ID: 935039150

View in Genome Browser
Species Human (GRCh38)
Location 2:99409479-99409501
Sequence GTGACCAATATGAAGATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935039150_935039151 11 Left 935039150 2:99409479-99409501 CCACACATCTTCATATTGGTCAC 0: 1
1: 0
2: 0
3: 9
4: 122
Right 935039151 2:99409513-99409535 GAAGTTTAATATTAAGTAGTTGG 0: 1
1: 0
2: 1
3: 30
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935039150 Original CRISPR GTGACCAATATGAAGATGTG TGG (reversed) Intronic
904499523 1:30906240-30906262 TTGACCCATGGGAAGATGTGAGG + Intronic
907883259 1:58570905-58570927 GTGGCCAATGTCAAGCTGTGGGG + Intergenic
910603959 1:89062968-89062990 GCCTCCATTATGAAGATGTGAGG - Intronic
920872157 1:209803849-209803871 GTTTACAATATGAAGTTGTGGGG + Intronic
920905646 1:210164525-210164547 TTTGTCAATATGAAGATGTGTGG + Intronic
921195705 1:212755674-212755696 GTTGCCTATTTGAAGATGTGTGG + Intronic
921832074 1:219738940-219738962 GGGACCAATATTAAGATATTGGG - Intronic
923951095 1:238955122-238955144 GGGAGCAATATGTAGATGTATGG + Intergenic
1063402868 10:5764438-5764460 ATGAAGAATATGAAGATGCGTGG + Intergenic
1066412304 10:35184205-35184227 TAGACCAATATCAGGATGTGGGG + Intronic
1068407829 10:56615032-56615054 TTGGCCAATATGAAAATGAGAGG - Intergenic
1068851069 10:61741569-61741591 GTTACCAATAATAAGTTGTGAGG + Intronic
1070635236 10:78120285-78120307 GTGACCAAGATGAAGAAGATGGG + Intergenic
1073740930 10:106406092-106406114 GTGAGCGAAATGAAGATGTAGGG + Intergenic
1074227785 10:111504517-111504539 GTGACAAAATTGAAGATTTGAGG - Intergenic
1074559407 10:114521724-114521746 GTGCCCAATAAGAGGATGAGTGG - Intronic
1078154612 11:8788543-8788565 GTGAAGAGTTTGAAGATGTGGGG - Intronic
1083002797 11:59311415-59311437 TTGACAAAAATGAAGAAGTGGGG + Intergenic
1084977426 11:72809942-72809964 CTGATCAATATGAAGGTGTGAGG + Intergenic
1086180000 11:83939376-83939398 GCTAAGAATATGAAGATGTGGGG - Intronic
1088001027 11:104880577-104880599 GTGACCAATATGCATATGGAAGG + Intergenic
1096935441 12:55268838-55268860 GTCACCAATATCAAGAATTGGGG + Intergenic
1098040321 12:66347829-66347851 TTGACCAAAATGAAAATGTTTGG + Exonic
1099284195 12:80695349-80695371 ATGCACAATATGAAGATCTGGGG + Intergenic
1099919902 12:88944334-88944356 GTGAGTATTATGAAGATCTGAGG + Intergenic
1101721760 12:107356468-107356490 GTGACCACTATGGAGAGGTTGGG + Intronic
1106463341 13:29991512-29991534 GTGACCCATACGGAGATGAGTGG - Intergenic
1109560260 13:64038995-64039017 GGGACCAATATGAAATGGTGGGG + Intergenic
1110373908 13:74770254-74770276 GTGTCAAATATGAAGAACTGAGG + Intergenic
1111063871 13:83064157-83064179 GTGACCTATGTGAAAATATGGGG - Intergenic
1112452322 13:99523960-99523982 GTGAGCCATGTGAATATGTGGGG + Intronic
1112572286 13:100604229-100604251 GTAACAAAAATAAAGATGTGAGG + Exonic
1113083828 13:106546930-106546952 GTTAACAGTATTAAGATGTGGGG + Intronic
1114542864 14:23475652-23475674 GAGACCATCATGAAGTTGTGGGG + Intronic
1115388772 14:32829485-32829507 CAAACCAATATGAAAATGTGAGG - Intronic
1121158130 14:91706522-91706544 GTGACCAATATGAAGGTCACTGG + Intronic
1121552239 14:94811684-94811706 GTCACCCAAATGCAGATGTGTGG + Intergenic
1135188378 16:20334360-20334382 GTGCCCAATATACAGATCTGGGG + Intronic
1135903122 16:26484941-26484963 ATGAAAAATATGAAGATGAGTGG + Intergenic
1138822571 16:60279550-60279572 GCGTCCAACATCAAGATGTGCGG + Intergenic
1143730970 17:8882559-8882581 GTGGTGAATATGAAGATGGGTGG - Intronic
1153233879 18:2967372-2967394 GTGGCCAATATGAATCTGGGGGG + Intronic
1157238716 18:45989080-45989102 TTGAACAATATGAAGATTTAAGG - Intronic
1159198716 18:65153907-65153929 GTGATGGATATGAAGATGTATGG - Intergenic
1159852214 18:73537812-73537834 GTCAGCAATATGAACATGTATGG + Intergenic
1162844437 19:13381584-13381606 GTGAGCCATATGAATATGTCAGG + Intronic
1162849709 19:13421541-13421563 GTCACCAATGTGAAGATATTAGG + Intronic
1165480440 19:36060410-36060432 GTGACCCATAAGAAGCTGTAGGG + Intronic
1165531544 19:36406366-36406388 GTGACCAATAGGGATATTTGGGG - Intronic
1168319536 19:55500769-55500791 GTGACCACGAGGAAGACGTGGGG + Exonic
1168612101 19:57809550-57809572 GTGAATAAAATTAAGATGTGAGG + Intronic
926408885 2:12581474-12581496 GTGAGCATTTTGAGGATGTGTGG - Intergenic
926421823 2:12707477-12707499 GTTACCAAAAGGAAGATATGAGG + Intergenic
927717595 2:25362600-25362622 GTTACCAATATAACGATCTGTGG + Intergenic
927920599 2:26969662-26969684 GTGAGCAAGATGAAGAAATGAGG + Intergenic
928608203 2:32963662-32963684 TTGAAGAATATGAAGAAGTGTGG - Intronic
929481781 2:42315092-42315114 ATGGACAATATGAAGGTGTGAGG - Intronic
930664530 2:54088866-54088888 GTGACCGATAGGAATGTGTGTGG - Intronic
932449124 2:71798522-71798544 GTGGTCACTATGAAGCTGTGCGG + Intergenic
932517163 2:72363721-72363743 CTGAACAATATAAAGATGAGAGG - Intronic
932857074 2:75246074-75246096 GTGACCAGTATGCTCATGTGAGG + Intergenic
935039150 2:99409479-99409501 GTGACCAATATGAAGATGTGTGG - Intronic
939730010 2:145772267-145772289 GTGACCAATAGGTAGATGGAGGG - Intergenic
940144316 2:150529672-150529694 GTGAGGAATATTTAGATGTGTGG - Intronic
940637937 2:156320631-156320653 GTGACTAATAAGAAGGCGTGGGG + Intergenic
944167961 2:196743197-196743219 GTGACCAATACAGAGCTGTGTGG - Intronic
946185054 2:217976051-217976073 GGGACCCAGATGATGATGTGGGG - Intronic
947075327 2:226337610-226337632 GATACCAATCTGAAGCTGTGAGG - Intergenic
948592524 2:239060475-239060497 GTGGCCAATAGGCAGATGCGGGG + Intronic
1170072065 20:12380107-12380129 GTGACCAAGTATAAGATGTGTGG + Intergenic
1180147464 21:45929337-45929359 GTGACTAAAAGGCAGATGTGTGG + Intronic
1180874250 22:19167490-19167512 GTGACCAAGGTGGAGATGGGAGG - Intergenic
1180895124 22:19325703-19325725 GTGACTAATATGCACATGAGAGG + Intergenic
1182003494 22:26940155-26940177 GTGAACCATCTGAAGATCTGAGG + Intergenic
1182003699 22:26941679-26941701 GTGAACCATCTGAAGATCTGAGG - Intergenic
1182200179 22:28560606-28560628 GTGAGTCATATGAAGATCTGGGG - Intronic
1182271552 22:29157074-29157096 TTTTCCAATATGAATATGTGGGG - Intronic
1183801243 22:40166568-40166590 GTTACCAATAACAAGTTGTGAGG - Intronic
1184312770 22:43658774-43658796 CTGACAAAACTGAAGATGTGAGG + Intronic
951937469 3:28037700-28037722 GTGTCCAATATGTATATGAGTGG + Intergenic
952740625 3:36730843-36730865 GTGAGCCATATTAAGATGTGAGG + Intronic
957729721 3:84118188-84118210 GTGATCAATAAGAGGAAGTGGGG - Intergenic
959383448 3:105671479-105671501 GTGAACAATCTGAATTTGTGTGG - Intronic
961400843 3:126641356-126641378 ATGAACACTATGGAGATGTGAGG - Intronic
978387201 4:108187959-108187981 GTGAGCCATGTGAAGATCTGGGG - Intergenic
979538658 4:121854000-121854022 GTTAGCAATATGAAGATTTGGGG - Intronic
979568633 4:122187458-122187480 GTGATCTCCATGAAGATGTGGGG - Exonic
982161354 4:152573190-152573212 GGGACCAATAAGAAAATGAGAGG - Intergenic
995621723 5:114032955-114032977 GTTGCCAATATTAAGAGGTGGGG + Intergenic
997021504 5:130007903-130007925 GTGCCCCATATGAACATCTGAGG - Intronic
1002699944 5:181116401-181116423 GTAACAAACATAAAGATGTGAGG - Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007991077 6:46256516-46256538 GTGTCAAATATGAACATTTGTGG + Intronic
1008851423 6:56027088-56027110 GTGAGCAATGTGAGAATGTGAGG - Intergenic
1008967211 6:57324778-57324800 GTGACCAAAATTAACATGTGAGG - Intronic
1011131252 6:84053872-84053894 TTGAACAGTATGATGATGTGGGG + Intronic
1017346746 6:153391742-153391764 ATCACCAATATGATGATGTTAGG + Intergenic
1017483759 6:154883620-154883642 CTGACCAAGGTGTAGATGTGTGG + Intronic
1018991288 6:168676085-168676107 ATGACCGAAATGAAGAGGTGGGG - Intergenic
1019391606 7:790586-790608 GTGACCTAAATGAAGAGCTGAGG + Intergenic
1022763558 7:33383684-33383706 GTGAACAATTTGAAGATCTTTGG + Exonic
1024798768 7:53051308-53051330 TTCACCAAAATGAAGATGTCAGG + Intergenic
1026395340 7:69947196-69947218 GACACCAATATCAAGCTGTGGGG + Intronic
1026571485 7:71535091-71535113 TGGACCAATGGGAAGATGTGAGG + Intronic
1031093229 7:117387828-117387850 GTTAGCAATATGAAGGTCTGGGG - Intronic
1031357610 7:120806543-120806565 GTGACCTTTATCAAGAGGTGAGG - Exonic
1031762951 7:125737304-125737326 GTGCCTAATATGAAGAAGTGGGG - Intergenic
1037200721 8:16249523-16249545 GTGAGGAAAATGAAGATGAGTGG + Intronic
1040004466 8:42607860-42607882 GTGACAAATAGGAGGATGTGTGG + Intergenic
1043076380 8:75706617-75706639 GGGACCACTATGAAGTTTTGTGG - Intergenic
1043830308 8:84980466-84980488 GACACCAAGATGAAGATGAGAGG - Intergenic
1046054400 8:109061650-109061672 ATGACCAACTGGAAGATGTGGGG - Intergenic
1048304422 8:133273689-133273711 GAGACCCATTTGAAGATGTTAGG - Intronic
1049142329 8:140966164-140966186 GTGAACAAAAAGTAGATGTGGGG - Intronic
1050794694 9:9523804-9523826 CTGAGAAATATGAAGATTTGAGG - Intronic
1053656694 9:40223388-40223410 GTCACCAATATGAAGTTATTCGG + Exonic
1054368814 9:64369666-64369688 GTCACCAATATGAAGTTATTCGG + Exonic
1054527904 9:66152841-66152863 GTCACCAATATGAAGTTATTCGG - Exonic
1054676444 9:67859418-67859440 GTCACCAATATGAAGTTATTCGG + Exonic
1055409658 9:76015569-76015591 ATGACCAATATGAAGAGTGGTGG + Intronic
1056387015 9:86105352-86105374 GGGACCAGTTTGAAGATGTGAGG + Intergenic
1058416332 9:104792855-104792877 ATGATGAAGATGAAGATGTGAGG - Exonic
1058808263 9:108614220-108614242 TTGACCAAGATGAAGATGGCAGG + Intergenic
1060494848 9:124111163-124111185 GGGACGACTTTGAAGATGTGTGG - Intergenic
1060577248 9:124707965-124707987 CTGACCAATGCAAAGATGTGTGG - Intronic
1061598046 9:131645384-131645406 GTGGCTAATCTGAAGATGGGAGG + Intronic
1187202280 X:17146358-17146380 GTGAGCCATATGAAGATATGGGG - Intronic
1187974336 X:24690272-24690294 GTGGCCAATATGCAAATGAGAGG - Intergenic
1190188000 X:48252676-48252698 GTTAACAATATTAAGAGGTGGGG + Intronic
1193909635 X:87286685-87286707 GTCACAAATTTGAAGATGTGCGG + Intergenic
1195537578 X:106026295-106026317 GTGACAAATTTGAAGACATGGGG + Intergenic
1200146970 X:153931372-153931394 GTGACCCAGATGACGATGTCTGG - Intronic