ID: 935027969

View in Genome Browser
Species Human (GRCh38)
Location 2:99295614-99295636
Sequence TCAGCCACACTCACCCATCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935027965_935027969 3 Left 935027965 2:99295588-99295610 CCCATCTCCAAAGTCATTTGTAA 0: 1
1: 0
2: 1
3: 35
4: 309
Right 935027969 2:99295614-99295636 TCAGCCACACTCACCCATCAGGG 0: 1
1: 0
2: 0
3: 16
4: 150
935027966_935027969 2 Left 935027966 2:99295589-99295611 CCATCTCCAAAGTCATTTGTAAA 0: 1
1: 0
2: 3
3: 43
4: 427
Right 935027969 2:99295614-99295636 TCAGCCACACTCACCCATCAGGG 0: 1
1: 0
2: 0
3: 16
4: 150
935027964_935027969 7 Left 935027964 2:99295584-99295606 CCTTCCCATCTCCAAAGTCATTT 0: 1
1: 0
2: 2
3: 36
4: 410
Right 935027969 2:99295614-99295636 TCAGCCACACTCACCCATCAGGG 0: 1
1: 0
2: 0
3: 16
4: 150
935027963_935027969 18 Left 935027963 2:99295573-99295595 CCTGTGCTTATCCTTCCCATCTC 0: 1
1: 0
2: 3
3: 48
4: 441
Right 935027969 2:99295614-99295636 TCAGCCACACTCACCCATCAGGG 0: 1
1: 0
2: 0
3: 16
4: 150
935027967_935027969 -4 Left 935027967 2:99295595-99295617 CCAAAGTCATTTGTAAAAATCAG 0: 1
1: 0
2: 0
3: 34
4: 418
Right 935027969 2:99295614-99295636 TCAGCCACACTCACCCATCAGGG 0: 1
1: 0
2: 0
3: 16
4: 150
935027962_935027969 28 Left 935027962 2:99295563-99295585 CCATTGTGTTCCTGTGCTTATCC 0: 1
1: 0
2: 0
3: 19
4: 204
Right 935027969 2:99295614-99295636 TCAGCCACACTCACCCATCAGGG 0: 1
1: 0
2: 0
3: 16
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935027969 Original CRISPR TCAGCCACACTCACCCATCA GGG Exonic
900494333 1:2969625-2969647 TCAGCCACACTCACCATTAGGGG + Intergenic
900776805 1:4591903-4591925 TCCTCCACAGTCACCCAGCAAGG + Intergenic
901321537 1:8343232-8343254 TCAGCCACTGTCCCCCAGCATGG + Intronic
901634045 1:10661578-10661600 TCAAACACACACACCCAACACGG + Intronic
902336453 1:15757624-15757646 TCAGCTACAGTCACCCCTCCAGG - Intronic
902435126 1:16393474-16393496 CCAGCCACACTCACCTGTCGAGG - Exonic
902609788 1:17590213-17590235 CCAGCCACACCCTCTCATCAGGG - Intronic
903380569 1:22894131-22894153 TCAATGACACTCACCCAACATGG - Intronic
903828437 1:26161107-26161129 TCAGCCACCCTCTCCCATCCAGG - Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
907962425 1:59296404-59296426 TCTGACACACACACCCATCAGGG + Intergenic
909602181 1:77472366-77472388 TCAGCCTCACTCTCCCATTCTGG - Intronic
915604767 1:156943646-156943668 TCAGACACTCTCACCCATCCTGG + Intronic
917732983 1:177894902-177894924 CCAGAAACACTCACCCATGATGG + Intergenic
920761498 1:208787413-208787435 CCAGCTCCACACACCCATCAGGG + Intergenic
921339652 1:214122045-214122067 TCAGCCTCATTCATCCATTATGG - Intergenic
923860188 1:237885398-237885420 TCAGCCACAGTGGCCCATCCTGG - Exonic
1063424932 10:5943522-5943544 TCAGCCTCACACACACATAATGG + Intronic
1064293084 10:14053268-14053290 TCAGCCATGCTCCACCATCAGGG - Intronic
1069441453 10:68432633-68432655 TCAGTCACACTTGCCAATCAAGG + Intronic
1069716239 10:70523201-70523223 CCAGCCACCCTCACCTCTCATGG - Intronic
1070162909 10:73876422-73876444 TCTGCCCCACCCACCCCTCAGGG - Intergenic
1071058694 10:81543445-81543467 TCATACACACACACACATCATGG + Intergenic
1072369327 10:94747800-94747822 TCAGGGACACTCACCTCTCAAGG + Intronic
1074748134 10:116555970-116555992 TCAGACACAATTACACATCAAGG - Intronic
1076030151 10:127150388-127150410 TCAGCAACTCTCAGCCACCAGGG + Intronic
1076565801 10:131398264-131398286 GCAGCCACACCCACCCAGGAGGG - Intergenic
1076668582 10:132106514-132106536 TCAGCAACACTCCCCCCTCCAGG - Intronic
1077284999 11:1761711-1761733 TCAGCCCCACACACCCAACCTGG + Intronic
1078568340 11:12436400-12436422 TCAGTAACAGTCTCCCATCAAGG + Intronic
1079133341 11:17762177-17762199 TCAGCCTCACTCACACTGCATGG + Intronic
1080878976 11:36301539-36301561 ACACACACACTGACCCATCATGG - Intronic
1083568306 11:63739844-63739866 TCATCTACACTCAAACATCAGGG - Intronic
1086059607 11:82687200-82687222 TCAGCCTCACTCACCTCACAGGG + Intergenic
1090969061 11:131623946-131623968 TCATCCACTCTCACCCACAAAGG + Intronic
1091339551 11:134799719-134799741 TGAGCCACAGTCATCCTTCACGG + Intergenic
1093418402 12:18947051-18947073 CCTGCCACCCACACCCATCATGG + Intergenic
1094704760 12:32903956-32903978 ACAGCCATACTCACACATCTGGG + Intergenic
1100303641 12:93330514-93330536 TCAGCCACACCTACTCATCTAGG + Intergenic
1104002521 12:124869130-124869152 TCATCCACACACACCGACCAAGG - Intronic
1104449918 12:128860728-128860750 TCAGCCACACACACACAAAACGG - Intronic
1104582971 12:130024227-130024249 TCACCCCCACTCACCTGTCATGG + Intergenic
1105628231 13:22134929-22134951 TCACCCACATCCACCCACCAGGG + Intergenic
1107469740 13:40681036-40681058 TCAGCCACACCCATCCACAAAGG + Intergenic
1108523180 13:51263005-51263027 CCAGCTACACTGACCCAGCAGGG - Intronic
1112482573 13:99790592-99790614 TAAGCCAGAGTCACCCATAAAGG - Intronic
1113607513 13:111620875-111620897 TCAGACACACACACACATCCTGG - Intronic
1113942687 13:114026619-114026641 CGAGCCCCACTCAGCCATCATGG + Intronic
1119726851 14:76926577-76926599 GCACCCACTCTCATCCATCAAGG + Intergenic
1123038408 14:105480601-105480623 TCAGCCACACTCTGCTCTCAGGG - Intergenic
1123192298 14:106583020-106583042 TGGGCCAAACCCACCCATCAGGG - Intergenic
1125074639 15:35599267-35599289 TCAACCCCACCCGCCCATCAAGG - Intergenic
1126156716 15:45572944-45572966 TGACCCACACTGACCCATCAGGG + Intergenic
1128155533 15:65389442-65389464 TCAGGCACACTCTCCCAGCAGGG + Intronic
1131305553 15:91240021-91240043 TCAGACACACTCAACCCTAAGGG - Intronic
1133303287 16:4795850-4795872 ACAGCCACACTTACCCATGAAGG - Exonic
1134294874 16:12936715-12936737 TCAGCCAAAATTACCCATGATGG - Intronic
1138315543 16:56066719-56066741 TCAGCAACAGTCATTCATCAAGG + Intergenic
1142174148 16:88637237-88637259 CCAGCCAGCCTCACCGATCAAGG + Intergenic
1142708838 17:1712596-1712618 TCTGCCATCTTCACCCATCATGG - Intergenic
1143618144 17:8065546-8065568 CCAGCCATTCTCACCTATCAGGG + Intergenic
1146546506 17:33743357-33743379 TTAGCCACACCCACACATGATGG - Intronic
1148901947 17:50884994-50885016 GCCACCACACTCACCCAGCAGGG + Intergenic
1150610925 17:66732508-66732530 GCAGCTACACTCACCCTACAGGG - Intronic
1152128361 17:78461063-78461085 TCAGCCACCCCCAACCAGCAAGG + Intronic
1153509345 18:5834963-5834985 TCGGCCACACTCAACCTTCTAGG - Intergenic
1157761485 18:50268568-50268590 CCAGCCACAGTCACCCACCGGGG - Intronic
1164744534 19:30601440-30601462 TCAGACAGGCTCCCCCATCAGGG - Intronic
1165429790 19:35766125-35766147 CCAGCCCCACTCACCCAACCTGG - Intronic
1165792300 19:38499707-38499729 TGAGCCACCCTCACCCCGCAGGG - Exonic
1165833235 19:38739783-38739805 TCAGCCAGGCTCTCCCCTCATGG - Intronic
1166717770 19:44979686-44979708 TCAGACACACTCACTCAGAAAGG - Intronic
1167124163 19:47538128-47538150 CCAGCCTCACTCACCGAGCATGG + Exonic
1167216785 19:48170523-48170545 TCAGCCACACCCGCTCATCCAGG - Exonic
1168073553 19:53965933-53965955 ACAGCCACACTCCCACCTCAGGG - Intronic
1168309646 19:55454053-55454075 TCAGCCACGGGCAGCCATCAGGG - Intronic
924991620 2:317451-317473 TCAGCCACACTGGCCCATGCCGG - Intergenic
927384573 2:22518214-22518236 TCAGCCTCACTCAACCTTCAGGG + Intergenic
935027969 2:99295614-99295636 TCAGCCACACTCACCCATCAGGG + Exonic
937347248 2:121133642-121133664 TCTGCCACGGTCACTCATCATGG + Intergenic
937706135 2:124922863-124922885 TCATGCACACTCACCAACCATGG + Intergenic
938402499 2:131005047-131005069 TCAGCCATACTCAGCCACCCAGG - Intronic
940856538 2:158732643-158732665 TCACCAACACTCACACACCAAGG + Intergenic
945350083 2:208767086-208767108 TCAGGCATTCTCACCCTTCAGGG - Intronic
946158262 2:217820929-217820951 TCAGCCTCACACTCCCAACATGG + Intronic
946634094 2:221705491-221705513 TAAGCCACTCTCTCCCCTCAAGG + Intergenic
947126071 2:226869828-226869850 TCAGACACTATCACCTATCAGGG - Intronic
1170156184 20:13271707-13271729 TGAGCCTCTCTCAACCATCATGG - Intronic
1170620480 20:17991583-17991605 TCAGCCACGGTCACCTAGCAAGG + Intronic
1170665306 20:18381346-18381368 TCAGCCAGAATTGCCCATCATGG - Intergenic
1171336271 20:24388524-24388546 TCAGCCTCACACAGCCCTCATGG - Intergenic
1172012620 20:31854739-31854761 TCAGACACACACACCCAGCAAGG - Intronic
1172930699 20:38584329-38584351 GAAGCCACACACACCCTTCAAGG + Intronic
1173136348 20:40442571-40442593 TCAGGCACACTCACACTTCCAGG - Intergenic
1173527307 20:43743035-43743057 CCAGCCACACTGGCCCATCCTGG + Intergenic
1173617303 20:44411481-44411503 GCACCCGCACCCACCCATCAGGG - Intronic
1174340775 20:49893616-49893638 TCAGCCACACTCCCCCTGCCTGG + Intergenic
1174487492 20:50870596-50870618 TCAGCCACCCTCAGCCATGAGGG + Intronic
1175303247 20:57957823-57957845 TCACCCACAGTCACCCACCATGG - Intergenic
1175920536 20:62448700-62448722 TCAGCCCCACTCACTCAGAAGGG + Intergenic
1176367779 21:6044208-6044230 TCAGCCACACTCGGCGATCAGGG + Intergenic
1178607135 21:34048290-34048312 CAAGCCACACGCATCCATCAAGG - Intergenic
1179755740 21:43494334-43494356 TCAGCCACACTCGGCGATCAGGG - Intergenic
1184034702 22:41912968-41912990 CAAGCTACCCTCACCCATCATGG + Intronic
1184870960 22:47238253-47238275 CCAGCCACACTGACCAGTCACGG + Intergenic
1185092769 22:48785255-48785277 TCGGCCACACTCAGCCTTAACGG - Intronic
954459819 3:50619921-50619943 TTAGCCATGCTCACCCATAAAGG - Intronic
954609017 3:51934454-51934476 TCAAGCACACTCACTCACCAGGG + Exonic
954985372 3:54786002-54786024 CCAGCCACCCTCTGCCATCATGG + Intronic
959162852 3:102740962-102740984 TTAGCCAAGCTCATCCATCATGG - Intergenic
960965130 3:123099449-123099471 TCCTCCCCACTCACCCCTCAGGG + Intronic
961738148 3:129015182-129015204 GCAGCCACACTGACCCTCCAGGG + Intronic
967887949 3:194346034-194346056 TCAGCCAAACCCCCACATCAGGG - Intronic
968654782 4:1773753-1773775 TCACCCACACTGAGCCATGAGGG - Intergenic
970324573 4:14910183-14910205 TCAACCACAATCACCCTCCAAGG + Intergenic
970949076 4:21731186-21731208 ACAGCCTCTCTCACCCATAATGG - Intronic
977627461 4:99203012-99203034 TCAGTCTCTCTCTCCCATCATGG - Exonic
983513133 4:168630185-168630207 TTAGCAAGACTCACCCAACAGGG + Intronic
984840085 4:184060212-184060234 TCAGCCCCACTCCACCATCTCGG + Intergenic
985822272 5:2168467-2168489 TCCACCACACTGTCCCATCAAGG - Intergenic
994185976 5:96815686-96815708 ACAGACACACTCAGCCATTAAGG + Intronic
995811735 5:116114685-116114707 GTAGCCCCACTCTCCCATCATGG - Intronic
996220096 5:120921047-120921069 TATGCCTCACTCACCCATTAAGG - Intergenic
1000213262 5:159130035-159130057 TCAGCCACCCACACCCTTCATGG - Intergenic
1001942019 5:175747265-175747287 TCAGCCACAGGCATTCATCAAGG - Intergenic
1002430371 5:179199757-179199779 TCAGCCTGAGGCACCCATCAGGG + Intronic
1003173003 6:3734591-3734613 TCATCCTCACTCTCCCATAAAGG + Intronic
1004974907 6:20954031-20954053 TCACCCACACCCACACAACATGG - Intronic
1005008081 6:21310056-21310078 TCAGCCACACTCATTTTTCAGGG + Intergenic
1005168093 6:22948939-22948961 TCACCCACTCTCACCAATCCAGG - Intergenic
1005951095 6:30631863-30631885 TCAGGCACACTCCCACCTCACGG - Intronic
1006378029 6:33682636-33682658 CCCGGCACACTCACCCACCATGG - Exonic
1007475563 6:42117601-42117623 TCTGCCACTCTCACTCATCCAGG - Intronic
1012840216 6:104320541-104320563 TCAGCCACACAAACACAACATGG - Intergenic
1013020786 6:106215346-106215368 TCACCTACCCTCACCCCTCAAGG + Intronic
1015843745 6:137497276-137497298 CCACCCACACTCACGCATTACGG - Intergenic
1017497328 6:154994143-154994165 TCAGCCAAAATTACGCATCATGG - Intronic
1017588120 6:155948555-155948577 CCAGCCACACTCACCTGTCAGGG - Intergenic
1017955883 6:159177420-159177442 TCATCCACAGTCACCCATGGCGG + Intronic
1018752418 6:166818953-166818975 TAAGCCACACTCCCCGATGAAGG - Intronic
1020251869 7:6475616-6475638 ACAGCCACACTCAGCCAGGAAGG + Intronic
1021531677 7:21653489-21653511 TCAGACACCCTCACACATTACGG - Intronic
1023556382 7:41427510-41427532 TAAACCACACTCAAACATCAGGG + Intergenic
1027852685 7:83468727-83468749 TCTGCCACTCACACCCAGCAGGG + Intronic
1029877364 7:103768518-103768540 GCAGCCACACTGCCTCATCATGG + Intronic
1031035112 7:116780504-116780526 CCAGCCACATTAATCCATCAGGG - Intronic
1031539134 7:122971848-122971870 TGTGCCTCACTCAGCCATCATGG - Intergenic
1035261247 7:157662934-157662956 TCAGCCACGTTCACGCAGCACGG + Intronic
1036753034 8:11455238-11455260 CCACCCACACTCACACAGCAAGG - Intronic
1036753085 8:11455487-11455509 TCACACTCACACACCCATCAGGG - Intronic
1036753093 8:11455526-11455548 TCAGACTCACACACCCAGCAGGG - Intronic
1036753218 8:11456204-11456226 TCACTCACACTCACACAGCAAGG - Intronic
1036753277 8:11456488-11456510 TCACACTCACACACCCATCAGGG - Intronic
1036785520 8:11683472-11683494 TCATTCAAACTCACCCATCAAGG + Intronic
1040102337 8:43516714-43516736 TCCTCCACCCTCACCCACCATGG - Intergenic
1049110569 8:140639894-140639916 TCAGACACGCTCACCAGTCAAGG - Intergenic
1049287710 8:141785503-141785525 TGTGCCACACTCACCCCTCTGGG - Intergenic
1053464624 9:38296637-38296659 TCAGCCACCCTTCCCCCTCAAGG - Intergenic
1055001064 9:71448946-71448968 TCACCCACATCCACCCATGAAGG + Intergenic
1055353993 9:75418442-75418464 CCAGCCATACTCTCCCAGCATGG + Intergenic
1056233572 9:84570409-84570431 TCACACACACACACCCCTCAGGG + Intergenic
1186459334 X:9735614-9735636 TCAGGAACACTCACCCATCCCGG + Intronic
1186906057 X:14111695-14111717 TGAGACACACTCACTCTTCAAGG + Intergenic
1190291809 X:48998121-48998143 CCAGTCACACTCACCCACAAGGG + Intronic
1192097889 X:68232635-68232657 TCAGCCATTCTTACCCATTAAGG + Intronic
1193402467 X:81062294-81062316 ACACACACACTCACACATCATGG - Intergenic
1197334081 X:125190296-125190318 TCAGCCACAGTCACCTCTAATGG - Intergenic