ID: 935039025

View in Genome Browser
Species Human (GRCh38)
Location 2:99407645-99407667
Sequence TGCTGTATGATGACCTAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935039025_935039028 16 Left 935039025 2:99407645-99407667 CCCTTCTAGGTCATCATACAGCA 0: 1
1: 1
2: 0
3: 5
4: 102
Right 935039028 2:99407684-99407706 CTGATTAAAAAGGAACTTAAAGG 0: 1
1: 0
2: 2
3: 28
4: 325
935039025_935039027 6 Left 935039025 2:99407645-99407667 CCCTTCTAGGTCATCATACAGCA 0: 1
1: 1
2: 0
3: 5
4: 102
Right 935039027 2:99407674-99407696 GAGTATGTTTCTGATTAAAAAGG 0: 1
1: 0
2: 1
3: 23
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935039025 Original CRISPR TGCTGTATGATGACCTAGAA GGG (reversed) Intronic
903916184 1:26766123-26766145 TGCTGTGTGATCATCTAGTAAGG - Intronic
903936548 1:26899143-26899165 TGCTGTGAGATGACAGAGAAGGG - Intronic
905508004 1:38495395-38495417 TGATCTAGGATGATCTAGAATGG - Intergenic
909468355 1:75999921-75999943 TGCTGTGGGATGACATAGGAAGG - Intergenic
909786107 1:79616182-79616204 TTCTTTAAGATGTCCTAGAATGG + Intergenic
910592028 1:88936138-88936160 TTCTGTTAGATGACCTAGTATGG - Exonic
913336625 1:117715100-117715122 TGCATTATGAAGACATAGAATGG + Intergenic
914974685 1:152350639-152350661 TGCTGTCTGTTGACCATGAAAGG + Exonic
918309725 1:183276954-183276976 TGCTGTAGGATAACCAAGATGGG - Intronic
918337085 1:183527267-183527289 TCCTTTAAGGTGACCTAGAAAGG + Intronic
918929101 1:190830583-190830605 TGCTCTAGGATGACCTAGCTGGG + Intergenic
920291160 1:204924006-204924028 TGCTGTCTTATGCCCTAGAAGGG - Intronic
921127751 1:212192856-212192878 TGCTGTATGCTGCCCAAGAGAGG + Intergenic
921245453 1:213234564-213234586 GGATGTTTGATGACCAAGAAAGG + Intronic
921657315 1:217755965-217755987 TGCTTTATTAAGACATAGAAGGG - Intronic
1070783341 10:79149809-79149831 TGCTGTCTGCTGACTTGGAAAGG + Intronic
1073891403 10:108106576-108106598 TGCTTTATGATTATGTAGAATGG - Intergenic
1074911302 10:117911783-117911805 TGCTGTGAGAGGACCTATAAAGG - Intergenic
1075787907 10:125062337-125062359 TACTGTATAATGGCCTAGTAGGG + Intronic
1077727316 11:4687782-4687804 TGCTGTAGGAGCACCTGGAAAGG + Intronic
1079233321 11:18668758-18668780 TTCTGCATGAGGACCTAGAGCGG - Intergenic
1080014509 11:27490498-27490520 TGATGTTAGATGTCCTAGAAAGG - Intergenic
1081748074 11:45487045-45487067 TGCTGCCTGATGGCCTTGAATGG - Intergenic
1085189329 11:74604694-74604716 TGCTGTATGATTATGTTGAAAGG + Exonic
1089146939 11:116336078-116336100 TGCTGTCTGAAGAACTAGAGGGG - Intergenic
1091788012 12:3254662-3254684 TGCTTTCTGGTGACCTTGAAGGG + Intronic
1091961046 12:4694642-4694664 TGCTGTATGCTGACCTGAAGTGG + Intronic
1096364773 12:51019587-51019609 TGCTTCTTCATGACCTAGAATGG - Intronic
1096932414 12:55226987-55227009 AGCTGTAAGCTGATCTAGAATGG - Intergenic
1102107667 12:110339272-110339294 AGCTGTTTAATGACCTACAAAGG - Exonic
1110861997 13:80354829-80354851 TGATTTATGTTGATCTAGAAGGG + Intergenic
1116751869 14:48896650-48896672 TGCTATAGAAGGACCTAGAACGG + Intergenic
1116809168 14:49523104-49523126 TCCTTGATGCTGACCTAGAATGG + Intergenic
1119394623 14:74317163-74317185 TGCTGTATGGAGAGCTAGAATGG + Intronic
1122759855 14:104015330-104015352 TGCTGTAGGGTTTCCTAGAAGGG + Intronic
1122809743 14:104282020-104282042 TGCTGTCTGCTGACCTACACTGG + Intergenic
1125050543 15:35293664-35293686 TACTGAATGATGATCTAGCAAGG + Intronic
1129004649 15:72362288-72362310 TGCTGCATGATCACATAGGAGGG - Intronic
1129622226 15:77158509-77158531 TGCTGTATGTTGCACTACAAGGG + Exonic
1135971538 16:27075420-27075442 TGGTTTATGATGACCTTGACAGG - Intergenic
1143162697 17:4881717-4881739 TTTTGAATGATGACCCAGAAGGG - Intronic
1147462191 17:40580388-40580410 TGCTGTAGGAGCACATAGAAGGG + Intergenic
1149612000 17:57964571-57964593 TGATGTATGAAACCCTAGAATGG + Intergenic
1156319612 18:36006723-36006745 TGCTGGATGATTAGCCAGAAAGG + Intronic
1158654336 18:59315578-59315600 TTCTGTATCATGACCCAGATTGG - Intronic
926573938 2:14559703-14559725 TGCTGTATAATGACCCAGTCAGG + Intergenic
935039025 2:99407645-99407667 TGCTGTATGATGACCTAGAAGGG - Intronic
935956980 2:108386963-108386985 TGCTGTAAACTGACCAAGAAGGG - Intronic
937666900 2:124498313-124498335 AGCTGTATGAGGAACTACAATGG - Intronic
939235748 2:139490079-139490101 TTATGAATTATGACCTAGAAGGG + Intergenic
939896549 2:147798699-147798721 TGCTGTATTATGGCTTAGAGTGG + Intergenic
943096724 2:183438018-183438040 TGCTTTCTGATAACTTAGAAAGG - Intergenic
943991719 2:194702827-194702849 TACTGTATGATTACCTACATTGG - Intergenic
1177262129 21:18743720-18743742 TGCTGGATGATGAAATAGCAGGG + Intergenic
1182832103 22:33312792-33312814 TGCTGAATGATGGTCTAGATTGG - Intronic
1184300573 22:43556334-43556356 TGGAGTATGCTGACCTGGAAGGG + Intronic
1184392578 22:44212947-44212969 TGGTTTATTATTACCTAGAAAGG + Intronic
951559852 3:23954912-23954934 TGATGTATGATTACCCAGCAAGG - Intronic
952021928 3:29033244-29033266 TGCTGTTTATTGACCAAGAAAGG + Intergenic
952445649 3:33378319-33378341 TTCTGTCTGATGACTGAGAATGG - Intronic
954123687 3:48516373-48516395 TGTTGTACCATAACCTAGAAAGG - Intergenic
956218530 3:66876954-66876976 TGCTCTATCTTGACCTAGCAGGG + Intergenic
957758114 3:84518031-84518053 TGCTGTATGATAATTTAGAAGGG + Intergenic
960183635 3:114612224-114612246 TGCATTATGGTGGCCTAGAAAGG - Intronic
960601235 3:119460585-119460607 TGCTGTAGGAGGGCTTAGAAGGG - Intronic
963723127 3:148886928-148886950 ATCTGTATGGTGAACTAGAAGGG + Intronic
964616078 3:158667018-158667040 TGCTATATTATGAAGTAGAATGG + Exonic
972302465 4:37797785-37797807 TCCTGTATGATGACATAACAAGG + Intergenic
974191721 4:58513036-58513058 CCCTGTATGATGACCTGAAATGG - Intergenic
975142446 4:70932354-70932376 TGCTGTTGGATCACCTAGACTGG - Intronic
981793483 4:148567750-148567772 TGTTGTAAGATGACTTAGAGAGG + Intergenic
982763210 4:159313848-159313870 GGCTACATGGTGACCTAGAAAGG + Intronic
992551275 5:77862489-77862511 TGCTGTAGAATGAGGTAGAAGGG - Intronic
994067929 5:95564298-95564320 TCCTCAATGATGAGCTAGAAAGG - Intronic
995072278 5:107938175-107938197 TGCTTTATGGTGACCTGAAATGG + Intronic
995441860 5:112201166-112201188 TGCTGCATGTTGACATAAAAAGG - Intronic
1001996086 5:176159915-176159937 TGCTGTAAGATGAGCAAGAAAGG + Intergenic
1006519009 6:34560875-34560897 TGCTCTCTGATGAGCTAGACTGG + Intergenic
1007879893 6:45153110-45153132 TTCAATATGATGACCAAGAAAGG - Intronic
1008150169 6:47940541-47940563 TGCAGTACAATGACCTAGAAAGG - Intronic
1009961847 6:70532497-70532519 TGCTGTATGATTACCTAGAATGG + Intronic
1010807755 6:80258991-80259013 TGCTGTAAGATGTCCTGGCATGG + Intronic
1014351029 6:120345645-120345667 TGGTGAATGATGAGCTGGAAGGG - Intergenic
1015014672 6:128397618-128397640 ATCTGTATGATGACTTTGAATGG - Exonic
1015344087 6:132135194-132135216 TGCTGTTTGTTTACCTATAAGGG + Intergenic
1019890059 7:3939283-3939305 TTCTGGATGATGAACTATAAAGG + Intronic
1020489709 7:8765907-8765929 TGATGTATGTTAATCTAGAAAGG + Intergenic
1022737429 7:33089274-33089296 AGATGTATGATGCCCTTGAAAGG + Intergenic
1025761182 7:64395139-64395161 TGCTGTATTATGTCACAGAATGG - Intergenic
1026234241 7:68512112-68512134 TGATGTGTGATGAGCTAAAATGG + Intergenic
1039372795 8:37003576-37003598 TGTCAGATGATGACCTAGAAGGG - Intergenic
1040057613 8:43073955-43073977 TACTCTTTGATGACCTAAAATGG + Intronic
1042061081 8:64818608-64818630 TGCTGAATGATGAAACAGAATGG - Intergenic
1042148344 8:65755752-65755774 TTCTTTATGATGACATAAAAGGG - Intronic
1047765744 8:127988466-127988488 TGCTTTAGGATAGCCTAGAAGGG + Intergenic
1048189519 8:132275412-132275434 AGCTGTAAAATGACATAGAAAGG + Intronic
1053612728 9:39731751-39731773 TCCTCTATGATGACCCAGATGGG - Intergenic
1053870770 9:42489713-42489735 TCCTCTATGATGACCCAGATGGG - Intergenic
1054085525 9:60739404-60739426 TCCTCTATGATGACCCAGATGGG + Intergenic
1054240788 9:62610639-62610661 TCCTCTATGATGACCCAGATGGG + Intergenic
1054554922 9:66645163-66645185 TCCTCTATGATGACCCAGATGGG + Intergenic
1060704870 9:125789503-125789525 TGCTGTAAGCTGCCCTAAAATGG - Intronic
1190065580 X:47239598-47239620 ACCTGTATGATGAGCTAGGAGGG - Intronic
1190097328 X:47492110-47492132 TACTGTATGATGACATACCAGGG + Intergenic
1190822382 X:53985771-53985793 TGCTGTCTGATAGCCTGGAAAGG + Intronic
1191833739 X:65442465-65442487 TGCAGGATGATGCCATAGAACGG - Intronic
1192305955 X:69959774-69959796 TGCTGTAAGATGATCAAGGAAGG + Intronic
1196519986 X:116661613-116661635 TGCTGGCTGAGGCCCTAGAAAGG + Intergenic
1202099622 Y:21293563-21293585 TGCAGAAGGATGACCCAGAAAGG + Intergenic