ID: 935036555

View in Genome Browser
Species Human (GRCh38)
Location 2:99381383-99381405
Sequence GTGCTCAGTGAACCAGAATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935036555 Original CRISPR GTGCTCAGTGAACCAGAATG CGG Intronic
900669215 1:3839872-3839894 ATGCTCTGTGAACCATGATGGGG - Intronic
902611862 1:17602475-17602497 GTGCCCTGGGGACCAGAATGAGG + Intronic
902715106 1:18267362-18267384 GTGCTCAGGAAAACAGGATGTGG + Intronic
903291706 1:22318375-22318397 GTGCCCACTGTACCAGCATGCGG - Intergenic
904226592 1:29026101-29026123 GTGCTGAGTAGCCCAGAATGGGG + Intronic
904622959 1:31786518-31786540 GTGCCCACTGAGCCAGACTGTGG - Intergenic
907299010 1:53474436-53474458 GGGCTCTGTGAACTAGGATGAGG - Intergenic
908065019 1:60393429-60393451 GTGCTCAGTGACCCCCAAAGTGG - Intergenic
908456964 1:64313449-64313471 GATCTCAGTGACCCTGAATGGGG + Intergenic
909939865 1:81598817-81598839 TTCCTCAATAAACCAGAATGGGG + Intronic
910710504 1:90174980-90175002 GTCCTCTTTGAACCAGAAAGTGG - Intergenic
911122022 1:94305944-94305966 ACTCTCACTGAACCAGAATGTGG - Intergenic
912307368 1:108582892-108582914 GTCCTCTGGGAACCAGAATTTGG + Intronic
915455284 1:156036434-156036456 GTGCTGAATGAACCAGAATAGGG + Exonic
916114098 1:161472818-161472840 GTGATCAGTGGGTCAGAATGCGG + Intergenic
918732652 1:188017601-188017623 GTGCTCAGTATATCAGAATTTGG + Intergenic
1064681952 10:17819134-17819156 GTGAACATTCAACCAGAATGTGG + Intronic
1066474548 10:35732469-35732491 TTGCTCTGTGACCCAGACTGGGG + Intergenic
1066780001 10:38934317-38934339 GGGCTCAGGGAAGCAGAATAGGG - Intergenic
1068959983 10:62857651-62857673 GTGCTCACTGAACCTGAAGAGGG - Intronic
1072432424 10:95384899-95384921 CTACTCAGGGAACCAGATTGAGG - Intronic
1076140681 10:128076795-128076817 CTTGTCATTGAACCAGAATGTGG + Intronic
1076391976 10:130110311-130110333 GCGCTCAGTGAACGAGACTCAGG + Intergenic
1076615248 10:131750569-131750591 CTCCCCAGTGAAGCAGAATGAGG - Intergenic
1078639981 11:13085368-13085390 GTGCTCAGGAAACCAGGAAGAGG - Intergenic
1080757830 11:35219209-35219231 CTTCTCAGTGATTCAGAATGTGG + Intronic
1081059491 11:38455683-38455705 GTGGTCTATGAACCAGAATGTGG + Intergenic
1082084803 11:48041099-48041121 GAGCTCAGTGACACAGAAAGAGG - Intronic
1083417502 11:62535176-62535198 CTGCTCAGGGGACCAGATTGTGG - Exonic
1087198726 11:95323986-95324008 GTTCTCAATTACCCAGAATGAGG + Intergenic
1088343758 11:108799274-108799296 GTGACGAGTGAACCAGAATCTGG - Intronic
1088911463 11:114195627-114195649 GTGCACAGTGACCCAGAACTTGG + Intronic
1089498577 11:118919948-118919970 GTGCTCAGTGACCCAGCAGGGGG - Intronic
1089725764 11:120478197-120478219 GTACTCAGTGAATGAGACTGAGG - Exonic
1089779283 11:120861852-120861874 GTGTTCACTGGACTAGAATGTGG + Intronic
1090547993 11:127786629-127786651 GTGCTCAGACAAACAGAATATGG - Intergenic
1092614895 12:10207963-10207985 CTGCTCTGAGAAACAGAATGAGG + Intergenic
1092949337 12:13486852-13486874 GTGCTCCATGAACCAGCTTGGGG - Intergenic
1095038789 12:37420968-37420990 GTGCCCTGTGCACCACAATGCGG - Intergenic
1098562376 12:71889210-71889232 GTTTTTAGTGAACCAGGATGTGG + Intronic
1099819434 12:87691623-87691645 GTGCTCAGTGAACCTAAAGATGG - Intergenic
1102914298 12:116741485-116741507 GCCATCAGTGAACCAGAAAGTGG - Intronic
1103451565 12:121032867-121032889 ATGCTCAGAGAAAAAGAATGGGG - Intronic
1104410459 12:128553690-128553712 GTGCTCCATGATTCAGAATGGGG - Intronic
1105254543 13:18734047-18734069 CTGCTGTGTGAACCAGAATTTGG - Intergenic
1105775481 13:23655535-23655557 CTGCTTAGTGAACTAGAATGGGG + Intronic
1106763223 13:32888109-32888131 GTGGTCAGTGAGGCAGAATAGGG - Intergenic
1107471460 13:40695251-40695273 GTGAGCAGTGACCCAGGATGTGG + Intergenic
1108089959 13:46838892-46838914 ATTCTCAATTAACCAGAATGTGG + Intronic
1114698096 14:24646194-24646216 GTGCTCAGTGAAACTCACTGAGG - Intergenic
1116008473 14:39323198-39323220 GTTCTAAGTGAAGCAAAATGAGG - Intronic
1121489588 14:94348357-94348379 GTGCACAGTGCACCAGGATTTGG + Intergenic
1202937253 14_KI270725v1_random:101916-101938 GGGCTCAGGGAAGCAGAATAGGG + Intergenic
1124149990 15:27168723-27168745 GTGGTCTGTGAACCAGGAAGTGG + Intronic
1124900415 15:33817473-33817495 TTTCTCTCTGAACCAGAATGAGG - Intronic
1125538505 15:40456556-40456578 GTGCTCAGAAAACCAGGCTGAGG - Intronic
1127352069 15:58163038-58163060 GTGCTGAGTCAACTAGAAGGTGG + Intronic
1127475135 15:59325925-59325947 CTGTCCAGTGAATCAGAATGTGG + Intronic
1129598690 15:76984477-76984499 GGGCTCAGTGAGTAAGAATGAGG + Intergenic
1132032024 15:98446169-98446191 GTGCAGAGTGAACCAGGATGAGG - Intronic
1132075910 15:98819485-98819507 GCCCTCCGTGAACCAGAAAGTGG + Intronic
1132322295 15:100934948-100934970 CTGCTCAGTTGACCAGAAGGAGG + Intronic
1136574022 16:31112614-31112636 GGGCTCAGTGAACCTGAATGGGG - Intronic
1136671785 16:31864976-31864998 GTTCCCAGTGCACCTGAATGTGG + Intergenic
1136956613 16:34794357-34794379 GGGCTCAGGGAAGCAGAATAGGG - Intergenic
1140807330 16:78545118-78545140 GTGCTGAGGGAATCAGAATGTGG - Intronic
1141450398 16:84096139-84096161 GTTCTCACTGAACCAGAAGGGGG + Intronic
1142330566 16:89449930-89449952 GTGCTCAGTGAAGCAGGAGCTGG - Intronic
1145087744 17:19956980-19957002 ATTCTCAGTGAACTAAAATGAGG - Intronic
1145709310 17:26955007-26955029 GGGCTCAGGGAAGCAGAATAGGG - Intergenic
1145792079 17:27633570-27633592 GAGCCCTGTGAACCAAAATGTGG - Intronic
1148962108 17:51401950-51401972 GAGCTCTATGAAACAGAATGGGG - Intergenic
1150544078 17:66135394-66135416 GTGAACAGTGAAACAGAAAGTGG + Intronic
1153167344 18:2277756-2277778 ATGCTCTGTTAACCAGATTGTGG + Intergenic
1153811136 18:8752858-8752880 GTGCACAGTGAGCCATAATGAGG + Intronic
1154436487 18:14346573-14346595 CTGCTGTGTGAACCAGAATTTGG + Intergenic
1155393670 18:25363934-25363956 GTGGTCAGGGCACCAGCATGGGG - Intergenic
1156847291 18:41681222-41681244 GTGCTAAGCCAACTAGAATGTGG - Intergenic
1156927491 18:42599412-42599434 GTGCTTTATGACCCAGAATGTGG + Intergenic
1159101052 18:63959539-63959561 GTGCTTTGTGGCCCAGAATGTGG + Intronic
1160339690 18:78078916-78078938 GTGCTCAGTGAAGCTGGCTGAGG - Intergenic
1163645410 19:18486367-18486389 GTACTCTGTGACCCAGAGTGGGG + Intronic
1202682585 1_KI270712v1_random:21292-21314 GGGCTCAGGGAAGCAGAATAGGG - Intergenic
924976984 2:186734-186756 TTCCTCCGTGAACCTGAATGTGG + Intergenic
925532643 2:4882001-4882023 GGACTCAGCGAACCAGAATGAGG - Intergenic
925804214 2:7632315-7632337 GTGCTCATTGAAGTAGAAAGTGG + Intergenic
925878802 2:8333432-8333454 GTTCCCAGGGAACGAGAATGTGG - Intergenic
927205154 2:20604316-20604338 GGGCTGAGAGAAGCAGAATGTGG - Intronic
927214150 2:20657103-20657125 GTGCTCAGGAAAGCTGAATGAGG + Intergenic
930959833 2:57247919-57247941 GTGCTTAATGGCCCAGAATGTGG + Intergenic
933590993 2:84232143-84232165 CTGCTCAGTAAAGCAGAATGAGG + Intergenic
934249218 2:90333884-90333906 GGGCTCAGGGAAGCAGAATAGGG + Intergenic
934260361 2:91469590-91469612 GGGCTCAGGGAAGCAGAATAGGG - Intergenic
934303676 2:91801532-91801554 GGGCTCAGGGAAGCAGAATAGGG - Intergenic
934329579 2:92051220-92051242 GGGCTCAGGGAAGCAGAATAGGG + Intergenic
934467798 2:94281132-94281154 GGGCTCAGGGAAGCAGAATAGGG + Intergenic
935036555 2:99381383-99381405 GTGCTCAGTGAACCAGAATGCGG + Intronic
936157054 2:110054596-110054618 GTGCTCTGTGAACAAAAGTGTGG + Intergenic
936187640 2:110316848-110316870 GTGCTCTGTGAACAAAAGTGTGG - Intergenic
938518945 2:132046279-132046301 GGGCTCAGGGAAGCAGAATAGGG + Intergenic
941343134 2:164332556-164332578 GTCTTCAGTGATCTAGAATGTGG + Intergenic
944210801 2:197204909-197204931 GTTATCAGAGAAGCAGAATGGGG + Intronic
944950564 2:204744273-204744295 GTTCACAGTAAAACAGAATGTGG + Intronic
947157258 2:227175044-227175066 GTGGTCAGGGAAGCAGACTGAGG + Intronic
1168879074 20:1191201-1191223 GTGATCTGTGAGACAGAATGAGG + Intergenic
1170042696 20:12054663-12054685 GTGAACATTGAACCAGACTGGGG - Intergenic
1172929065 20:38569775-38569797 GTGCTCAGTGACCAAGTATCAGG - Intronic
1173358443 20:42317550-42317572 GGGCATAGTGAACCAGCATGTGG + Intronic
1173726057 20:45298479-45298501 GCGCTTCGTGAACCAGATTGTGG - Exonic
1175952498 20:62590891-62590913 CTGCTCAGGGAACCAGAATGAGG - Intergenic
1176586067 21:8587201-8587223 GGGCTCAGGGAAGCAGAATAAGG - Intergenic
1177148486 21:17431264-17431286 GTCCTCAGTGAAGCAGAACAGGG - Intergenic
1180268874 22:10564107-10564129 GGGCTCAGGGAAGCAGAATAAGG - Intergenic
1180280697 22:10691318-10691340 GGGCTCAGGGAAGCAGAATAGGG - Intergenic
1183301402 22:37060805-37060827 GTGCTCTGTGAACCAGCCGGCGG - Exonic
1184146018 22:42611192-42611214 TTGCTCCGTCAACCAGACTGGGG + Intronic
1184688744 22:46108065-46108087 GTGGTCAGGGAGCCTGAATGTGG - Intronic
1185201836 22:49511675-49511697 CTGATCAGTGAACCAGGAAGTGG + Intronic
1185201852 22:49511785-49511807 CTGATCAGTGAACCAGGAAGTGG + Intronic
1185201868 22:49511895-49511917 CTGATCAGTGAACCAGGAAGTGG + Intronic
1185201874 22:49511932-49511954 CTGATCAGTGAACCAGGAAGTGG + Intronic
1203289866 22_KI270735v1_random:25538-25560 GGGCTCAGGGAAGCAGAATAAGG + Intergenic
949408059 3:3735282-3735304 GTTCTCACTGAACCAAAGTGGGG - Intronic
951035556 3:17928152-17928174 GTGCTCAGTGAGGCAGACAGAGG - Intronic
952824490 3:37513789-37513811 GTGCGCAGTTGACCTGAATGGGG + Exonic
955746843 3:62148854-62148876 GAGCCCAGGGATCCAGAATGAGG + Intronic
956254008 3:67264430-67264452 CTGCTCAGTGAACAAGCAAGTGG + Intergenic
959267072 3:104156121-104156143 GTGGTCAGAGAAAGAGAATGAGG + Intergenic
960050863 3:113238069-113238091 ATGCTACGGGAACCAGAATGAGG + Intronic
961558310 3:127711694-127711716 GTGCCCAATGCACCAGAAGGTGG - Intronic
963296245 3:143549829-143549851 ATGCTCAGAGAACCAAAAAGAGG + Intronic
963366173 3:144337362-144337384 GGCCTCAGTGAACCAGAAACTGG - Intergenic
963732191 3:148985317-148985339 GTGCTGAATGAACCAGAATAGGG + Intergenic
964526130 3:157616686-157616708 GGGCTCAGTGAAGAAGAAGGTGG + Intronic
965504798 3:169502577-169502599 TTGCTCAATGAACAAGAAAGTGG + Intronic
966601807 3:181782809-181782831 GTTGTCAGTAAACCAGAAAGAGG - Intergenic
969629254 4:8325975-8325997 AAGCTCAGTGAACCATAATGGGG + Intergenic
970949412 4:21736057-21736079 GTGCTCATTTAACCTTAATGTGG + Intronic
973282086 4:48369634-48369656 GTACTAAGTGAACCCAAATGAGG - Intronic
973834676 4:54797329-54797351 GTCATCTGTGAACCAGAAAGAGG + Intergenic
976856213 4:89608499-89608521 GTGCTCAGAGAAAGAGAAGGTGG + Intergenic
977443798 4:97102468-97102490 GTTGTCAGTTTACCAGAATGAGG - Intergenic
977822806 4:101495030-101495052 GTGTTTAATGACCCAGAATGTGG - Intronic
977838469 4:101672605-101672627 GTCCTCTGAGAAACAGAATGAGG - Intronic
981521648 4:145668636-145668658 GTGCTCAGGGAAGCAGAATTGGG - Intergenic
982845323 4:160245872-160245894 GAGCTCAGTGAATCAGTCTGAGG + Intergenic
985736767 5:1587400-1587422 GTTGTCAGTTTACCAGAATGAGG - Intergenic
985789204 5:1916235-1916257 CTGCTCCGGGAACCAGAAGGAGG + Intergenic
986564285 5:9095903-9095925 ATGTTCAATGAACAAGAATGAGG - Intronic
987849062 5:23325392-23325414 GTGCTCAGGCAATGAGAATGGGG - Intergenic
993004304 5:82414174-82414196 GTGCTCTGTGCTCCAGAGTGAGG + Intergenic
995621567 5:114031434-114031456 TTTTTCAGTGAATCAGAATGAGG - Intergenic
997154345 5:131537239-131537261 TTGCCCAGGGAACCAGAATTAGG - Intronic
997821781 5:137072650-137072672 GTGAGCAATGAACCAGAAAGAGG - Intronic
999368112 5:151036014-151036036 GTGATCACAGAACCAGAGTGTGG + Intronic
1001937056 5:175712740-175712762 GTGCTCTGTGACCTTGAATGAGG - Intergenic
1001957915 5:175861063-175861085 ATGCTCTGTGATCCAGAAAGTGG + Intronic
1002192951 5:177488305-177488327 GTGGTCAGTCAACCTGAAGGGGG - Intronic
1002383128 5:178844873-178844895 GTGTTCAGTGATCCAGTACGAGG + Intergenic
1007039011 6:38704199-38704221 GTGCTCACCTAACCAAAATGAGG + Intergenic
1009467521 6:63990556-63990578 GTTCTCAGTGATCCCCAATGTGG - Intronic
1012751906 6:103174855-103174877 GTGATTAGAGAACAAGAATGTGG + Intergenic
1014620957 6:123666451-123666473 ATGCTCAGTGAACAAGAACTGGG + Intergenic
1016051969 6:139539179-139539201 CTCCTCAGTGAACCAGAAACTGG - Intergenic
1016352391 6:143182427-143182449 GTGCTCAAGGAACCAGAAGGAGG - Intronic
1017217668 6:151928958-151928980 GTGTTTTGTGACCCAGAATGTGG + Intronic
1017998560 6:159557257-159557279 GAGCTCAGTGAAAGAGCATGAGG - Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1018420685 6:163638364-163638386 GTGCACAGAGACACAGAATGTGG - Intergenic
1021418362 7:20416562-20416584 GTTGTCAGTTTACCAGAATGAGG - Intergenic
1021910586 7:25382429-25382451 ATGCTCAGTGAATCAGAATCAGG - Intergenic
1023428831 7:40068333-40068355 GTTCTCAGTGAACCATATGGGGG + Intronic
1023510249 7:40945188-40945210 GTCCTCAGTGAAACACACTGAGG + Intergenic
1024805054 7:53129435-53129457 GGGCTCAGGGAAGCAGAATACGG + Intergenic
1025307544 7:57876858-57876880 GGGCTCAGGGAAGCAGAATAGGG + Intergenic
1025481123 7:60984297-60984319 GGGCTCAGGGAAGCAGAATAGGG - Intergenic
1025838139 7:65115559-65115581 GGGCTCAGGGAAGCAGAATAGGG - Intergenic
1025879135 7:65517526-65517548 GGGCTCAGGGAAGCAGAATAGGG + Intergenic
1025884934 7:65580413-65580435 GGGCTCAGGGAAGCAGAATAGGG + Intergenic
1026075474 7:67163105-67163127 GTGCCCTGAGAAGCAGAATGCGG - Intronic
1028109291 7:86919899-86919921 GTGCACAGAGAACCATTATGAGG + Intronic
1030007863 7:105136097-105136119 CTGTTCAGTGAACCTTAATGAGG - Intronic
1031877567 7:127159101-127159123 CTGCTCAGTGGACCAGGCTGTGG + Intronic
1034882089 7:154770531-154770553 GTCCTCTGTGAACCAGAAATTGG + Intronic
1035579309 8:730284-730306 TTTCTCAGTGAGGCAGAATGTGG - Intronic
1036518477 8:9468311-9468333 GTGCCCAGAGAGCAAGAATGAGG + Intergenic
1039390675 8:37178793-37178815 GTGCTCAGTGAAGGAGGAGGGGG + Intergenic
1040521072 8:48176560-48176582 GTTCTCACTCTACCAGAATGTGG - Intergenic
1040956394 8:52983933-52983955 GTTGTCAGTTTACCAGAATGAGG - Intergenic
1043887246 8:85615425-85615447 GTCCTTAGTGAAACATAATGGGG - Intergenic
1046269095 8:111870021-111870043 GAGCTCAGTAAACCATACTGAGG - Intergenic
1047028049 8:120846139-120846161 ATGTTCAGTGAGCCTGAATGAGG + Intergenic
1049137441 8:140916152-140916174 CTGTTGAGAGAACCAGAATGAGG + Intronic
1050039003 9:1468434-1468456 ATGGTCTGTGAACCTGAATGAGG - Intergenic
1050476272 9:6044773-6044795 GTTCTCAGTGAAACACACTGAGG + Intergenic
1053698217 9:40659202-40659224 GGGCTCAGGGAAGCAGAATAGGG + Intergenic
1054309508 9:63458610-63458632 GGGCTCAGGGAAGCAGAATAGGG + Intergenic
1054408302 9:64782751-64782773 GGGCTCAGGGAAGCAGAATAGGG + Intergenic
1054441448 9:65266559-65266581 GGGCTCAGGGAAGCAGAATAGGG + Intergenic
1054488830 9:65754930-65754952 GGGCTCAGGGAAGCAGAATAGGG - Intergenic
1058520481 9:105810608-105810630 GTTGTCAGTTTACCAGAATGAGG - Intergenic
1058735542 9:107890725-107890747 GTTGTCAGTGAACTAGAAAGTGG - Intergenic
1202780580 9_KI270717v1_random:32393-32415 GGGCTCAGGGAAGCAGAATAGGG + Intergenic
1203581941 Un_KI270746v1:15608-15630 GGGCTCAGGGAAGCAGAATAGGG - Intergenic
1203587359 Un_KI270747v1:17987-18009 GGGCTCAGGGAAGCAGAATAGGG + Intergenic
1203615972 Un_KI270749v1:64717-64739 GGGCTCAGGGAAGCAGAATAAGG - Intergenic
1188000488 X:24975756-24975778 GAGATCTGTGAAGCAGAATGGGG + Intronic
1190915722 X:54809766-54809788 GTTGACAGTGACCCAGAATGTGG + Exonic
1192268772 X:69558911-69558933 TTTCTCAGTGAACAAGCATGGGG + Intergenic
1193357651 X:80540371-80540393 TTGCTCTGTCAACCAGGATGGGG - Intergenic
1194327727 X:92540844-92540866 GTCATCTGTGAGCCAGAATGGGG + Intronic
1195639148 X:107154933-107154955 GGGCTCAATGAGGCAGAATGAGG + Intronic
1199563334 X:149187477-149187499 GAGCTCAGGGAAGGAGAATGGGG - Intergenic
1199810013 X:151339842-151339864 CTGCTCAGTGGGCCAAAATGTGG + Intergenic
1200636440 Y:5660062-5660084 GTCATCTGTGAGCCAGAATGGGG + Intronic