ID: 935025290

View in Genome Browser
Species Human (GRCh38)
Location 2:99270789-99270811
Sequence TTCGTGGCTCTCAGCTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1175
Summary {0: 16, 1: 221, 2: 448, 3: 244, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935025290 Original CRISPR TTCGTGGCTCTCAGCTCTGA AGG (reversed) Intronic