ID: 935020214

View in Genome Browser
Species Human (GRCh38)
Location 2:99223065-99223087
Sequence CTGTGTAAGTAAAAATAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 291}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935020214 Original CRISPR CTGTGTAAGTAAAAATAGGA TGG (reversed) Intronic
901347998 1:8564518-8564540 CTGTGTAAATAAATACAGGTTGG - Intronic
902705433 1:18201048-18201070 AAGTGGAAGTGAAAATAGGAAGG + Intronic
902853806 1:19184357-19184379 TTGTGTAAGTAGAATTAGGTGGG - Intronic
903985554 1:27225170-27225192 CTGTGTCAGTCAAAATCAGAGGG - Intergenic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
906807600 1:48794309-48794331 ATGTGTAAGTGCATATAGGAAGG - Intronic
908005875 1:59728705-59728727 CCGTGTAAATAAAACTAGAATGG - Intronic
909050405 1:70760694-70760716 TTATGAAATTAAAAATAGGAAGG - Intergenic
909142136 1:71881064-71881086 CTGTGTAGGTAAAAAGTGGGAGG - Intronic
909787098 1:79627620-79627642 CTGTGTGAATAGAACTAGGATGG - Intergenic
909801648 1:79817402-79817424 CTGGGTCAGTAATCATAGGAAGG + Intergenic
911094427 1:94044137-94044159 TTGTGAAAGAAAAAAAAGGAAGG - Intronic
911162301 1:94693378-94693400 CTGTGTAAATAAGAAAACGAAGG + Intergenic
913495468 1:119424301-119424323 CATTGTAAGCAAAAACAGGATGG + Intergenic
913599073 1:120405574-120405596 CTTTCTAAGTAAACACAGGAAGG - Intergenic
914088306 1:144474046-144474068 CTTTCTAAGTAAACACAGGAAGG + Intergenic
914310305 1:146460164-146460186 CTTTCTAAGTAAACACAGGAAGG - Intergenic
914591804 1:149112978-149113000 CTTTCTAAGTAAACACAGGAAGG + Intergenic
916284103 1:163085465-163085487 CTGTGTAGGTCACAAGAGGAGGG - Intergenic
917618527 1:176770785-176770807 CTCTGTAAGTAAAAAGATGTAGG + Intronic
917757228 1:178114370-178114392 CTCAGAAACTAAAAATAGGAGGG - Intronic
918805313 1:189033364-189033386 CTGTGTAAGCAAAATTAGCCAGG + Intergenic
919186727 1:194160800-194160822 TTGTGTAAGAGAAAATAGGGAGG + Intergenic
919469896 1:197965008-197965030 CCCTGAAAGTAAAAGTAGGATGG - Intergenic
920842442 1:209566000-209566022 TTTTGGAAGTAAAAAGAGGATGG - Intergenic
923955776 1:239018522-239018544 CTATGTAGATAAAAATGGGAGGG + Intergenic
1064965235 10:21009201-21009223 CTGCCTAATTAAAAATAGAATGG + Intronic
1065055625 10:21839001-21839023 CTGGGTAAATAAAGAAAGGAAGG + Intronic
1067084035 10:43228869-43228891 CTGAGTAAGTGAAAGAAGGAAGG + Intronic
1067138281 10:43631363-43631385 CTGTGTGAGAACAAATGGGAAGG + Intergenic
1067914493 10:50381849-50381871 GTGTGGAAGGAAAAATAGGGCGG + Intronic
1068830366 10:61487297-61487319 CAGTGTAGGTAAAACTAGAAAGG + Intergenic
1069250307 10:66258588-66258610 TTGTGTACGTAAAAAAAGAAAGG - Intronic
1069306332 10:66975443-66975465 TGGTGTAAGTAAAAATAAGTTGG + Intronic
1071222595 10:83486935-83486957 CTGAGAAAGTAGAAATAGCATGG + Intergenic
1071801815 10:89071921-89071943 CTGTACACTTAAAAATAGGAGGG - Intergenic
1072347611 10:94524149-94524171 CGGTGGAAGTAAAAAATGGAAGG - Intronic
1073580357 10:104660043-104660065 CTGTGTGAGAAAAAAGAGAAAGG - Intronic
1075363355 10:121860201-121860223 CTCTGTAAGTGAGAAAAGGAAGG + Intronic
1075590941 10:123691257-123691279 CTTTCTAAGTAAAAACAGGCAGG - Exonic
1075740733 10:124694479-124694501 CTGTGTAAGTTATAATAAGGTGG - Intronic
1077826141 11:5809839-5809861 CTGGGTAAATAACAAAAGGAAGG - Intronic
1078554057 11:12304205-12304227 CTGTGAAAGGAAAAATAATAAGG - Intronic
1079113440 11:17622075-17622097 CTCTGTCTGTACAAATAGGAAGG + Intronic
1079265162 11:18924025-18924047 CTGGGTAAATAAAAAAATGAAGG + Intergenic
1082148616 11:48702869-48702891 CTGTGAAAGTATATATAGGAGGG - Intergenic
1082727030 11:56748409-56748431 CTGTGTGAGTGAATATATGATGG + Intergenic
1085766340 11:79286353-79286375 TTCTATAAGTAGAAATAGGATGG + Intronic
1087505692 11:99018659-99018681 CTGTTTAATTAAAAATAGTAAGG - Intergenic
1088454817 11:110022542-110022564 CTGTGAAAGCAAAAATGGCAAGG - Intergenic
1088459956 11:110072229-110072251 CTGTGTAAGTGATACTATGAAGG + Intergenic
1090591404 11:128274056-128274078 CTGTGAAAGAACAAAAAGGAAGG + Intergenic
1091350489 11:134890389-134890411 CTGTGGAAGCAATAACAGGAGGG + Intergenic
1091989390 12:4942584-4942606 CTGTATAAGTAACAATAGGCAGG + Intergenic
1092541541 12:9422572-9422594 CTGTGTAAATAAAACAGGGAAGG + Intergenic
1092813566 12:12293311-12293333 CTGTGGAGTTAAAAATAGTATGG + Intergenic
1092902814 12:13075758-13075780 CCTTGTAAGAAAAAAAAGGAAGG - Intronic
1094034901 12:26058107-26058129 TTGAGAAAGTAAAAATAGGAGGG - Intronic
1094834867 12:34317576-34317598 CTGTGTAAGGAAAAATAATGCGG - Intergenic
1095241132 12:39860101-39860123 CTGTGTTAGCTAAAAAAGGAAGG + Intronic
1097319120 12:58206051-58206073 CTGTGTATTTAAAAATAAGTAGG - Intergenic
1097654120 12:62340620-62340642 CTGAGTAAGTAACAAAATGAAGG - Intronic
1099639341 12:85265493-85265515 CTAGGTAAGTAAAAATATCATGG - Intergenic
1099895803 12:88645109-88645131 GTGGGTAAGTAGAAACAGGAAGG - Intergenic
1100177645 12:92049425-92049447 CTGTGTAATGAACAAGAGGATGG + Intronic
1100784635 12:98065910-98065932 CCTTATAAGTAAAAGTAGGAAGG + Intergenic
1101072231 12:101087761-101087783 CTGGGCAAGTACAATTAGGAAGG - Intronic
1102927683 12:116839278-116839300 CTGTCTCAGTAAATATTGGATGG + Intronic
1103154406 12:118671813-118671835 CTGGGTAAATAAAGAAAGGAAGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106602801 13:31201398-31201420 CAGTGTAATTAAAAATATTAGGG + Intronic
1106863148 13:33933653-33933675 CTGTGAAATTGAAAATAAGAAGG + Intronic
1106879244 13:34111415-34111437 CTTTGTAATTAAAAATATTATGG + Intergenic
1107194008 13:37625158-37625180 GTGGGTGAGTAAAAATATGAAGG + Intergenic
1108992100 13:56673124-56673146 CTGTATAAGTCAAACTGGGAGGG + Intergenic
1109048106 13:57439231-57439253 GTGGGGAAGTGAAAATAGGAGGG - Intergenic
1109212955 13:59556102-59556124 TTGTGTATGAAAAAATAGGCCGG + Intergenic
1109370080 13:61412342-61412364 CTGTCTAAGGAAAAATATGATGG + Exonic
1109633941 13:65088587-65088609 CTGTGTGAGTAAAGAAGGGAAGG + Intergenic
1110492869 13:76129447-76129469 CAGTGTAGTTAAAAATAGCAGGG - Intergenic
1110516637 13:76420483-76420505 CTGTGAAAGGAAAACTATGAAGG - Intergenic
1111701747 13:91698195-91698217 ATCTGTAAGAAAAAATAGAATGG - Intronic
1113662317 13:112116176-112116198 TTGTTTAAAAAAAAATAGGAAGG - Intergenic
1118960356 14:70524478-70524500 CTGTGTAGGTGAACACAGGAAGG + Exonic
1120105942 14:80494802-80494824 CTTTATTAGTAAAAATAGGTAGG + Intronic
1120199929 14:81526238-81526260 TTGTGAAAGTTAGAATAGGATGG + Intronic
1121581607 14:95036356-95036378 CTGTATAAGTAAAATTAAGCTGG + Intergenic
1122219304 14:100225982-100226004 CTGTCTAAAAAAAAATAGGCTGG + Intergenic
1125329722 15:38570849-38570871 CTGGGTAAATAAAAAAATGAAGG - Intergenic
1126272043 15:46831413-46831435 CTGTGTCAGTGATGATAGGAAGG - Intergenic
1126837961 15:52686888-52686910 CTGTGCAAGTTGAAATAAGAAGG - Intronic
1127651317 15:61010857-61010879 TGATGTAAGTAGAAATAGGAGGG - Intronic
1128670456 15:69570883-69570905 CCGGGTTAATAAAAATAGGAAGG + Intergenic
1129052450 15:72793799-72793821 CTGTGTAAGAAAAAAAAAAATGG - Intergenic
1129483956 15:75850653-75850675 CTATGTAAGTTAATATAGAATGG + Intronic
1130271286 15:82450250-82450272 CTATGTAAGTTAATATAGAATGG + Intergenic
1130276783 15:82482874-82482896 CTATGTAAGTTAACATAGAATGG - Intergenic
1130463624 15:84177586-84177608 CTATGTAAGTTAATATAGAATGG + Intronic
1130469148 15:84210238-84210260 CTATGTAAGTTAACATAGAATGG - Intergenic
1130474491 15:84252004-84252026 CTGTGTAAGTTAACATAGAATGG + Intergenic
1130476638 15:84324794-84324816 CTATGTAAGTTAACATAGAATGG - Intergenic
1130481906 15:84366052-84366074 CTGTGTAAGTTAACATAGAATGG + Intergenic
1130489048 15:84417197-84417219 CTATGTAAGTTAATATAGAATGG - Intergenic
1130495127 15:84463336-84463358 CTATGTAAGTTAACATAGAATGG + Intergenic
1130500641 15:84495956-84495978 CTATGTAAGTTAATATAGAATGG - Intergenic
1130508129 15:84566007-84566029 CTATGTAAGTTAACATAGAATGG - Intergenic
1130591441 15:85214849-85214871 CTATGTAAGTTAACATAGAATGG - Intergenic
1131492048 15:92871605-92871627 CTGTGTTATTAAAAATTGCATGG - Intergenic
1135214410 16:20552433-20552455 ATGTTTAAGTATAAGTAGGAAGG + Intronic
1137860159 16:51838866-51838888 CATGGTAAGTAAAAATAGTAAGG - Intergenic
1138110789 16:54322125-54322147 CTGTACAATTAAAAATAGAATGG + Intergenic
1138821521 16:60265907-60265929 TTGTGTGAGAAATAATAGGAGGG - Intergenic
1139141547 16:64269251-64269273 CTGTGTAATTAGGAATAGGGAGG + Intergenic
1140611443 16:76604022-76604044 ATGATTAAGTAAAAAAAGGAAGG + Intronic
1141571668 16:84937912-84937934 CTGTGCAAGAAAAAATAAAATGG - Intergenic
1142358081 16:89613535-89613557 CTCTGAAAGTAGAAAGAGGAGGG - Intronic
1142436667 16:90063593-90063615 CTGGGTAAGAAAAAATTTGAGGG - Exonic
1144537504 17:16105214-16105236 CTGTGGAAGAAAAAACAGAATGG + Intronic
1145197582 17:20908377-20908399 CTGTGTAACAAAAAATATGTTGG + Intergenic
1151073864 17:71248725-71248747 CTGTGTAAGTTGAAATAGAAGGG + Intergenic
1153612336 18:6899195-6899217 GTGTTTAAGTTAAAAAAGGAGGG + Intronic
1153782835 18:8509430-8509452 GTCTGGAAGTAAAAATGGGAAGG + Intergenic
1155408609 18:25517139-25517161 TTGTGTAAGTGAAAACAGGTGGG + Intergenic
1155506457 18:26538277-26538299 CTCTGTAAAGAGAAATAGGAAGG + Intronic
1156279818 18:35626032-35626054 CAGTGTGAGTTAAAATAGGGAGG - Intronic
1158928623 18:62297854-62297876 ATGTTTAAGTAAAAACATGAAGG - Intronic
1159507755 18:69358441-69358463 CTGTGTCATCAAAAAAAGGAAGG - Intergenic
926968424 2:18441585-18441607 ATGTGTAAGTTAAAAAACGATGG - Intergenic
927762102 2:25767189-25767211 CTGTGTAAAGAAAGATAGAAGGG - Intronic
928216618 2:29366697-29366719 AAGTGTAAGTAAACATGGGAAGG - Intronic
928899189 2:36299432-36299454 CTGTGTAAGAACCAATGGGAAGG - Intergenic
929086835 2:38176414-38176436 CTGTCTAACTAAAATTATGAAGG + Intergenic
930889988 2:56373634-56373656 ATTTGAAAGTAAAAACAGGAAGG + Intronic
931780512 2:65575566-65575588 CTTTGTAAGTAAAAATGAAAGGG + Intergenic
932199003 2:69809479-69809501 CTGTGTCAAAAAAAATAGGCAGG - Intronic
933145360 2:78845639-78845661 ATGTGGGTGTAAAAATAGGATGG + Intergenic
935020214 2:99223065-99223087 CTGTGTAAGTAAAAATAGGATGG - Intronic
935083725 2:99824421-99824443 CTGTGGAATTAAAAATATTAAGG - Intronic
937579761 2:123470531-123470553 CTGTGTATGTCAAAGTAAGAGGG + Intergenic
937713742 2:125008760-125008782 GTGTGCAATTTAAAATAGGATGG + Intergenic
937760610 2:125598067-125598089 ATATTTAAGTAAAAATAGTAAGG + Intergenic
940039861 2:149348780-149348802 CTGTGAGAATAAATATAGGAAGG + Intronic
940492004 2:154374514-154374536 TTGAGTAAGGAAAAAAAGGATGG + Intronic
941673061 2:168315812-168315834 CTGTGTGAGGAAAAATGAGAAGG + Intergenic
942170680 2:173286768-173286790 CTGTGAAAGTAAAAATTCGATGG - Intergenic
942308700 2:174633919-174633941 TTGTGTTAGTAAAAGAAGGAAGG + Intronic
942674280 2:178411417-178411439 CTGTGCACCTAAAAATAGGATGG + Intergenic
943114022 2:183643930-183643952 CTGTGTATGCAAAATTAGAAGGG + Intergenic
943738834 2:191388876-191388898 CTGTAAAAATAAAAAAAGGAGGG - Intronic
944609308 2:201384843-201384865 CTGTGTGATGAAAAATGGGAAGG + Intronic
944971987 2:205003445-205003467 CTTTGTAAGAAAAAGTAGTAGGG - Intronic
944985867 2:205175866-205175888 CTGTAAAAATCAAAATAGGAAGG + Intronic
945609953 2:211987637-211987659 ATGTGTAAATAAAATTAGGTAGG - Intronic
947301042 2:228688975-228688997 CTGGGAAAGTAAAAATGGGAGGG + Intergenic
1169807062 20:9570508-9570530 CAGTGTAAGTTAAACTACGATGG + Intronic
1169938840 20:10915215-10915237 CTGTGTATGTAAAAAAATGCCGG + Intergenic
1171894327 20:30745716-30745738 GGATGTAAGTAATAATAGGAAGG + Intergenic
1173049700 20:39547306-39547328 TTGTGTAAGTAAAAGAAGGGGGG - Intergenic
1173325878 20:42033192-42033214 CTGAGTGAGGAAATATAGGAAGG + Intergenic
1174941021 20:54927262-54927284 ATGTTGAAGTAAACATAGGAAGG - Intergenic
1176303223 21:5108880-5108902 CTGTGCAAGTAAAAATACAGTGG + Intergenic
1177539665 21:22475985-22476007 CTCTGTGTGTAAAAGTAGGATGG + Intergenic
1178066380 21:28908752-28908774 CTTGGTAATTTAAAATAGGATGG - Intergenic
1178248689 21:30979724-30979746 TAGTGTTAGTAAAAATAGTAAGG - Intergenic
1179711076 21:43263494-43263516 CTGGGGTAGTAAAGATAGGAGGG - Intergenic
1179853802 21:44153044-44153066 CTGTGCAAGTAAAAATACAGTGG - Intergenic
1180541275 22:16450115-16450137 CTGGGTAAATAAAAAAATGAAGG + Intergenic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
949171533 3:1004770-1004792 CTGTGTAAGTAAATTATGGATGG + Intergenic
951523239 3:23629033-23629055 CTGTATAAGGGAAAATAGGGAGG + Intergenic
951662126 3:25079238-25079260 ATGTGTAAGTAAATTTAGCAAGG - Intergenic
952090641 3:29881122-29881144 GTGTGTAAATAAAAATGGAAAGG - Intronic
953335891 3:42093706-42093728 CTCTGTAAAAAAAAAAAGGAAGG - Intronic
955997463 3:64691839-64691861 CATTGTAAGTAAAATGAGGAGGG - Intergenic
956467072 3:69529680-69529702 CTGTGAAATTAAGAATAGTAAGG - Intronic
957028336 3:75210816-75210838 TTGTATAAGTAAAAATATAAAGG - Intergenic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
959045612 3:101469977-101469999 CTATGTAAGTAACAAAATGAAGG + Intronic
961221603 3:125205332-125205354 CTCTGTAAGTTAAAATACGGCGG + Intronic
961321146 3:126077471-126077493 CTGTGTGGGTAAACATTGGAAGG - Intronic
962284798 3:134076660-134076682 CTGTGTGTGTGTAAATAGGAGGG + Intronic
962767237 3:138576853-138576875 CTGTGTAAATAACAAAATGAAGG + Intronic
962885370 3:139620661-139620683 TTGTGTAAATAGAAATAGAATGG + Intronic
963117581 3:141744763-141744785 CTTGGTAAATAAAAATTGGAAGG + Intronic
963266941 3:143249342-143249364 CAGTGTAAGAAAATATAGGATGG - Intergenic
963546518 3:146666072-146666094 CTGTGGAAGTAAGAAGAAGAGGG - Intergenic
963789005 3:149564142-149564164 CTGTGTCAGTAAATGTAGGGTGG - Intronic
964117585 3:153152679-153152701 CTCTGTAAATAAAAATGGAAAGG - Intergenic
964394237 3:156228800-156228822 CTGTGGAAGGAGAAATAGGGTGG - Intronic
964484299 3:157171828-157171850 CTGTACAATTAAAAATAGAAAGG + Intergenic
964857752 3:161165355-161165377 CTGTGGACGTAGAAATGGGAAGG - Intronic
966825238 3:183959437-183959459 CTGAGTAAGGAAAAATCGAATGG - Intronic
967084436 3:186080952-186080974 CTGGGTAAGTAACACTGGGAAGG + Intronic
967522555 3:190451131-190451153 ATTTGTATGCAAAAATAGGAAGG + Intergenic
967645086 3:191912995-191913017 CTGTGAAAGTAACAATACGTGGG + Intergenic
967672835 3:192259604-192259626 GTTTGTAAGTAGAAATAGGGTGG + Intronic
967675346 3:192291981-192292003 CCATTTAAGTAGAAATAGGAAGG + Intronic
968075969 3:195816307-195816329 CTGTGTAAGGAAAAGGAGGCCGG - Intergenic
972097880 4:35371200-35371222 GTCTTTAAGTTAAAATAGGAAGG - Intergenic
974415470 4:61600741-61600763 CTATGTAAGTCAAAATAGAAGGG + Intronic
976032246 4:80770500-80770522 GTTTGTACTTAAAAATAGGAAGG - Intronic
977310167 4:95376159-95376181 ATGTGTAAGTATATATAGAAAGG - Intronic
979115550 4:116817957-116817979 CTGGGTAAATAAAAAAATGAAGG + Intergenic
980102105 4:128552060-128552082 AGGTGTAAGTAAATGTAGGATGG - Intergenic
981205043 4:142031057-142031079 CTGTGTAAATAAAAAAAAGTAGG + Intronic
983332896 4:166354185-166354207 CTGTGTAAGTACATGTAGGATGG + Intergenic
983594567 4:169451537-169451559 CTGGGTAAATAAAAAAATGAAGG + Intronic
983867355 4:172784582-172784604 CTGTGGTAGTAATAATAGGCTGG - Intronic
984032470 4:174621025-174621047 CTGGGTAAGTAAAGAAATGAAGG + Intergenic
986988091 5:13521873-13521895 CTGTCGAAGTAAGAAAAGGAGGG - Intergenic
987295943 5:16551491-16551513 CTGGGCAAGTAGAAATAAGAAGG - Intronic
989252094 5:39329172-39329194 CTGTAGAAGTAAAAAGGGGAGGG - Intronic
989327524 5:40216698-40216720 CTTTGAAAATAAAAATAGCATGG + Intergenic
990264300 5:54059108-54059130 CAGATTAAGGAAAAATAGGAGGG - Intronic
990983316 5:61620478-61620500 CTGTATAAATAAAAAGAGTAAGG + Intergenic
991131696 5:63130199-63130221 CTGGGTAAGCAGATATAGGATGG - Intergenic
991628715 5:68632175-68632197 CTGTTCAAATAAAAATAAGATGG + Intergenic
993976773 5:94492446-94492468 TTGTGCAAGGCAAAATAGGAAGG - Intronic
994656130 5:102594884-102594906 CTGTGTATTTAAAAATATGGTGG + Intergenic
995137613 5:108696879-108696901 TTGCTTAAGTAAAAATAGCAGGG + Intergenic
995439104 5:112170514-112170536 GTGTTCAAGGAAAAATAGGAGGG + Intronic
996905084 5:128590056-128590078 CTGTGAAAATAACAATTGGATGG + Intronic
998846633 5:146316686-146316708 CTGTGTAATTAAAACAAGGCAGG + Intronic
1000117276 5:158165652-158165674 CTCAGTAAGTAAAAACAGGGTGG - Intergenic
1000380373 5:160623555-160623577 CTTTGGAAGAAAAAAGAGGACGG + Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004211767 6:13654426-13654448 CTATATAAGGAAAAATAGAAAGG - Intronic
1005449292 6:25957450-25957472 CTAGGTACATAAAAATAGGATGG - Intergenic
1005891499 6:30143884-30143906 CTGTGTAAATGAAAAAAAGAAGG - Intronic
1006102979 6:31697709-31697731 CTGTGTAAGTGAAAAGAGAGAGG - Intronic
1006237841 6:32651204-32651226 CTGTAAAAGTAATAATAGAATGG + Intergenic
1006244471 6:32718377-32718399 ATGTTTAAGTAAAAAAAGAAAGG - Intergenic
1007872003 6:45051084-45051106 CTGTGTTAGTCAGGATAGGATGG + Intronic
1008117942 6:47574513-47574535 CAGTGTAAATAAAAATTAGAGGG + Intronic
1008269823 6:49478070-49478092 CTGTGAAAGTAAAAATAAGGAGG - Intronic
1011121084 6:83953698-83953720 TTGTGACAGTAAAAATGGGAAGG + Intronic
1011965101 6:93146337-93146359 CTGTTTATCTAAAAATAGTAAGG - Intergenic
1013135008 6:107273575-107273597 TTATGTAAGAAAAAATAGGCAGG + Intronic
1014156826 6:118120477-118120499 CTGTATATGTAAACTTAGGAGGG + Intronic
1014523678 6:122475487-122475509 CTATAAAAGTAAAAATAGGCCGG + Intronic
1014725198 6:124963680-124963702 CTGTATAAGAAATAAGAGGAGGG - Intronic
1014955303 6:127607841-127607863 CTGTGTAAGCTATAATACGATGG - Intergenic
1015300362 6:131646157-131646179 TCTTGTAAGTAAAAATATGAGGG - Intronic
1015418953 6:132984322-132984344 CTGTGTAAATAACAAAATGAAGG - Intergenic
1015658678 6:135548295-135548317 ATGTGTAAACAAAAATACGAAGG + Intergenic
1018694331 6:166379731-166379753 CTGATGAAGTAAAAAGAGGAAGG + Intronic
1020603692 7:10308119-10308141 CTGTGTGAGTAAAAGCAGAAAGG - Intergenic
1021993493 7:26158312-26158334 CTAGGTAAGTTAAGATAGGAAGG - Intronic
1022756215 7:33293259-33293281 ATGTGAAAGTGAAAATAGAAGGG + Intronic
1022887353 7:34660304-34660326 CTGTGTAACTAAAAATCACAGGG - Intronic
1024859442 7:53821094-53821116 CTGTGTATGTAATAATACTAAGG - Intergenic
1026613240 7:71879548-71879570 CTGGGGAAGTAACAACAGGAGGG - Intronic
1027950769 7:84812059-84812081 TTGCTTAAATAAAAATAGGAAGG - Intergenic
1028678719 7:93499746-93499768 CTGTGTAAGATATAATAGAAGGG - Intronic
1028697706 7:93735431-93735453 ATCTGTAAGTAAAAATAGGCTGG + Intronic
1031072406 7:117176675-117176697 AGGAATAAGTAAAAATAGGAAGG + Intronic
1031103175 7:117507272-117507294 CTATGAAAGAAAAAATAGAATGG - Intronic
1031621946 7:123945014-123945036 CTGTGTAAGTCATAATAAGAAGG - Intronic
1031726347 7:125244449-125244471 CTGTACCAGTAAAAATATGAAGG - Intergenic
1032026565 7:128447247-128447269 CTGTGGAAGTAAAGTGAGGATGG - Intergenic
1033057742 7:138075171-138075193 CTGTCTACATAAAGATAGGATGG - Intronic
1034840998 7:154396618-154396640 CTGTGTAATGAAAAATATCAGGG - Intronic
1035825511 8:2640449-2640471 ATTTTTAAGTGAAAATAGGATGG + Intergenic
1038847206 8:31241273-31241295 AGGTGTAAGAAAATATAGGAAGG - Intergenic
1038873819 8:31525733-31525755 CTGTGGAGGGAAAAATGGGATGG - Intergenic
1040503930 8:48029942-48029964 ATTTCTAAGTAAAATTAGGATGG - Intronic
1040758805 8:50812959-50812981 CTATGTAAGAAAAACGAGGATGG - Intergenic
1042016566 8:64319962-64319984 CTGGGTAAGTAAAGAAATGAAGG - Intergenic
1043071168 8:75637679-75637701 CTGTGTATGTAACAAAATGAAGG - Intergenic
1043330686 8:79114829-79114851 CTGTGTAAATAACGATATGAAGG + Intergenic
1043725413 8:83604623-83604645 CTGGGTAAATAAAAAAATGAAGG + Intergenic
1045639568 8:104232837-104232859 CTATAGAAGTTAAAATAGGAAGG - Intronic
1045998727 8:108394619-108394641 CAGTGTAATTGGAAATAGGAAGG - Intronic
1048286266 8:133144199-133144221 CTGGGTCATTAAAAAGAGGAAGG + Intergenic
1051189432 9:14495641-14495663 CAGTGTAATTAAAAATAAGAAGG + Intergenic
1052167818 9:25355257-25355279 GTGTGCAATTAAAAATTGGAAGG - Intergenic
1052247795 9:26358875-26358897 CTTTGTAATAAAAAATATGATGG - Intergenic
1052331570 9:27275202-27275224 CTTTGTAAGAAATAAGAGGAAGG + Intergenic
1052463387 9:28796565-28796587 TTGTTTAACTGAAAATAGGAAGG + Intergenic
1052619912 9:30893767-30893789 CAGTGTAAATAAAGATAGAAAGG - Intergenic
1053614245 9:39746765-39746787 CAGTGGAAGTAAAAATTGTAAGG + Intergenic
1053872273 9:42504706-42504728 CAGTGGAAGTAAAAATTGTAAGG + Intergenic
1053900482 9:42791228-42791250 CAGTGGAAGTAAAAATTGTAAGG - Intergenic
1054239271 9:62595627-62595649 CAGTGGAAGTAAAAATTGTAAGG - Intergenic
1054261164 9:62866389-62866411 CAGTGGAAGTAAAAATTGTAAGG + Intergenic
1054553402 9:66630149-66630171 CAGTGGAAGTAAAAATTGTAAGG - Intergenic
1057612514 9:96558270-96558292 CTGTGTATTTCAAAATAGAAAGG + Intronic
1057779641 9:98039149-98039171 CTCTAAAAGTAAAAATAAGAGGG - Intergenic
1057932099 9:99202959-99202981 CTTTTTAAGAAAAAAAAGGATGG + Intergenic
1058116532 9:101091177-101091199 TTCTGTAAGGAAACATAGGAGGG - Intronic
1059010991 9:110459284-110459306 ATGTGTTACTAAAGATAGGAAGG - Intronic
1059200227 9:112407775-112407797 CTGTACACTTAAAAATAGGATGG - Intronic
1059980768 9:119769492-119769514 CTGTGACAGAAAAAATATGATGG - Intergenic
1061280100 9:129593051-129593073 CTGTGTAAGTATAAATGGAAAGG + Intergenic
1062257031 9:135630975-135630997 CTGTGTAAAAAAAAAAAAGACGG + Intronic
1186661336 X:11670266-11670288 TTGGGCAAGTGAAAATAGGATGG - Intergenic
1187664272 X:21586670-21586692 ATTTTTAAGTAAAAACAGGAAGG + Intronic
1188195968 X:27234188-27234210 GTGTGTAAGTAAAAATTTGGGGG - Intergenic
1188987799 X:36783377-36783399 CTGGGGAAGTGAAAATAGTAAGG + Intergenic
1189284101 X:39839729-39839751 CTGTCTAAGAAAAAATAAAAAGG - Intergenic
1191139186 X:57097524-57097546 CTGGGTAAGTAAATAAATGAAGG + Intergenic
1191905496 X:66084135-66084157 CTTTGTAATTAATAATAGTAGGG - Intergenic
1192679084 X:73232486-73232508 CTGAGTAAGTAACAAAATGAAGG + Intergenic
1194228906 X:91297754-91297776 CTGGGTAAATAACAAAAGGAAGG - Intergenic
1195718819 X:107845868-107845890 CAGTGTAAGTATAAATATAAGGG + Intronic
1197990804 X:132314958-132314980 CTGAGGAAATAAATATAGGAGGG + Intergenic
1198585693 X:138118280-138118302 CTGTGTTAGCAAAAATATGAAGG - Intergenic
1199426075 X:147702641-147702663 CTTTGAGAGTGAAAATAGGAAGG + Intergenic
1201384216 Y:13420581-13420603 TTTTGTAACTATAAATAGGAAGG - Intronic
1201664129 Y:16429833-16429855 CTGGGTACGTAAAAAAATGAAGG + Intergenic
1201961684 Y:19687885-19687907 CTGTGTAAGTAACAAAATGAAGG - Intergenic
1202371568 Y:24201031-24201053 CTATGTAAGTTAATATAGAATGG - Intergenic
1202376499 Y:24242863-24242885 CTATGTAAGTTAACATAGAATGG - Intergenic
1202494281 Y:25427256-25427278 CTATGTAAGTTAACATAGAATGG + Intergenic
1202499217 Y:25469085-25469107 CTATGTAAGTTAATATAGAATGG + Intergenic