 4:73819466-73819488 TTAAAGAAACAGATGGATATGGG + Intergenic
976167159 4:82268282-82268304 TTAAAGAGGCAAATGAAGCCTGG - Intergenic
977204584 4:94154699-94154721 TTCAGAAGACAGATGGATCTTGG + Intergenic
977751935 4:100620354-100620376 GTACAGAGACAGAGGGAGCAGGG + Intronic
978342683 4:107734826-107734848 CTAATGAGGCAGGTGGAGCTGGG + Intergenic
979232159 4:118358273-118358295 TTAAAGAAATAGATGGGGCCGGG - Intergenic
979283051 4:118888983-118889005 TTGACGAGACAGACGAAGCTTGG - Exonic
979618422 4:122770728-122770750 TTTAAGAGACAGATGGTGTTAGG + Intergenic
979657558 4:123213665-123213687 TTTAGGAGACAGCTGTAGCTGGG + Intronic
979665581 4:123307299-123307321 TTCAAAATGCAGATGGAGCTGGG - Intronic
979769407 4:124504130-124504152 TTAATGAAATATATGGAGCTAGG - Intergenic
980957622 4:139445028-139445050 TGCAAAAGACAGATGGATCTTGG + Intergenic
981980383 4:150784674-150784696 GTACAGAGACAGAGGGAGCGGGG - Intronic
982084394 4:151819049-151819071 TTAAAAAGAAAGATGTGGCTGGG - Intergenic
982545468 4:156726934-156726956 TTAAAAATACAGTTGGACCTGGG + Intergenic
985349368 4:189040901-189040923 GTAAAGAGACAGAGGGAGAGTGG - Intergenic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
986694883 5:10342806-10342828 TTAAATATACAGTTGGGGCTGGG - Intergenic
988746302 5:34142134-34142156 TAAAAGAAACAGAGGCAGCTGGG + Intergenic
988878843 5:35477907-35477929 TTAGAGAGGTTGATGGAGCTGGG + Intergenic
989632427 5:43499279-43499301 TACAAAAGACAGATGGAGGTAGG - Intronic
991976843 5:72191588-72191610 TAAAACAGACAGATGGAATTGGG - Intronic
992177167 5:74161261-74161283 TTAAAGAGAATGATGAAGCTGGG + Intergenic
994025493 5:95077354-95077376 AAAAAGAGACAGATAGAGGTGGG - Intronic
994333782 5:98539835-98539857 TAAAAGAGAGAGATGGAGAGAGG + Intergenic
995738568 5:115329789-115329811 GTACAGAGACAGAGGGAGCGGGG - Intergenic
995897818 5:117035125-117035147 ATTAAGAGAGTGATGGAGCTTGG + Intergenic
997363201 5:133308462-133308484 ATAAAGAGCCAGATAGATCTGGG + Intronic
998290444 5:140909447-140909469 TGAAGAAGACAGATGGATCTTGG - Intronic
998345097 5:141455397-141455419 TTACAGAGACAGAGGGAGCGGGG + Intronic
998591974 5:143487915-143487937 ATAAAGAGAGAGATGGGGCCAGG - Intergenic
998735233 5:145130675-145130697 TTGAAGAGACAGAAATAGCTAGG + Intergenic
998840536 5:146249276-146249298 TTAAAGAGAAAAATGGGGCCAGG - Intronic
999857695 5:155613106-155613128 TTAGAGAGGAAGATGGAGATAGG + Intergenic
999931708 5:156440166-156440188 TCATAGAGACAGATGTAGATTGG - Intronic
1000223354 5:159235153-159235175 TGCAAAAGACAGATGGATCTTGG - Intergenic
1001063750 5:168518244-168518266 TAAATGAGACACTTGGAGCTGGG - Intronic
1002040475 5:176510199-176510221 TCAAAGAGAAGGATGGAGTTAGG + Intergenic
1002703114 5:181141164-181141186 TTTAGGAGGCAGAGGGAGCTGGG - Intergenic
1003598363 6:7495227-7495249 TTAAAAAGACTGATGGGGCTGGG - Intergenic
1004401111 6:15289524-15289546 TTAAAGAGTAAGAAGGGGCTGGG - Intronic
1005544449 6:26850367-26850389 TAAAAGAAACAGAGGCAGCTGGG + Intergenic
1005824513 6:29624737-29624759 TTAAAGAGAGGCTTGGAGCTAGG + Intronic
1006258540 6:32850139-32850161 TTAAAGAGAGGGAGGGGGCTAGG + Intronic
1006370895 6:33643055-33643077 GAAAAGACAAAGATGGAGCTTGG + Intronic
1009015237 6:57891995-57892017 TAAAAGAAACAGAGGCAGCTGGG + Intergenic
1010208805 6:73346768-73346790 TTTAAAAGACAGATGGGTCTGGG + Intergenic
1013845154 6:114441458-114441480 ATAAAGAGCAAGAAGGAGCTGGG + Intergenic
1014400828 6:120987596-120987618 ATCAGGAGACAGATGGAGCAGGG - Intergenic
1014895576 6:126895681-126895703 TTCAAAAGACAGATGGATCTTGG + Intergenic
1016799466 6:148154172-148154194 TTTTGGAGTCAGATGGAGCTGGG + Intergenic
1017756893 6:157537111-157537133 TTAAAAAGATAGATGGAGCCGGG - Intronic
1017768260 6:157624634-157624656 GTTAGGAGACAGATAGAGCTGGG + Intronic
1018483653 6:164217138-164217160 TTAACCGGACAGCTGGAGCTGGG - Intergenic
1018923888 6:168193724-168193746 TTGAAGAGAAAGGTGGAGTTGGG + Intergenic
1020508918 7:9027918-9027940 TTAAAAAGACAGAAGAAGATTGG + Intergenic
1022528035 7:31051004-31051026 GTAAAGAGAAACATGGACCTAGG + Intergenic
1024181626 7:46901105-46901127 TTAGAGAGACAGCTGGAACCTGG + Intergenic
1024193063 7:47032282-47032304 TTACAGAGACAGAGGGAGGGGGG - Intergenic
1026870206 7:73846411-73846433 CCAAAGTGACAGAGGGAGCTTGG + Intergenic
1027587715 7:80078376-80078398 TAGAGGAGACAAATGGAGCTTGG + Intergenic
1028276242 7:88861313-88861335 TTAAAGAAAAAGATGAAGCCAGG + Intronic
1028404287 7:90459476-90459498 TTTAAGAGACAGTTGGGGCCAGG + Intronic
1028931699 7:96420199-96420221 TTAAAGAGAGAGATGGCAGTTGG - Intergenic
1029858725 7:103545929-103545951 TTAAATAGACAGAAGGGGCCGGG - Intronic
1029918608 7:104238322-104238344 ATAAAGAGACAGAGAGAGGTTGG + Intergenic
1030122596 7:106124729-106124751 TTAAAGGGAGAGATAGGGCTGGG + Intergenic
1030846675 7:114423545-114423567 TTAAAGGGAAAGATGAATCTGGG - Intronic
1031933434 7:127710374-127710396 ATAAAGTGACATAAGGAGCTTGG + Intronic
1032844927 7:135744350-135744372 TTAAAAATACAGTTGGAGTTTGG - Intronic
1032956174 7:136973830-136973852 TTAAAGAGCCAAATGGTTCTTGG + Intronic
1032998633 7:137477954-137477976 TTAAAAATACAAATGTAGCTGGG - Intronic
1033423834 7:141225689-141225711 TAAAAATGACAGATGTAGCTGGG - Intronic
1033519435 7:142145968-142145990 TTAAAGAAACAGCTGTACCTTGG - Intronic
1034628195 7:152510314-152510336 TTAAAAATAGAGATGGGGCTGGG + Intergenic
1035581514 8:742801-742823 ATAAAGAGCCAAATGCAGCTGGG - Intergenic
1035973425 8:4279168-4279190 TTACAGAGACAGACGAAGCTTGG - Intronic
1036172983 8:6508152-6508174 TTAAAAAGACAGCTGGGGCCGGG + Intronic
1036396440 8:8375493-8375515 TTAAAGAAAAAAATGGGGCTGGG - Intronic
1036789141 8:11706694-11706716 TTAAAGAGAGAAATGGAGTGTGG + Intronic
1038608311 8:29033386-29033408 TTAAATAGACAGCAGGAGCCTGG + Intronic
1038854190 8:31313503-31313525 TTTAAGAGAAAGATGGGGATGGG + Intergenic
1038975906 8:32695794-32695816 TTAAAGAATCAGAGGGAGCAAGG + Intronic
1038977751 8:32719735-32719757 AAAAAGAGACAAAGGGAGCTAGG - Intronic
1040988136 8:53318627-53318649 TTACAGAGACAGAGGGAGGGGGG - Intergenic
1041025078 8:53676287-53676309 TTAAAGAGCCAGGTGGGGCATGG + Intergenic
1041117019 8:54549621-54549643 TTAAACAGAAAGATTGAGCCAGG - Intergenic
1041986070 8:63923566-63923588 TGCAAAAGACAGATGGATCTTGG + Intergenic
1042579948 8:70265848-70265870 TTAAAGAGACAGAGTCGGCTGGG + Intronic
1042985931 8:74582882-74582904 TTACAAAAACAGATGGAGGTGGG + Intergenic
1044793396 8:95871250-95871272 TGCAAAAGACAGATGGATCTTGG - Intergenic
1046120133 8:109835859-109835881 GTAATGAGAAAGATGGAGATAGG - Intergenic
1047304997 8:123645518-123645540 AGACAGAGACAGATGGAGGTGGG + Exonic
1048676360 8:136786906-136786928 TGAAAGAGACACTTGGAGGTTGG + Intergenic
1049995454 9:1029902-1029924 TTAAAGAGACAGATAGAAAAGGG - Intergenic
1050510165 9:6385924-6385946 CTAAAGAGACAGATAGACCCAGG + Intergenic
1050746661 9:8884161-8884183 TGAAGGAATCAGATGGAGCTAGG - Intronic
1050785064 9:9390192-9390214 TGAAAGAGGAAGATGGAGGTGGG + Intronic
1051057215 9:13001774-13001796 TTGAAGACACAGAGGGAGCCAGG - Intergenic
1052583353 9:30390918-30390940 TTAAAGAGAGAGAGAGAGCAAGG + Intergenic
1055959929 9:81810633-81810655 GTAAATAAATAGATGGAGCTGGG + Intergenic
1057084411 9:92195784-92195806 ATAAAGAGACAAAAGGAACTAGG + Intergenic
1057192258 9:93094721-93094743 GCAAAGAGACAGATGGCGCATGG + Intergenic
1057442700 9:95093438-95093460 TTAAAGTTACAGATGGTGCCTGG + Intergenic
1058111843 9:101039205-101039227 CTAGAGCGTCAGATGGAGCTAGG + Intronic
1058898226 9:109418382-109418404 ATAAAGAGACAGAGGGTGCTGGG + Intronic
1058937526 9:109782802-109782824 ATTAAGAGACAGAGGGAGTTGGG + Intronic
1059875747 9:118632650-118632672 TTAAAAAGACAGATTAATCTGGG - Intergenic
1060509616 9:124222399-124222421 TTGAAGTGACAGATGAAGCTAGG - Intergenic
1060954397 9:127628182-127628204 ATAAAGTGACAGATAGAGATGGG - Intronic
1062505741 9:136875000-136875022 ATAAAGAAACTGATGGGGCTGGG + Intronic
1186954064 X:14660622-14660644 TCAAAGCGAGAGATGGAGATTGG + Intronic
1187604744 X:20870955-20870977 TGCAGGAGACAGATGGATCTTGG + Intergenic
1188350805 X:29128472-29128494 TCAAAGAGACAGAAGGTGCTTGG - Intronic
1189205275 X:39232877-39232899 TTAAAGAGACAGATGCCACCAGG - Intergenic
1189337672 X:40180170-40180192 TAAAAGAGGCTGATGCAGCTGGG - Intergenic
1189911152 X:45811557-45811579 ATAAAGGCACAGATGTAGCTAGG - Intergenic
1192776780 X:74253914-74253936 TTACAGAGACAGAGGGAGGGGGG - Intergenic
1193419197 X:81263255-81263277 TTACAGAGGCAGATGAAGCTGGG + Intronic
1193631583 X:83895341-83895363 TTAAAGATACAGATACAGATAGG - Intergenic
1195316030 X:103679208-103679230 TTAAAGAGACAGATAAGGCCGGG + Intronic
1196587919 X:117451316-117451338 TTATAGAGTCAAATGGATCTGGG + Intergenic
1196652220 X:118179587-118179609 ATATAGAAAGAGATGGAGCTGGG + Intergenic
1197173610 X:123461715-123461737 TTGAAGAGAGAGATGAAGCAGGG + Intronic
1199108837 X:143906299-143906321 TTAAGGAGAGAGATCGAGTTGGG + Intergenic
1199851827 X:151729309-151729331 TTATAGACAAAGATGGGGCTGGG - Intergenic
1201379046 Y:13352602-13352624 TTAAAGGGAGAGATGTGGCTTGG - Intronic
1201900461 Y:19042783-19042805 TTACAGAGACAGAGGGAGGAGGG - Intergenic