ID: 935037129

View in Genome Browser
Species Human (GRCh38)
Location 2:99388399-99388421
Sequence TAAGTATGATGTCAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 8, 2: 21, 3: 101, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935037121_935037129 25 Left 935037121 2:99388351-99388373 CCTTTCCTTATTCCTGATATTAA 0: 1
1: 0
2: 22
3: 213
4: 2623
Right 935037129 2:99388399-99388421 TAAGTATGATGTCAGCTGCAGGG 0: 1
1: 8
2: 21
3: 101
4: 320
935037124_935037129 20 Left 935037124 2:99388356-99388378 CCTTATTCCTGATATTAAGGGAA 0: 1
1: 2
2: 15
3: 112
4: 537
Right 935037129 2:99388399-99388421 TAAGTATGATGTCAGCTGCAGGG 0: 1
1: 8
2: 21
3: 101
4: 320
935037125_935037129 13 Left 935037125 2:99388363-99388385 CCTGATATTAAGGGAAAGTGCTC 0: 1
1: 0
2: 0
3: 16
4: 104
Right 935037129 2:99388399-99388421 TAAGTATGATGTCAGCTGCAGGG 0: 1
1: 8
2: 21
3: 101
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935037129 Original CRISPR TAAGTATGATGTCAGCTGCA GGG Intronic
901168958 1:7240836-7240858 TAAGTATGATGTTAGCTGTATGG - Intronic
902848561 1:19133419-19133441 TAAGTATGATGTTAGCACAAGGG - Intronic
904475601 1:30762710-30762732 TGAGGATGAGGTCAGCAGCAGGG - Intergenic
904535369 1:31195922-31195944 TAAGGCTGATATCAGCTGCAAGG - Intronic
906969779 1:50499341-50499363 TAGGTAAGATGTTAGCTGTAGGG + Intronic
908701073 1:66900988-66901010 TAAGTATAATGTTAGCTGTGGGG + Intronic
909194352 1:72598356-72598378 AAAGTATGATGTTAGCTGTAGGG - Intergenic
910161287 1:84275457-84275479 TAAGTATGATGTTAACTGTAGGG + Intergenic
910220187 1:84881860-84881882 TGAGTATGATGTTAGCTGTGGGG - Intronic
911246531 1:95524638-95524660 TATGAGTGATGTCAGCTGGAGGG + Intergenic
911769889 1:101726972-101726994 TAAGTTTTATTTCAGCTGGAAGG + Intergenic
912479328 1:109967782-109967804 TAAGTATGATGTTAGCTGCAGGG - Intergenic
912970731 1:114280422-114280444 TAAGTATGATGTTAGCTATAGGG - Intergenic
913204718 1:116527288-116527310 TACAGATGATGTTAGCTGCAGGG + Intronic
915612976 1:157009981-157010003 TGAGTATGATGTTAGCTGTGGGG - Intronic
917769453 1:178261071-178261093 TAATAATGATGGCAGCAGCAAGG - Intronic
918539831 1:185618920-185618942 TAAGTATGATGTTCACTGTAGGG - Intergenic
918606693 1:186436364-186436386 TAAGAATATTTTCAGCTGCATGG + Intergenic
918623400 1:186630973-186630995 AAAGTATTATGGCAGCAGCAAGG - Intergenic
921810650 1:219509434-219509456 AAAGTTTGATGTTAGCTGCAAGG - Intergenic
922004117 1:221511525-221511547 TAAGTATGAAGGCAGCTGTGTGG - Intergenic
922143027 1:222909029-222909051 TGAGGATGATGTGGGCTGCATGG + Intronic
922257229 1:223902931-223902953 GAAGGATGATGTGAGCAGCAAGG + Intergenic
922694967 1:227726105-227726127 GAAGCATGGTGTTAGCTGCAGGG + Intergenic
923420008 1:233803928-233803950 TAAATATGATGTTAGCTATAGGG - Intergenic
923878697 1:238079001-238079023 TAAGTATGATGTGAGCTGTGAGG + Intergenic
924505219 1:244676667-244676689 TAAGTATGATATTAGCTGTGAGG + Intronic
924821150 1:247491805-247491827 TGAGGATGAAGTCAGCAGCAGGG + Intergenic
924842960 1:247733711-247733733 TAACTATGATATTAGTTGCAGGG - Intergenic
1062778022 10:171757-171779 TAAGTATGATGTTAGCTGTAGGG - Intronic
1064465817 10:15580804-15580826 CAAGTTTGATGCCAGCTGCAGGG - Intronic
1064686358 10:17866437-17866459 CAATTATGATCTCAGATGCAGGG - Intronic
1065243424 10:23731713-23731735 TAAGTATAAGGTTAGCTGTAGGG + Intronic
1066548588 10:36529596-36529618 TAAGTATGATGTTAGCTGCAGGG - Intergenic
1067983019 10:51108652-51108674 TAAGTATGATGTTAGCTGTGGGG - Intronic
1068475931 10:57525214-57525236 TAAGTATGATGTCTTCTTCTAGG - Intergenic
1068655710 10:59574068-59574090 TAAGTATGATATTAGCTGTAGGG - Intergenic
1070504442 10:77100611-77100633 ATAGTATGATGACAGCAGCATGG + Intronic
1071236338 10:83654394-83654416 TAAGTATGATGTTAACTGTGGGG + Intergenic
1071606119 10:86991894-86991916 GAAGTATTATGTTAGCTGCAGGG - Intergenic
1071815665 10:89230263-89230285 TCAGTATAATGTCAGCTCCATGG - Intronic
1072026576 10:91465538-91465560 TAATTATGATGTTAGCTGTAGGG + Intronic
1072338838 10:94426271-94426293 TAAGTATGATGTTAGCTGTAGGG + Intronic
1072504133 10:96047181-96047203 TTAGTATAGTGTCTGCTGCATGG + Intronic
1073317056 10:102589884-102589906 CAAGTATGATGTTAGCTGTGGGG + Intronic
1073898358 10:108189342-108189364 TCAGTATGATGTCAGCTACTGGG - Intergenic
1074481966 10:113831590-113831612 TAAATATGATGTTAGCTGTAGGG - Intergenic
1078332218 11:10433458-10433480 TAGGTATGATGTTAGCTGTGGGG - Intronic
1078403799 11:11050260-11050282 TAAGTATAATGTTAGCTGTAGGG + Intergenic
1078833481 11:15000518-15000540 TAAATGTGATGTCAACTTCAGGG + Intronic
1078942450 11:16023048-16023070 TAATTATGATGTCATCTGGAAGG - Intronic
1079700974 11:23547131-23547153 TAGGTACGATGTTAGCTGTAGGG + Intergenic
1080319835 11:30994802-30994824 TGAGTATGATGTCAGCTGTAGGG - Intronic
1080956721 11:37105808-37105830 TAAGTCTGATCCCAGCAGCAAGG - Intergenic
1081502127 11:43677222-43677244 AAACTATGAAGTTAGCTGCAAGG + Intronic
1081723891 11:45311988-45312010 TAAGTATAATGTTTGCTGTAGGG + Intergenic
1083974778 11:66109143-66109165 CAAGTTTTATGCCAGCTGCAGGG + Intronic
1084633113 11:70369106-70369128 TAAGTATGATGTTCACTGTAGGG + Intronic
1084985068 11:72862146-72862168 TAAGTATGAAGTTAGCAGTAGGG - Intronic
1085935699 11:81139207-81139229 TAAGTTTGGTGTCAGCAGCTGGG - Intergenic
1087612451 11:100451071-100451093 TAATTATAATGTCATCTTCATGG + Intergenic
1088971834 11:114780738-114780760 GAGGTATGATTTCAGCTGCCTGG + Intergenic
1089194328 11:116684385-116684407 TAAGTATGATGTTAGCTGCAGGG - Intergenic
1089592293 11:119550814-119550836 TAAGCATGATGTTTGCTGCAGGG - Intergenic
1089686675 11:120153818-120153840 TAAGTATAATGTCAATTGTAGGG + Intronic
1090122297 11:124043595-124043617 TAAGCATGACGTCAGCTGTGGGG + Intergenic
1090130063 11:124131926-124131948 TAAGTATGGTGTTTGCTGTAAGG + Intronic
1090143160 11:124287948-124287970 TAAGCATGATGTTAACTGTAAGG + Intergenic
1090301829 11:125648777-125648799 TAAGTATGATGTTAGCTGTGGGG + Intronic
1090580113 11:128150366-128150388 AAAGTATGAAGTCAGAAGCATGG + Intergenic
1091324388 11:134674837-134674859 TAAGTATGATGTTAGCTGTGGGG - Intergenic
1091412159 12:250172-250194 TAAGTATGATGTTAGCTGTAGGG - Intronic
1092299796 12:7236093-7236115 TGAGTATGATGTGAGCTGTGGGG - Intergenic
1092510983 12:9156428-9156450 TAATTATGATGGTAGCTGAAAGG + Intronic
1092688693 12:11082189-11082211 TAATGATGATGTCAGCTAAAAGG + Intronic
1093248928 12:16775598-16775620 TAAGTATGATGTTAGCTGTAAGG - Intergenic
1093426950 12:19038428-19038450 TAAGTTTGATGTCCTCTGCCTGG + Intergenic
1093616319 12:21229976-21229998 TAAGTATGAAGTTAGATGTAGGG + Intronic
1093720283 12:22434337-22434359 TAACTGTGATGTTATCTGCATGG - Intronic
1095901324 12:47331597-47331619 TAAGTATGATGTTAGCTGCAGGG + Intergenic
1096014969 12:48262507-48262529 TAAGTATGATGTGAACTATAGGG + Intergenic
1096128909 12:49141565-49141587 TAAGTATAGTGTTAGCTGTAGGG + Intergenic
1097693141 12:62752966-62752988 TATGTGTGATGTCAGGTGGAGGG + Intronic
1097900482 12:64868138-64868160 TAAATATGATATCATCTGCATGG - Intronic
1098486635 12:71028991-71029013 TAACTAAAATGTAAGCTGCAAGG + Intergenic
1099398609 12:82173345-82173367 TTAGTATGATGTCTGGTGGATGG - Intergenic
1099788036 12:87292528-87292550 TAAATATGATATTAGCTGTAGGG - Intergenic
1100344910 12:93719074-93719096 TAAGTATGATGTTAGCTGCAGGG + Intronic
1100683374 12:96955844-96955866 TAAGTTTAATGTTAGCTGCTGGG - Intergenic
1100884374 12:99053617-99053639 TAAAAATGATGTCAGTTGAATGG + Intronic
1101323740 12:103696713-103696735 TAGCTAAGATGTCAGCAGCAGGG - Intronic
1104995680 12:132653776-132653798 TAAGTATGAGGTCTGCTGTTAGG + Intronic
1108097270 13:46916354-46916376 TAAGTATAATGTCAGCTGTAGGG + Intergenic
1108368150 13:49738946-49738968 TAAGTGTGATGTTAGCTGTGAGG + Intronic
1108567667 13:51717050-51717072 TAAGGATGATGTTAGCTGCAGGG - Intronic
1108955023 13:56142568-56142590 TAAGGATTATGTTAGATGCAAGG - Intergenic
1110861739 13:80351577-80351599 TGGGTATGATGTCAGATGGATGG + Intergenic
1112809877 13:103205691-103205713 AAGGAATGATGTCAGCAGCATGG - Intergenic
1113705273 13:112426990-112427012 GAAGGATGATGTTAGCTGCAGGG + Intronic
1113730195 13:112636368-112636390 TCAGAATGCTTTCAGCTGCAAGG + Intergenic
1113754463 13:112801018-112801040 TAAGTATGACGTCAGCTGTAGGG - Intronic
1114701210 14:24680290-24680312 TAACTAAGATGTCAGATTCATGG + Intergenic
1114941769 14:27621966-27621988 TAAGTATAATGTTAGCTGTAAGG - Intergenic
1115317666 14:32042359-32042381 TCAATATGATGTTAGCTGTAGGG + Intergenic
1115361664 14:32509971-32509993 TCTGCATGAGGTCAGCTGCACGG - Intronic
1115456126 14:33605228-33605250 TGAGTATGATGTCAGTTATAGGG - Intronic
1116084027 14:40212259-40212281 TAAGTGTGATGTCAGTGGAAAGG + Intergenic
1118131609 14:62970890-62970912 TGAGTATGATGTTAGTTGTAGGG - Intronic
1119092118 14:71793610-71793632 TAAGTAAGATGTTAGCTGTTGGG + Intergenic
1120017224 14:79487635-79487657 TGAGGATAATGGCAGCTGCAGGG + Intronic
1120833620 14:89020802-89020824 TACGTATGATGTTAGCTGTGGGG + Intergenic
1121246881 14:92467432-92467454 TAAGTATGATGTTAGCTTTGGGG - Intronic
1121978751 14:98433143-98433165 TAACTCTAATGTCAGCTGCATGG + Intergenic
1123681289 15:22765987-22766009 TCACTATGGTGGCAGCTGCACGG - Intergenic
1123977317 15:25565660-25565682 CAAGTGGGCTGTCAGCTGCAGGG - Intergenic
1124607669 15:31183338-31183360 TAAGTATGATGTTAGCTGTAGGG - Intergenic
1124857375 15:33402868-33402890 TGACCATGGTGTCAGCTGCAGGG + Intronic
1125247340 15:37656003-37656025 TTAGTATGATGTTAGCTGTAGGG - Intergenic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1126043682 15:44618167-44618189 TAAGTATGATGTTGGCTAAAAGG + Intronic
1126200939 15:45985396-45985418 TAAGTATGATGTTATCTGTGGGG + Intergenic
1128102378 15:65013423-65013445 TAAGTATGATGTTAGTTACAGGG + Intronic
1128340414 15:66818769-66818791 CAAGAATGCTTTCAGCTGCAAGG - Intergenic
1128575285 15:68770130-68770152 TAAATATGATGGCAGCTCCAGGG - Intergenic
1129307805 15:74680528-74680550 TTAGTATAATGTTAGCTGTAGGG - Intronic
1130245460 15:82243935-82243957 TATGTGTGATGTGAGCTCCAAGG - Intronic
1130455227 15:84099421-84099443 TATGTGTGATGTGAGCTCCAAGG + Intergenic
1132411852 15:101585513-101585535 TAAGTATAATTTTAGCTGTAAGG + Intergenic
1132981363 16:2740078-2740100 TCAGTATGGGGGCAGCTGCAGGG - Intergenic
1133578678 16:7121142-7121164 TAAGTATGATATTAGCTGTGGGG - Intronic
1136714574 16:32267728-32267750 CAAGTATGATGTTAGCTGTGGGG + Intergenic
1136753314 16:32661687-32661709 CAAGTATGATGTTAGCTGTGGGG - Intergenic
1136814799 16:33208678-33208700 CAAGTATGATGTTAGCTGTGGGG + Intronic
1136821275 16:33318758-33318780 CAAGTATGATGTTAGCTGTGGGG + Intergenic
1136827838 16:33375297-33375319 CAAGTATGATGTTAGCTGTGGGG + Intergenic
1136832904 16:33474068-33474090 CAAGTATGATGTTAGCTGTGGGG + Intergenic
1137298044 16:47116113-47116135 TAAGTATGGTGTCAGCTGTAGGG + Intronic
1137520164 16:49186971-49186993 TAAGTAGGATATTAGCTGTAGGG + Intergenic
1137535310 16:49317732-49317754 TAAGTGTGATATTAGCTGTATGG + Intergenic
1137618970 16:49863750-49863772 TGAGTAGGATTTCAGCTGCATGG + Intergenic
1137764782 16:50969675-50969697 TAAGTTTAATGTCTGTTGCATGG - Intergenic
1139414051 16:66792303-66792325 TAAGTATGATGTTTGCTGTAGGG - Intronic
1139482045 16:67236100-67236122 TAACTGTGGTGTCAGCTCCATGG + Intronic
1139565810 16:67775331-67775353 TGAGTATGATGTTAGCTGTGGGG - Intronic
1140051778 16:71487921-71487943 TAAGTATGTTTGCAGCTGCAAGG - Intronic
1140159956 16:72479297-72479319 TAAGTATAATATTAGCTGTAGGG - Intergenic
1140623438 16:76763866-76763888 TAAGTATGACGTTAGCTGTAGGG - Intergenic
1140973230 16:80033850-80033872 TAAGTATGATGTTAACTGTGGGG - Intergenic
1202993375 16_KI270728v1_random:31652-31674 CAAGTATGATGTTAGCTGTGGGG + Intergenic
1203055476 16_KI270728v1_random:922041-922063 CAAGTATGATGTTAGCTGTGGGG - Intergenic
1144163824 17:12587896-12587918 TAAGTACGATGTTAGATGCTGGG - Intergenic
1144188350 17:12818357-12818379 TAAATATGATGTGAGTTGTAGGG - Intronic
1145368598 17:22287675-22287697 TCAGTATGATCTTAGCTGTAGGG + Intergenic
1147154770 17:38538611-38538633 TGAGAATGCTTTCAGCTGCAAGG - Intronic
1148006609 17:44436495-44436517 CAAGTATGATGTCATGGGCATGG - Exonic
1148199253 17:45738912-45738934 TAAGTATAATGTTAGCTGTAGGG + Intergenic
1148365988 17:47056343-47056365 TGAGGATGATGGCAGCTGCTAGG + Intergenic
1148585489 17:48775926-48775948 TAAGTATGATGTTAGCTGTCAGG - Intronic
1149218272 17:54384580-54384602 TTATTAGGATGTCAGCTTCAAGG + Intergenic
1150021844 17:61624104-61624126 TAGGTATGATATTAGCTGTAGGG + Intergenic
1150024408 17:61657097-61657119 TAAGTATGATGTAAACTGTGTGG + Intergenic
1150835086 17:68556752-68556774 TTAGTATGATGTCATCTGGCTGG + Intronic
1152548540 17:81016926-81016948 TAAGTGTGATGTTATCTGTAGGG - Intergenic
1152593546 17:81226145-81226167 TAAGTATGATGTCAGCTGAGGGG + Intergenic
1153542609 18:6172057-6172079 TAAATATTATTTCAACTGCAAGG - Intronic
1154134345 18:11762516-11762538 TCAGTGTGACGCCAGCTGCATGG - Intronic
1155084061 18:22439430-22439452 TAAATATGATGTAAGCTACTGGG - Intergenic
1155513635 18:26602102-26602124 TAAGTATGATGTTAGTTGTGGGG + Intronic
1155589992 18:27416464-27416486 TAAGTATGATGTTCACTGCAGGG - Intergenic
1156338797 18:36191991-36192013 TAAGTATGATGTTAGCTGTGGGG - Intronic
1156380094 18:36551027-36551049 TAAGTATGATGTTATCTGCAGGG + Intronic
1156439002 18:37165368-37165390 TAAGTATGATTTTAGCTGAAGGG + Intronic
1156926763 18:42590848-42590870 TAAGTGTGTTGTTAGCTGTAGGG + Intergenic
1157275341 18:46306626-46306648 TAAGTATGCTGTTAGGTGTAGGG + Intergenic
1157540586 18:48501765-48501787 TAAGTATAATGTAAGCTGTGGGG - Intergenic
1157637509 18:49173959-49173981 TAAGTATGATTTTAGCTGTAAGG + Intronic
1157646286 18:49276182-49276204 TAAATATGATGTGAGCTGTGGGG + Intronic
1158808979 18:61009060-61009082 TAAATAAGATGTCAGCTAAATGG + Intergenic
1160580395 18:79880986-79881008 TATGTATGTTGTTAGCTGTAGGG - Intronic
1162148775 19:8630555-8630577 TATTTATGATGTCACCTCCATGG + Intergenic
1163226780 19:15967638-15967660 TAAGTATGATGTTAGCTGTAGGG - Intergenic
1163460980 19:17437347-17437369 TGAGGAGGATGACAGCTGCAGGG + Intronic
1164264889 19:23606042-23606064 TCAGTATGATATTGGCTGCAGGG + Intronic
1164766772 19:30778338-30778360 TAGGAATGCTTTCAGCTGCAAGG + Intergenic
1165065981 19:33227936-33227958 TAAACATGATGTCAGCTGTAGGG - Intergenic
925784231 2:7413887-7413909 TAAGCATGATGTTAGTTGTAGGG + Intergenic
926485635 2:13452765-13452787 TAAGTATAATCTTAGCTGTAGGG + Intergenic
927037755 2:19198079-19198101 TAAGTATGATGTTAGCTATAGGG - Intergenic
927302442 2:21531129-21531151 TAAGTATGACGTTAGATGAAGGG + Intergenic
927409126 2:22805336-22805358 TCAGTATCATGAGAGCTGCATGG + Intergenic
927444497 2:23146390-23146412 TAAGCATGATGTTAGCTGTGGGG - Intergenic
930305681 2:49671745-49671767 TAAGCATGAAGTCAGCTAAATGG - Intergenic
930323012 2:49879171-49879193 TAAATATGACATCATCTGCATGG + Intergenic
930839548 2:55830271-55830293 TAAGAATAATGTCATCTGCAAGG - Intergenic
930949751 2:57126201-57126223 TAAATATTATGTTAGCTGCAGGG + Intergenic
931003673 2:57821665-57821687 TAATTATAATGTTAGCTGTAGGG - Intergenic
931273592 2:60724019-60724041 AAAGTATGATGTTAGTTGTAAGG - Intergenic
931446949 2:62334719-62334741 TCAGTAGAATGTAAGCTGCATGG - Intergenic
931772465 2:65509981-65510003 TAAGTATGATGCTAGCTGTAGGG + Intergenic
931939871 2:67240534-67240556 TAAGCATGTTGTAAACTGCAAGG - Intergenic
932293108 2:70600082-70600104 TAAGTATACTGTTAGCTGTAGGG + Intergenic
932964151 2:76451006-76451028 TCAGTATGATGGTAGCTGTAGGG - Intergenic
933838782 2:86268030-86268052 TAAGTCTAATGTTAGCTGTAGGG - Intronic
934616459 2:95774390-95774412 TTAGAGTGCTGTCAGCTGCAAGG - Intergenic
934644434 2:96050170-96050192 TTAGAGTGCTGTCAGCTGCAAGG + Intergenic
934837850 2:97606260-97606282 TTAGAGTGCTGTCAGCTGCAAGG + Intergenic
935037129 2:99388399-99388421 TAAGTATGATGTCAGCTGCAGGG + Intronic
935231706 2:101103732-101103754 TAAGTATGATGTTAACTGTGGGG - Intronic
935320352 2:101881637-101881659 TATGTATGACGTTAGCTGTAAGG + Intronic
935343346 2:102079145-102079167 TAAGTATAATGTTAGCTGTGGGG - Intronic
937420580 2:121751603-121751625 TAACTATGATGTTAGCTGTAGGG - Intronic
937623948 2:124023461-124023483 TAGGTATGATGGCAGATGAATGG + Intergenic
937850621 2:126630743-126630765 TGAATATGATGTTAGCTGTAGGG - Intergenic
937959534 2:127445220-127445242 TAAGTACGATGTTAACTGTAGGG + Intronic
938181039 2:129183184-129183206 TAAGTATGATGTTAGCTAAAGGG + Intergenic
938222671 2:129584481-129584503 TAAGTATGATGTTAGCTGTGGGG - Intergenic
939138703 2:138327026-138327048 TAAGTATGATGTTAGCTGCTAGG - Intergenic
939841380 2:147192449-147192471 TGAGTATGATGTTAGCTGTAGGG - Intergenic
940313157 2:152300531-152300553 TAAGAACGATGTTAGCTGTAGGG + Intergenic
941402822 2:165052430-165052452 TAAGTATGATGGTAGCTGTAGGG - Intergenic
941539098 2:166760235-166760257 TAAGTATAATATTAGCTGTAGGG + Intergenic
943349762 2:186783674-186783696 TCAGTATGCTGTTAGCTGTAGGG - Intergenic
944162760 2:196683131-196683153 TAAGTATGATGTCAACTGTGGGG + Intronic
944621800 2:201523149-201523171 TCAGCATGATGGCAGCGGCAAGG - Intronic
946664810 2:222037435-222037457 TAAGTGTGATGGAAGCTGCTGGG - Intergenic
947075475 2:226339813-226339835 TATGTATGATGTCATCTGTAGGG - Intergenic
1169048116 20:2553208-2553230 TAAGTATGATGTTAGTTGTAGGG + Intronic
1170014075 20:11761221-11761243 TAAGTATGATATCAGTTGTGAGG + Intergenic
1170722298 20:18893696-18893718 TCAATATGATGTTAGCTGTAGGG - Intergenic
1171041980 20:21773004-21773026 TAATTATGAATTCAGCTGGATGG + Intergenic
1171338037 20:24404994-24405016 TAAGTATCATGTTAATTGCAGGG + Intergenic
1172616757 20:36293338-36293360 TAAGTGTGATGTTAGCTATAGGG + Intergenic
1175477913 20:59289928-59289950 TTTGTATCATGTCTGCTGCAAGG - Intergenic
1175588633 20:60168935-60168957 CTAGGATGATTTCAGCTGCAAGG - Intergenic
1175662639 20:60828299-60828321 CAAGTATGCTGTTAGCTGTAGGG + Intergenic
1177133784 21:17289219-17289241 TAAGTATAATATTAGCTGAAGGG - Intergenic
1179018093 21:37611855-37611877 TTAGTATGATGTTAGCTGTAAGG - Exonic
1179903980 21:44411708-44411730 TAAGTGTGATGTTAGCTGTGGGG + Intronic
1179904050 21:44412672-44412694 TGGGTATGATGTTAGCTGCAGGG + Intronic
1180003842 21:45010350-45010372 TAGGTGTGATGTCAGCTGTCGGG + Intergenic
1181900371 22:26149796-26149818 TAAGGATGATGTTAGCTGTAGGG - Intergenic
1182949507 22:34359351-34359373 TGAGTATGATGTTTGCTGCGGGG - Intergenic
1183750421 22:39716847-39716869 TAAGGAAGATGTGAGCTGCTAGG + Intergenic
1184440004 22:44505053-44505075 TAAGTATAATGTCAGTTATAGGG - Intergenic
1184641582 22:45875351-45875373 TAAGTGTGATTTTATCTGCAGGG - Intergenic
1185230927 22:49681622-49681644 GAAGTATAATGTTAGCTGAAAGG + Intergenic
949292198 3:2480147-2480169 TAAGTATGATGTTAACTGTAGGG - Intronic
950519807 3:13491315-13491337 TGAGTATAATGTCAGCTGTGGGG + Intronic
950950479 3:16993094-16993116 AAAGTATAATCTCAGCTACAGGG - Intronic
952110354 3:30116090-30116112 TAAATATGATGCTAGCTGAAGGG - Intergenic
953487233 3:43312517-43312539 TAAGTAGGATGTTATCTGTAGGG - Intronic
955101417 3:55853727-55853749 AAAGTATAATGTCGGCTGCCAGG + Intronic
955262795 3:57410901-57410923 TAAGTATGATGTTAGCTGTAGGG - Intronic
955476964 3:59347135-59347157 TAAGTATGAGGTAAGCGACAGGG + Intergenic
956104078 3:65798419-65798441 TCAGAATGATGTCTGCTCCATGG - Intronic
956498109 3:69850648-69850670 TAACTATGGTGCCAGGTGCAAGG + Intronic
959328998 3:104977908-104977930 TAAGAATGACGTCAGCAGAAAGG + Intergenic
959762595 3:109985136-109985158 AAAATATGATGTCAGTGGCATGG - Intergenic
959846782 3:111041926-111041948 TCAGTATGATGTTAGCTGTGGGG - Intergenic
960489112 3:118290217-118290239 CAAGTATGATGCTAGCTGCAAGG + Intergenic
961130788 3:124465601-124465623 TAAGTATTAGGACAACTGCATGG - Intronic
961946460 3:130694893-130694915 TAAGTACAATGTTAGCTGTAGGG + Intronic
961975619 3:131022168-131022190 TAAGTAGGATGTCCCTTGCAGGG + Intronic
962299595 3:134226837-134226859 TGAGTATGATATTAGCTGTAGGG - Intronic
962441357 3:135420249-135420271 TAAATATGATGTTAGCTGTGGGG + Intergenic
962939669 3:140114370-140114392 TAAGGGTGATGCCAGATGCAGGG - Intronic
963012435 3:140784835-140784857 TAAGTATAATGTTAACTGTAAGG - Intergenic
963725743 3:148919294-148919316 TAAGTATAATGTTAGCTGTAAGG - Intergenic
965415938 3:168392192-168392214 TAATTATGATATCAGCTATAAGG - Intergenic
966965578 3:184989221-184989243 TAAGTATGATGTTAGCTGCAAGG + Intronic
968242899 3:197107929-197107951 TTAGTATGATGTCAGCTATAGGG + Intronic
968488905 4:879531-879553 AAAGAAAGATGTCAGCCGCAAGG - Intronic
968952337 4:3701595-3701617 TAAGGAGGATGTGAGCTGGATGG - Intergenic
972121310 4:35707720-35707742 TCAGTATGATGTTGGCTGTAGGG + Intergenic
973235929 4:47904462-47904484 TTACTCTGATTTCAGCTGCAGGG - Intronic
973286094 4:48418273-48418295 TAAGTATAATGTTAACTGTAGGG + Intronic
974480851 4:62441191-62441213 TAAGTGTGATGTTAGTTGTAGGG + Intergenic
975070308 4:70128267-70128289 TATGGATGGTGCCAGCTGCAGGG - Intergenic
975567089 4:75768742-75768764 TAAGTATGATGTTAGCTGTAAGG + Intronic
976126811 4:81841924-81841946 TAAGTATGATGTGAGGTGGGAGG - Intronic
976357816 4:84140228-84140250 TGAGTATGATGTTAGCTGTAGGG - Intergenic
976369432 4:84269924-84269946 TGAGAATGTTGTCAGTTGCAGGG + Intergenic
978074113 4:104507688-104507710 TAAGTCTTATGTTAGCTTCATGG + Intergenic
980311733 4:131140006-131140028 TAAGTATAATGTCAGCTATGGGG - Intergenic
981446793 4:144849369-144849391 TAGGTGTGGTGTCAGCAGCAGGG + Intergenic
981598676 4:146458342-146458364 TAGGTATGATGTCAGCTGTTTGG - Intronic
982119045 4:152122295-152122317 TAAATATGATGTTAGATGTAGGG + Intergenic
982510246 4:156273687-156273709 TTAGTATGATGCTGGCTGCAGGG + Intergenic
984053216 4:174893083-174893105 TAGCTATGATGTCAGCTGTAGGG - Intronic
984056583 4:174937968-174937990 AAAGTGTGTTGGCAGCTGCATGG + Intronic
984636653 4:182118396-182118418 GAAGTATAATGTTAGCTGTAGGG + Intergenic
1202760916 4_GL000008v2_random:109714-109736 TGAGTATGATGTTAGCTGTGAGG + Intergenic
985990441 5:3554876-3554898 TAAGTATGATATTAGCTGTAGGG - Intergenic
986991674 5:13560807-13560829 TAAGTACAATGTTAGCTGTAGGG - Intergenic
987579374 5:19769703-19769725 TAACTATGATGTCAAAAGCATGG + Intronic
988611467 5:32730354-32730376 TAATTGTGATATCAGCTGCGAGG - Intronic
988819792 5:34870984-34871006 TAAGCATGAAATCAGCTGCAGGG - Intronic
989139260 5:38186888-38186910 TGAGTATGATGTTAGCTGTGGGG - Intergenic
989461897 5:41709210-41709232 TAAGTATGATGTTAGCTGTAGGG + Intergenic
989490334 5:42044829-42044851 TAAATATGATGTTAGCTGTGGGG - Intergenic
990858156 5:60295454-60295476 TAATTATGATGTGAGCTGTTGGG + Intronic
990930432 5:61084079-61084101 TAGGTATGATATTAGCTGTAAGG + Intronic
991007995 5:61850256-61850278 TAAATATGATGTTAGCTGTGGGG - Intergenic
991140641 5:63237582-63237604 TAAGTATGATGTTTGCTGTGGGG - Intergenic
991629480 5:68641368-68641390 GAAGTATGATGTTAGCTGTAGGG + Intergenic
992861009 5:80909740-80909762 TAAGAATGATGTTAGCGGCTAGG - Intergenic
993681063 5:90878777-90878799 GAGGTATGAAGTCAGCTACATGG + Intronic
995064800 5:107848174-107848196 TAAGTATGATCGTAGCTGTAGGG - Intergenic
995382302 5:111548664-111548686 TAATTATCATGTAATCTGCAAGG - Intergenic
997166836 5:131669784-131669806 TAAGTATGTTGTTAGTTGTAAGG - Intronic
997406393 5:133651345-133651367 TAAGTATGATGTTAGCTATAGGG + Intergenic
998673659 5:144382473-144382495 TAAGTATGGTGTCAGAGGCGAGG - Intronic
998899364 5:146836169-146836191 TAAATTTGTTGGCAGCTGCATGG - Intronic
999549230 5:152666539-152666561 TAAGGATGATGTCAGCTGTGGGG - Intergenic
1001842492 5:174890831-174890853 TAAATATGATGTTAGTTGTAGGG + Intergenic
1003027831 6:2572812-2572834 TAAGTATATTGTTAGCTGTAGGG + Intergenic
1003198392 6:3935458-3935480 TTAGTATGAGGTTAGCTGTAGGG + Intergenic
1003313522 6:4990046-4990068 TAAGTGTGATGTTAGCTGTAGGG + Intergenic
1003870021 6:10394627-10394649 TAAATATTATTTCAGCTGCGGGG + Intronic
1003907292 6:10713734-10713756 TAAGTATAATGCCAGCTGTAGGG + Intergenic
1005228226 6:23668163-23668185 TAAGTATAATGTTGGCTGCAGGG + Intergenic
1005659256 6:27977825-27977847 TAAGCATCAAGTCAGCTGCCAGG + Intergenic
1006487443 6:34355139-34355161 TAAGTATGATATTAGCTGTTTGG + Intronic
1006499851 6:34451156-34451178 TAGGGATGGTGTCAGCAGCATGG + Intergenic
1007456384 6:41980907-41980929 TGAGTATGATGTTAGTTGTAGGG - Intronic
1008073861 6:47125682-47125704 TGAATATGATGTTAGCTGTAGGG + Intergenic
1009361680 6:62822356-62822378 GAAGTTGGGTGTCAGCTGCAAGG + Intergenic
1009899517 6:69794956-69794978 GAAGATTCATGTCAGCTGCAAGG - Intronic
1011924912 6:92630270-92630292 TAAGCATGATGTTAGCTGTTAGG + Intergenic
1012415370 6:99007071-99007093 TCAGTATGATGTTGGCTGTAGGG - Intergenic
1012716796 6:102684414-102684436 TAAGTTTGATGTCACCTTTAGGG - Intergenic
1012759730 6:103283378-103283400 TAAGTATGATGTTAGCTGTTGGG + Intergenic
1012782019 6:103572574-103572596 TAAGTATGGTGTTAGCTGTATGG + Intergenic
1012909495 6:105103047-105103069 TGTGTTTGATGTCACCTGCATGG - Intronic
1013971304 6:116022687-116022709 TGAGTATGATGTTAGGTGAAGGG - Intronic
1014488367 6:122029927-122029949 TGAGTATGAAGTGACCTGCAAGG - Intergenic
1014958044 6:127646271-127646293 TCAGTATGATGTTAGCTGTGGGG - Intergenic
1014961008 6:127684763-127684785 TAAGTATAATGTTAACTGTAGGG + Intergenic
1015038245 6:128684097-128684119 CAAGAATGCTTTCAGCTGCAAGG - Intergenic
1015096690 6:129423213-129423235 TAAGTATGATTTTAGCTGTTAGG - Intronic
1015234525 6:130955359-130955381 TTAGTATGTTGTCATCTGCAAGG - Intronic
1015324911 6:131913954-131913976 GAAGAATGATGTTAGCTGTAGGG + Intergenic
1015500202 6:133923902-133923924 TAAGTTTTAAGGCAGCTGCATGG + Intergenic
1015768212 6:136741522-136741544 TAAGTATGATGTTAGCTATAGGG - Intronic
1015829138 6:137348741-137348763 AAAATAAGATGACAGCTGCATGG - Intergenic
1016601827 6:145870763-145870785 TAAATATGATGTTAGCTGTAGGG + Intronic
1018863246 6:167727574-167727596 TAAGTGTGATGTTAGCTGTAGGG - Intergenic
1020547021 7:9545025-9545047 TCAGTATGATGTTAGCTGTGGGG - Intergenic
1020806474 7:12795862-12795884 TATCTCTGATGTCACCTGCAAGG - Intergenic
1023979345 7:45058300-45058322 TAAGTATGATGTTCGCTTTAGGG + Intronic
1024122185 7:46255354-46255376 TAAGTATGATGTTAACTGTAGGG - Intergenic
1024185425 7:46943898-46943920 TAAGTATCAAGTCAGCTACAAGG - Intergenic
1024489301 7:49959127-49959149 TAAGTATGGTATTAGCTGTAGGG - Intronic
1025712001 7:63920459-63920481 TCAGTATGAGGTTAGATGCAGGG - Intergenic
1027551565 7:79603717-79603739 CAAGTATAATGTTAGCTGTATGG + Intergenic
1027590626 7:80114348-80114370 GAACTATTATGTCAGCTGAATGG - Intergenic
1028926655 7:96364616-96364638 TAAGTATAATGTTAGCTGTAGGG + Intergenic
1029293508 7:99520306-99520328 TAAGGATTATTTCATCTGCATGG + Intronic
1029854561 7:103502177-103502199 TCAGGATGCTTTCAGCTGCAAGG - Intronic
1030402442 7:109069103-109069125 TATGTATATTGTTAGCTGCATGG + Intergenic
1030798353 7:113817647-113817669 TAAGTATGAAGCTAGCTACACGG + Intergenic
1031112973 7:117633609-117633631 TAAGTATGATTTTAGCTGGAGGG + Intronic
1031444263 7:121831497-121831519 TAAGCCTGATGCCAGCTGTAAGG + Intergenic
1031590175 7:123581194-123581216 TAAGTATCATGTCCTCTGAACGG - Intronic
1032935479 7:136725902-136725924 TAAGTATGATGTTGGCTGTGGGG - Intergenic
1033268344 7:139907148-139907170 TAAGTATGACATTAGCTGTAAGG + Intronic
1034292929 7:149946774-149946796 TTATTATGATGTCACCTTCACGG - Intergenic
1034453408 7:151149998-151150020 TAAGCTTGATGTCAGCTGGGAGG + Intronic
1034986900 7:155521911-155521933 ATAGGATGATGTCAGCCGCAGGG - Intronic
1035149641 7:156858932-156858954 TAAGTATGATGTTAGCTGTGGGG - Intronic
1035474218 7:159130403-159130425 TAATAGTGATGTCATCTGCAGGG - Intronic
1035835462 8:2746676-2746698 TCAGTATGATGTTAGCTGTGGGG - Intergenic
1035992961 8:4512319-4512341 TAAGTAAAATGTTAGCTGCAGGG - Intronic
1037296541 8:17407857-17407879 TCAGTATACTGTCAGCTCCAAGG - Intronic
1037358159 8:18044923-18044945 TAAGTATGATATTAGCTGTATGG + Intergenic
1037508738 8:19560110-19560132 TAAGTAGAATGTAACCTGCACGG + Intronic
1037956191 8:23061647-23061669 TGAGTATGATGTTAGCTGTGGGG + Intronic
1039340358 8:36642249-36642271 TAAGCATAATGTTAGCTGTAAGG - Intergenic
1039660606 8:39459516-39459538 TAAGTATGATGGTAGCTGTAGGG - Intergenic
1040420305 8:47233438-47233460 TAAGTATAATGTTAGCTGTAGGG - Intergenic
1040446182 8:47496309-47496331 TAAGTCTGATGTTAGTTGTAGGG + Intronic
1040534222 8:48293029-48293051 TAAGTATAATGTTAGCCTCAGGG + Intergenic
1040652951 8:49470035-49470057 TAAGTATGAGGTCAGCTGCAGGG - Intergenic
1041474850 8:58252847-58252869 TAAGAATGATGTTAGTTGTAGGG - Intergenic
1041872392 8:62649602-62649624 TAAGGATGGTGTCAGCTGAGCGG + Intronic
1042211438 8:66385021-66385043 TAAGTATGATTCCATCTGCATGG - Intergenic
1042366627 8:67944387-67944409 TAAGTATGATGTTAGCTGTAGGG - Intergenic
1042394429 8:68276165-68276187 TAAGTCTGATGCTAGCTGTAGGG + Intergenic
1043066754 8:75581695-75581717 TAAATATGAGGTTAGTTGCAAGG - Intergenic
1044435241 8:92154309-92154331 TCAGTATGATGTTTGTTGCATGG + Intergenic
1045080594 8:98621511-98621533 TAATTATGATGTTAGCTGAAAGG + Intronic
1045118518 8:99010929-99010951 TAAGTATGTTGTTAGCTGTAGGG - Intergenic
1046557936 8:115799230-115799252 TAAGTATGATTTTAGATGCAGGG - Intronic
1046682790 8:117190706-117190728 TAACTATGATGTTAGCTGTGGGG - Intergenic
1048132347 8:131711665-131711687 TGAGTGTGCTGTCAGCTGCTGGG + Intergenic
1048598365 8:135891060-135891082 TCAGTATGATGTTAGCTGTGGGG - Intergenic
1049866231 8:144938845-144938867 TGTGTATGATGTCAGCTTGAGGG + Intronic
1050394661 9:5182808-5182830 GAAATATGATGTCAACTTCATGG + Intronic
1050724674 9:8634935-8634957 TAAGTATGGTGTCTGGTCCATGG - Intronic
1050890341 9:10817493-10817515 TAAGTATAATATTAGCTGTAGGG + Intergenic
1051515986 9:17930890-17930912 TTAGTATCTTGTCAGCTGAATGG + Intergenic
1053545266 9:39017126-39017148 TAATTATGATATCAGTTGTAGGG + Intergenic
1054703776 9:68441628-68441650 TAAATATGATTTTAGCTGTAGGG - Intronic
1055536783 9:77255105-77255127 TGAGTATGATGTCAGCTGTGGGG + Intronic
1055562926 9:77539122-77539144 TCAGTATGATGTCAGCTGTGAGG + Intronic
1056375455 9:86005367-86005389 TAAGTATGATGTTAGCTGTAAGG - Intronic
1057087150 9:92221829-92221851 GAGGTATAATGTCAGCTGTAAGG + Intronic
1057288457 9:93780919-93780941 TAAGGATGATGTTAGCTGTAGGG + Intergenic
1059024449 9:110610512-110610534 TAAGTATGTTGAAAACTGCAAGG - Intergenic
1059494187 9:114696102-114696124 TAAATATGGTATCATCTGCACGG - Intergenic
1059593244 9:115687665-115687687 TCATTAAGAAGTCAGCTGCAAGG + Intergenic
1060451864 9:123750297-123750319 TAAGTATGAAGGCATCTGTATGG + Intronic
1060590801 9:124815485-124815507 TAAGTACGCTGTTAGCTGAATGG + Intergenic
1062704359 9:137927726-137927748 TAAGTATAATGTTAGCTGTACGG + Intronic
1062719538 9:138030174-138030196 TTAGTATGATATTAGCTGTAAGG + Intronic
1188870980 X:35371465-35371487 TAAGTATTATGTTAGTTGTATGG + Intergenic
1189527554 X:41840691-41840713 TAAGTAAGATGTTAGCTGTAGGG + Intronic
1189566981 X:42252569-42252591 TAAGTATGATGTTAGCTGTAGGG - Intergenic
1189575300 X:42345058-42345080 TAAGTATGATGTCAGCTGTAAGG + Intergenic
1189654571 X:43229686-43229708 TAAGTATAATGTTAGGTGTAGGG - Intergenic
1189670017 X:43398477-43398499 TAAGTATGATGTTAGCTGTGGGG - Intergenic
1189741996 X:44128427-44128449 TAAGTGTGATGTTAGCTGTAGGG + Intergenic
1189770407 X:44419822-44419844 TGTGTATGATGTCAGCTACAGGG - Intergenic
1190011208 X:46786560-46786582 TAAGTATGATGTTATCTATAGGG + Intergenic
1190140434 X:47838417-47838439 TAAGTATGATTTTAGCTGTAGGG + Intronic
1190469075 X:50758326-50758348 TAAGTATGATGCTACCTGTAAGG + Intronic
1190625490 X:52334226-52334248 TAAGAATAATGTAAGCTGTAGGG + Intergenic
1191042399 X:56097830-56097852 TATGTATGATGTTAACTGTAGGG - Intergenic
1191703035 X:64063757-64063779 TAAGTATGATATTAGTTGTAGGG + Intergenic
1191707402 X:64108535-64108557 TAAATATGATGTCAACTATAGGG + Intergenic
1191749835 X:64529971-64529993 TAAGTATGATGTTAGCTGTCAGG - Intergenic
1192187904 X:68966012-68966034 TAATTATGATGTTAGCTATAGGG + Intergenic
1192548535 X:72033998-72034020 TAAGTTTAATGTTAGCTGTAGGG + Intergenic
1193097658 X:77569158-77569180 TAACTATGATGTTAGCTGTAAGG - Intronic
1193293988 X:79811906-79811928 TAAGTATAATGTTAGATGTAGGG + Intergenic
1194391514 X:93322994-93323016 TAAGTATGATATTAGCTGTGGGG - Intergenic
1195059646 X:101181895-101181917 TAAGTATGATATCAGCTGTTAGG + Intergenic
1195589254 X:106604830-106604852 TAAGCATGATGTTAACTGTACGG - Intergenic
1195633204 X:107082125-107082147 TAAGTATAATGTTAGCTGTAGGG + Intronic
1195840677 X:109172678-109172700 TAAGTCTCATGCCTGCTGCATGG - Intergenic
1195957692 X:110350327-110350349 TAAGTATGATGTTATCTGTTGGG - Intronic
1197450662 X:126611592-126611614 TAAGTGTGCTGTTAGCTGTAGGG - Intergenic
1197539414 X:127738054-127738076 TAAGTATGATGCTAGCTATAGGG - Intergenic
1197568942 X:128125298-128125320 TGAGTATGATGTTAGCTGTTAGG - Intergenic
1198446369 X:136720539-136720561 TAAGTATGATGTTAGATGTCGGG - Intronic
1198699083 X:139377245-139377267 AAAATATGATGTTAGCTACAAGG + Intergenic
1198930420 X:141852545-141852567 TGAGTATCATGTTAGCTGCAGGG + Intronic
1199311266 X:146322947-146322969 TAAGTATGATATGAGCTTTAGGG - Intergenic
1200169489 X:154062021-154062043 GAACTAAGATATCAGCTGCAAGG + Intronic
1202386468 Y:24331320-24331342 GAAGGATGATGTGAGCAGCAAGG - Intergenic
1202484318 Y:25338808-25338830 GAAGGATGATGTGAGCAGCAAGG + Intergenic