ID: 935025086

View in Genome Browser
Species Human (GRCh38)
Location 2:99269167-99269189
Sequence TATGTAGCCACCACTTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935025080_935025086 27 Left 935025080 2:99269117-99269139 CCTCTATGCTGTTCAGTCATGCT 0: 1
1: 0
2: 1
3: 8
4: 111
Right 935025086 2:99269167-99269189 TATGTAGCCACCACTTGAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 86
935025081_935025086 4 Left 935025081 2:99269140-99269162 CCACCTTCTATGACTAGATCAGC 0: 1
1: 0
2: 0
3: 3
4: 88
Right 935025086 2:99269167-99269189 TATGTAGCCACCACTTGAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 86
935025079_935025086 28 Left 935025079 2:99269116-99269138 CCCTCTATGCTGTTCAGTCATGC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 935025086 2:99269167-99269189 TATGTAGCCACCACTTGAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 86
935025082_935025086 1 Left 935025082 2:99269143-99269165 CCTTCTATGACTAGATCAGCCTG 0: 1
1: 0
2: 0
3: 22
4: 400
Right 935025086 2:99269167-99269189 TATGTAGCCACCACTTGAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935025086 Original CRISPR TATGTAGCCACCACTTGAGG AGG Intronic
901183644 1:7358459-7358481 TAGGTGGCCATCACTGGAGGCGG + Intronic
908433618 1:64082956-64082978 TATGTAACCATCACTTGTGTTGG - Intronic
919493761 1:198238224-198238246 TAAGTAGCCTCCACTTGAGAGGG - Intronic
920722439 1:208400163-208400185 TCTGTGGCCAGGACTTGAGGAGG + Intergenic
922354804 1:224765567-224765589 AATGGAGCCACCACTTTAGTGGG + Intergenic
1064116049 10:12578312-12578334 TAGGCAGCCAGCACTTGGGGAGG + Intronic
1064475557 10:15684627-15684649 TATATTTCCAGCACTTGAGGAGG - Intronic
1066167377 10:32801840-32801862 GATGTTGCCACCACTTGGAGTGG + Intronic
1066552911 10:36579019-36579041 CATGCACCCACTACTTGAGGGGG + Intergenic
1074038882 10:109768511-109768533 TACATAGCCACCACTTGGGGAGG - Intergenic
1080494294 11:32801030-32801052 GATGGAGCCAACACTGGAGGAGG - Intergenic
1082135765 11:48547492-48547514 TCTGTAGGCTCCACTTCAGGGGG - Intergenic
1087157100 11:94915887-94915909 GCTGTAGCCAACACTTGTGGTGG + Intergenic
1092012750 12:5128675-5128697 AAAGTAGCCCCCATTTGAGGAGG - Intergenic
1097440228 12:59598913-59598935 CATGTAGCAACCATTTGAGGTGG + Intronic
1099860415 12:88218693-88218715 TGTGAAGCCAGCACTTGAGCAGG + Intergenic
1101352311 12:103942847-103942869 TTTATAGCCAACTCTTGAGGGGG + Intronic
1106399931 13:29419771-29419793 TATTTAGGCAACACTTGAGCTGG + Intronic
1106443572 13:29802016-29802038 TTTGCAGCCACCACTTAAGTGGG + Intronic
1109713021 13:66183575-66183597 AATGTTGCCACCACTAGGGGTGG + Intergenic
1111373576 13:87350091-87350113 TATGGAGCCACCATTTGAAGAGG - Intergenic
1111440752 13:88280604-88280626 GATGTTGCCACCACTGGGGGTGG - Intergenic
1114921610 14:27339170-27339192 AATCCAGCCACCACTTAAGGAGG + Intergenic
1118039387 14:61900799-61900821 TATGTACCCACCACCTGATCAGG + Intergenic
1119437250 14:74605538-74605560 TATGTCACCACCCCTTGTGGTGG + Intronic
1121292609 14:92789107-92789129 TATGTTTCCACCGCTGGAGGAGG + Intergenic
1122139778 14:99655929-99655951 TCTGCAGCCACCACTTCCGGAGG + Intronic
1127412647 15:58724662-58724684 TAGGGAACCCCCACTTGAGGTGG - Intronic
1128127115 15:65201351-65201373 CATGGAGCCATCATTTGAGGAGG - Intronic
1132692216 16:1186709-1186731 TACGTGGCCACCCGTTGAGGAGG - Intronic
1134797409 16:17054063-17054085 TCTGTGGCCAGCACTTGAGTGGG - Intergenic
1137335688 16:47546705-47546727 TCTGTAGACTCCACTTGTGGGGG - Intronic
1139109304 16:63869419-63869441 TGTGCAGTCAACACTTGAGGAGG - Intergenic
1144073570 17:11696479-11696501 TATGTATCCACCCTTTGAGCCGG - Intronic
1147896609 17:43755602-43755624 TAGGTCGCCACCACTTGCCGCGG + Exonic
1150750178 17:67854574-67854596 TGTGAAGCCACCTCTTGAGGAGG + Exonic
1151168695 17:72227226-72227248 TGTGTAGCCCACACTTAAGGAGG + Intergenic
1152009737 17:77704880-77704902 TCTGAAGCCACTACTGGAGGCGG + Intergenic
1156997120 18:43482030-43482052 TATGTAGCCATAACATGGGGAGG + Intergenic
1157312027 18:46559973-46559995 TATTTGGCCTCCACGTGAGGGGG + Intronic
927398455 2:22683133-22683155 TATGTAGCCCCCAGTGGAGATGG - Intergenic
933266048 2:80181308-80181330 GATGTTGCCACCACTGGGGGTGG + Intronic
935025086 2:99269167-99269189 TATGTAGCCACCACTTGAGGAGG + Intronic
936913821 2:117618911-117618933 TATGTAGCCAGCACTTCAGGTGG + Intergenic
939091085 2:137780863-137780885 TATATACCCACCAGTTGAGCTGG + Intergenic
939990099 2:148870047-148870069 TATGGAGCCAGGAGTTGAGGTGG - Intergenic
945750889 2:213781052-213781074 TCTGTTGCCACCACTTCAGAAGG - Intronic
946790582 2:223297152-223297174 GATGTTGCCACCACTGGGGGTGG - Intergenic
1170853836 20:20029856-20029878 TATGTAACCAAGACTTTAGGTGG - Intronic
1172174816 20:32965925-32965947 ACTTTGGCCACCACTTGAGGTGG + Intergenic
1178206302 21:30470476-30470498 TTTTTAGCCACCACTAGAGTGGG - Intergenic
1178597336 21:33966605-33966627 TAATTAGCCAGAACTTGAGGGGG + Intergenic
949346885 3:3084948-3084970 GATGTAGGCACCAATAGAGGTGG + Intronic
951847360 3:27098914-27098936 TATGTAGGCACCAGGTGCGGTGG + Intergenic
954300219 3:49697224-49697246 TATGTGGCCACCTCTGGAGTGGG + Intronic
964826839 3:160837947-160837969 TATGTAGCCAGCCCTTGGTGTGG + Intronic
966746014 3:183277757-183277779 TATGTTTCCTCCACTTTAGGAGG - Intronic
970968854 4:21958296-21958318 CATGTATCAACCACTTGAGAAGG + Intergenic
971393589 4:26208348-26208370 TCTGTAGCTACCATTTCAGGAGG - Intronic
972513958 4:39795180-39795202 TATATAGCCACCAACTGAAGAGG - Intergenic
975522341 4:75313967-75313989 TATGTAGACTCCACTTCTGGGGG + Intergenic
975734047 4:77364609-77364631 GATGTTGCCACCACTTGGGGGGG + Intronic
978825677 4:113020449-113020471 TATAAACCCAACACTTGAGGAGG - Intronic
981630508 4:146813725-146813747 TAGGTAGCCAGCACTTTGGGAGG + Intronic
982280528 4:153679863-153679885 TATGAAGACACAACTTGAAGAGG - Intergenic
982282992 4:153704911-153704933 TATGAAGACACAACTTGAAGGGG - Exonic
983131326 4:164023058-164023080 TCTGTGGCCAGCACTTGAGTTGG + Intronic
994784708 5:104142737-104142759 TATGTAGCCACCAGGTGATAAGG + Intergenic
995504558 5:112846447-112846469 TTTGTAGGCAACACTTGAGTGGG + Intronic
1001740586 5:174049943-174049965 TCTGAAGCCACCTCTTTAGGTGG + Intronic
1004687377 6:17960080-17960102 TTTCTAGCCACCATTTGGGGAGG - Intronic
1005512919 6:26528291-26528313 TATGTTGCCACCTCTGAAGGAGG - Intergenic
1008314647 6:50025490-50025512 TATTGAGACACCAGTTGAGGTGG + Intergenic
1009338330 6:62522750-62522772 TGTTGAGCAACCACTTGAGGGGG - Intergenic
1010776776 6:79895920-79895942 TGTGTAGCCACACCTTGAGATGG + Intergenic
1015451719 6:133377076-133377098 TATGTCTCCTCCACTAGAGGAGG + Intronic
1016120247 6:140335244-140335266 GATGTTGCCACCATTGGAGGTGG + Intergenic
1018305687 6:162453013-162453035 TATGCTGCCACCACTTGAAAAGG + Intronic
1018535336 6:164813063-164813085 TATGTTTCCACCACTGGGGGTGG + Intergenic
1019040455 6:169099834-169099856 GATGTTGCCACCACTGGGGGTGG - Intergenic
1020426190 7:8069060-8069082 TCTGCAGCCAGCACTTGAGTAGG - Intronic
1021365220 7:19770355-19770377 TATGTAGCCAATATTTGTGGAGG - Intronic
1021773768 7:24031242-24031264 GAAATAGCCACCACTTGAGAGGG + Intergenic
1023210968 7:37804375-37804397 TATATGGCCAACACTTGAGTGGG + Intronic
1044272599 8:90264643-90264665 TCTGTAGACACCACTTCTGGGGG + Intergenic
1044510476 8:93072333-93072355 TATGTAGTTACCATTTGATGCGG + Intergenic
1044546610 8:93466859-93466881 TCTGTAGACTCCACTTCAGGGGG + Intergenic
1188287579 X:28346872-28346894 TATGTAGGCACCATTGGATGAGG + Intergenic
1192071112 X:67941953-67941975 TTTTTAGCCACAACTTGAGCTGG + Intergenic
1192974439 X:76267941-76267963 TCTGTAGGCTCCACTTGTGGGGG + Intergenic
1193440462 X:81534852-81534874 TGTGTGGCCAGCACTTGAGAGGG - Intergenic
1195241643 X:102959070-102959092 TCTGCAGCCAGCACTTGAGTGGG - Intergenic
1196496504 X:116329734-116329756 TCTGTGGCCAGCACTTGAGTGGG + Intergenic
1197537285 X:127706659-127706681 AATGTTGCCACCACTTGGGATGG - Intergenic
1197562965 X:128047253-128047275 TCTGTGGCCACCACTTGAGTGGG - Intergenic