ID: 935040009

View in Genome Browser
Species Human (GRCh38)
Location 2:99417111-99417133
Sequence AGTCACATGGTGAAGTACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1622
Summary {0: 1, 1: 2, 2: 57, 3: 385, 4: 1177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935040009 Original CRISPR AGTCACATGGTGAAGTACTG GGG (reversed) Intronic
900268712 1:1775529-1775551 GGTCACAGGGTGAAGCCCTGTGG - Intronic
900824348 1:4914064-4914086 GGTCACATTTTGAGGTACTGGGG + Intergenic
901260529 1:7867318-7867340 AGTCACATTCTGAAATACTGGGG - Intergenic
901471721 1:9461272-9461294 AGTCACATGCCGAGGTACTGGGG - Intergenic
901826657 1:11866336-11866358 AGTCACATTCTGAGATACTGAGG + Intergenic
901864179 1:12093208-12093230 AGTCACATCCTGAGGTACTGGGG + Intronic
902113628 1:14103318-14103340 AGTCGCATGTTGAGGCACTGGGG + Intergenic
902116901 1:14128668-14128690 AGTCACATTATGAGATACTGGGG + Intergenic
902272091 1:15311993-15312015 ACACACATGGTGAGGAACTGAGG - Intronic
902651182 1:17838683-17838705 AGTCACATTCTGAGGTCCTGGGG + Intergenic
902981807 1:20128778-20128800 AGTCACATTCTGAAGTATTGGGG - Intergenic
903001764 1:20271239-20271261 AGTCATATTCTGAGGTACTGAGG - Intergenic
903853039 1:26319723-26319745 GGTCACATGGGGCAGAACTGAGG + Intronic
904241830 1:29151764-29151786 AGACACATGCTGAAGTATTTAGG + Intronic
904637004 1:31889868-31889890 GGTCACATTCTGAGGTACTGGGG - Intergenic
904941793 1:34168842-34168864 GGTCACATCCTGAAGTACTAGGG + Intronic
905115525 1:35635969-35635991 AGTCACATACTAAAGTACTAGGG - Intronic
905367496 1:37461580-37461602 GGTCACATTCTGAGGTACTGGGG - Intergenic
905801481 1:40846716-40846738 AGTCACATTTTGAGGAACTGAGG + Intergenic
905979630 1:42211873-42211895 AGTTACATCCTGGAGTACTGGGG + Intronic
906364989 1:45200941-45200963 AGTCACATCATGAGGGACTGAGG - Intronic
906682272 1:47736804-47736826 AGTCACATAATGAATTAGTGGGG + Intergenic
906919855 1:50052082-50052104 AGTCACATCCTGAGATACTGGGG + Intronic
907166209 1:52413767-52413789 AGTCACATGGAGATGGACTTTGG + Intronic
907383166 1:54108335-54108357 AGTCACATTCTGGGGTACTGGGG - Intronic
907563954 1:55417227-55417249 GGTCACATTCTGAGGTACTGGGG + Intergenic
907583330 1:55591815-55591837 GGGCACATTCTGAAGTACTGGGG + Intergenic
907612200 1:55882736-55882758 GGTCACATTCTGAAGTACTGTGG - Intergenic
907617655 1:55940751-55940773 AGTCACATTTTGAGGTACTAGGG + Intergenic
907618750 1:55953570-55953592 AGGCACATGGTGCAGGTCTGAGG - Intergenic
907840942 1:58157030-58157052 AGTCACATGGTGATTTGCTTAGG + Intronic
907929568 1:58986820-58986842 AGTCACATTATCAGGTACTGGGG - Intergenic
908032484 1:60016081-60016103 AGCCATATTCTGAAGTACTGGGG + Intronic
908087966 1:60657006-60657028 AGTCACATTCTGAGGTACTAGGG + Intergenic
908168671 1:61483731-61483753 AGTCACATTCTGAGGTACTAGGG + Intergenic
908536936 1:65086988-65087010 AGTCACATTCTGCAGTACTGGGG - Intergenic
908551562 1:65213786-65213808 AGTCACAATCTGAGGTACTGGGG - Intronic
908846353 1:68328507-68328529 AGTCACATTCTGAGGTACTGGGG + Intergenic
909352084 1:74665800-74665822 AGTCACATTCTGAGGAACTGAGG + Intronic
909538395 1:76764235-76764257 GGTCACATTATGAGGTACTGGGG + Intergenic
909551921 1:76907584-76907606 ACTTGCATGGTAAAGTACTGGGG - Intronic
909893535 1:81037242-81037264 AGTAACATTCTGAAGTACTGGGG - Intergenic
910095331 1:83515189-83515211 AGTCACATTCTGAGGTACTGAGG + Intergenic
910282436 1:85516145-85516167 AGTCACATTCTGAGGTACTGGGG + Intronic
910460474 1:87443628-87443650 AGTCACATTCTGAGGCACTGGGG - Intergenic
910551553 1:88481224-88481246 AGTCACATTGTGAGGTACTGAGG - Intergenic
910554289 1:88513568-88513590 AGTCACATTCTGAGATACTGAGG + Intergenic
910988220 1:93027231-93027253 AGTCACATGCTGTCCTACTGGGG + Intergenic
911191800 1:94955850-94955872 GGCCACATGGAGAAGAACTGAGG - Intergenic
911360188 1:96866173-96866195 AGTCACATTCTGAAGTCATGTGG + Intergenic
911507909 1:98776414-98776436 AGTCACATTCTGAGGTACTGAGG + Intergenic
911537735 1:99120631-99120653 AGTCACATTTTGAGGTACCGGGG - Intergenic
911566174 1:99465610-99465632 GGTCACATTCTGAGGTACTGGGG - Intergenic
911730208 1:101284587-101284609 AGTCACATTCTGAAGTACTGGGG - Intergenic
911833885 1:102590820-102590842 AGTCACATTCTGAGGTACTGTGG + Intergenic
912139048 1:106698867-106698889 AGTCACATTTTGAGGTATTGAGG - Intergenic
912405065 1:109430806-109430828 AGTCACATTCTGAGATACTGGGG - Intergenic
912540897 1:110414556-110414578 GGTCACATTCTGAGGTACTGGGG - Intergenic
912765635 1:112407581-112407603 AGTCACATTTTGAGGTACTGGGG + Intronic
912860017 1:113205963-113205985 AGTCACATTCTGAGGTACTGGGG + Intergenic
913066195 1:115257641-115257663 AGTCACATTCTGTGGTACTGGGG + Intergenic
913160378 1:116139799-116139821 AGTCACATTCTGAGGTGCTGGGG - Intergenic
913213309 1:116599630-116599652 AGTTACATGCTGAAGTACTTAGG + Intronic
913468058 1:119163493-119163515 AGTCACATTCTGAGGTACTGGGG - Intergenic
914207655 1:145547745-145547767 AGTCACATTCTGAGGTACTGGGG - Intergenic
914317698 1:146529913-146529935 AGTCACATTCTGAGGCACTGGGG - Intergenic
914496659 1:148203447-148203469 AGTCACATTCTGAGGCACTGGGG + Intergenic
915637762 1:157198446-157198468 AGTCACATTCAGAGGTACTGGGG - Intergenic
916512274 1:165482866-165482888 AGTCACATTCCGAGGTACTGGGG - Intergenic
916590419 1:166184726-166184748 GTTCACATTCTGAAGTACTGGGG + Intergenic
916644290 1:166767210-166767232 GGTCACATTCTGAGGTACTGTGG + Intergenic
916655305 1:166870179-166870201 AGTCATATTCTGAAGTACTAGGG - Intronic
917068180 1:171120635-171120657 AGTAACATTCTGAAGTACTAGGG + Intergenic
917124266 1:171671638-171671660 GGTCACATTCTGAGGTACTGGGG + Intergenic
917488575 1:175477861-175477883 AGTCAGAAGCTGAAGGACTGCGG - Intronic
917492098 1:175506423-175506445 AGCCACATTCTCAAGTACTGGGG - Intronic
917870598 1:179238533-179238555 GGTCACATTGTGAAGTATTAGGG - Intergenic
918157384 1:181862326-181862348 AGTCACATTCTGAGGTACTGGGG - Intergenic
918625201 1:186649503-186649525 AGTCACATTCTGAAGTTCTGGGG - Intergenic
918724588 1:187903428-187903450 AGTTGCCTGGTGAAGTAGTGGGG - Intergenic
918938416 1:190955244-190955266 AGTCACATTCAGAGGTACTGGGG + Intergenic
919692639 1:200541465-200541487 GATCACATTCTGAAGTACTGGGG - Intergenic
919997023 1:202761572-202761594 AGTCACATTCTGAGGTACTGAGG - Intronic
920236633 1:204511339-204511361 ATTCCCATTCTGAAGTACTGGGG - Intergenic
920446692 1:206023409-206023431 AGTCCCCTGGGGAAGTCCTGGGG + Intronic
920740735 1:208579017-208579039 AGTCACATTCTGAGGTACTTAGG - Intergenic
920762200 1:208795495-208795517 AGTCACATCCTAAGGTACTGGGG + Intergenic
920879427 1:209866130-209866152 AGTCACATTCTGAACTACTGGGG + Intergenic
921076403 1:211703388-211703410 AGTCATATTGAGAAGTACTGAGG - Intergenic
921153222 1:212418099-212418121 GGTCACATTCTGAGGTACTGAGG - Intergenic
921388574 1:214596418-214596440 AGTCACATTCTGAAATACTGGGG - Intergenic
921733753 1:218603014-218603036 AGTCACATTCCGAAGTACTGGGG - Intergenic
921970591 1:221144270-221144292 AGTCACATTCTGAGGTACAGGGG + Intergenic
922088878 1:222376791-222376813 GGTCACATTCTGAGGTACTGAGG + Intergenic
922110802 1:222553268-222553290 GGTCACATTCTGAGGTACTGGGG + Intergenic
922141348 1:222891010-222891032 GGTCACATTCTGAGGTACTGAGG + Intronic
922435820 1:225605672-225605694 AGTCACATTCTGAGGTAATGGGG - Intronic
922438954 1:225635635-225635657 GGTCACATTGTGATATACTGAGG - Intronic
922788485 1:228295728-228295750 AGTGACATTGTGAAGTACTAGGG + Intronic
922810107 1:228410578-228410600 AGTCACATTCTGAGGTCCTGAGG - Intronic
922849440 1:228720429-228720451 AGTCACATTCTGAGGTATTGGGG - Intergenic
922883828 1:229003066-229003088 AGTCACATTCTGAGGTCCTGAGG + Intergenic
922953019 1:229575015-229575037 AGTCACATTCTGAAGTACTGGGG - Intergenic
923052475 1:230398498-230398520 GGTCACATTTTGAAGTACTAGGG + Intronic
923103401 1:230835734-230835756 AGTCACATTCTGAGATACTGGGG - Intergenic
923144234 1:231186696-231186718 AGTCACATTCTGAGGTGCTGGGG + Intronic
923215877 1:231847346-231847368 AGTCACATTCTGAAGTACCAGGG + Intronic
923401659 1:233621151-233621173 AGTCACATTTTGAAATACTGAGG - Intronic
923469896 1:234281121-234281143 AGTTACATTCTGAAGTACTGGGG - Intronic
923561324 1:235044043-235044065 ACTCACATTGTTAAGTACTGGGG - Intergenic
923655872 1:235916396-235916418 AGACACATGCTGAAGTACTTAGG + Intergenic
923768480 1:236915256-236915278 AGTCACATTCTGAGGTGCTGGGG - Intergenic
923952897 1:238980043-238980065 AGTCACATTCTGAAGTACTGGGG - Intergenic
924036844 1:239946326-239946348 GGTCACTTTCTGAAGTACTGGGG - Intergenic
924041897 1:239992113-239992135 GGTCACTTTCTGAAGTACTGGGG + Intergenic
924104884 1:240640025-240640047 GGCCACATGGGGAAGGACTGGGG + Intergenic
924246552 1:242091215-242091237 AGTTACATTCTGAGGTACTGGGG + Intronic
924326396 1:242898665-242898687 AGTCACATTCTAAAGTACTCAGG + Intergenic
924388159 1:243520110-243520132 AGTCACATTCTGAGGTACTTGGG - Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
924815660 1:247439617-247439639 GGTCACAATCTGAAGTACTGGGG + Intronic
924827797 1:247559938-247559960 AGTCACATTCTGAGGTTCTGGGG + Intronic
924928739 1:248708697-248708719 AGTCACATCTGGAGGTACTGGGG - Intergenic
1063042669 10:2359110-2359132 GGTCACATTCTGAAGTCCTGAGG - Intergenic
1063255324 10:4321092-4321114 AGTCAGATGCTGAGGTCCTGGGG + Intergenic
1063363711 10:5477210-5477232 AGTCACTTGGTGAGGGACTGGGG - Intergenic
1063524426 10:6771843-6771865 GGTCACATTATGAAGTGCTGGGG - Intergenic
1063571915 10:7223057-7223079 ACTCACATGCTGAGGTATTGGGG + Intronic
1063860653 10:10304261-10304283 AGTCACATTCTGAGGTTCTGTGG - Intergenic
1064006075 10:11700196-11700218 AGCCACATTCTGATGTACTGGGG - Intergenic
1064339700 10:14474980-14475002 AGTCACATCCTGAGGTAGTGTGG - Intergenic
1064582520 10:16808747-16808769 AGTCACATGTTGAGGTATTTGGG - Intronic
1064676675 10:17767085-17767107 GATCACATTCTGAAGTACTGGGG + Intronic
1064837099 10:19545277-19545299 AGTCACATTCTGAGGTTCTGTGG + Intronic
1065047920 10:21760627-21760649 AACCACTTGGTGTAGTACTGAGG + Intronic
1065105245 10:22377171-22377193 GTTCACATGGTGAAGAACTGAGG + Intronic
1065164518 10:22961034-22961056 GGTCACATTATGAGGTACTGGGG + Intronic
1065178237 10:23099114-23099136 AGTCACATTTTAAAGTACTGGGG + Intronic
1065228691 10:23574470-23574492 AGTCACATTCTGAGGTTCTGTGG - Intergenic
1065847294 10:29756272-29756294 ACTCACATTGTGAAATACTGTGG + Intergenic
1066057515 10:31695732-31695754 AGTCACATTCTGAGGTGCTGAGG + Intergenic
1066641602 10:37559645-37559667 AGTCACATTTTGAGGTACTGGGG + Intergenic
1067524503 10:47030005-47030027 AGTCACATTCAGAGGTACTGGGG + Intergenic
1067577673 10:47418530-47418552 AGTCACATGCTGAAGTCCCTTGG - Intergenic
1067740627 10:48893335-48893357 AATCACAGTGTGAGGTACTGAGG + Intronic
1067753079 10:48984735-48984757 AGTCACATTTGGAGGTACTGGGG + Intergenic
1067763348 10:49067433-49067455 AGTCACATTCTGAAGTACTGAGG - Intronic
1068107002 10:52630942-52630964 AGTCACATTCTGAGGTTCTGGGG + Intergenic
1068342547 10:55726525-55726547 AGTCACATTCTGAGGTACTATGG - Intergenic
1068855693 10:61795247-61795269 AGTCATATTTTGAGGTACTGGGG - Intergenic
1068896881 10:62213645-62213667 AGTTACATGTTGAAGTATTCAGG + Intronic
1069396701 10:67997601-67997623 AGTCACATTCTGAGGTACTCAGG - Intronic
1069404312 10:68082051-68082073 AGTCACATTCTGAGGTACTGGGG + Intergenic
1069569052 10:69483489-69483511 AGTCACATTTCGAGGTACTGGGG + Intronic
1070020821 10:72584139-72584161 TATCAGAAGGTGAAGTACTGTGG - Intronic
1070210872 10:74319551-74319573 AGTCACATTGTGAGATACTGGGG + Intronic
1070401746 10:76058995-76059017 AGCCCAATGGTGAAGTTCTGTGG + Intronic
1070472110 10:76791351-76791373 AGTCACTTTCTGAGGTACTGGGG - Intergenic
1070963471 10:80515499-80515521 AGTCACCTTCTGAAGTCCTGGGG + Intronic
1071143531 10:82540863-82540885 AGTCACATCCTGAGGTACTGGGG - Intronic
1071228053 10:83554540-83554562 AGTCACATTCTGAGGTACTGGGG + Intergenic
1071234135 10:83624765-83624787 AGGCACATTCTGAAGTACTGGGG - Intergenic
1071247321 10:83779069-83779091 AGTGACATGTTGGAGTACTCTGG - Intergenic
1071729193 10:88231150-88231172 AGTCACATTCTGAGGTACTGAGG - Intergenic
1071921541 10:90356238-90356260 ACTCACATTCTGAGGTACTGGGG - Intergenic
1071934037 10:90506915-90506937 ACTCACATTTTGAAGTACTGGGG - Intergenic
1072057306 10:91772729-91772751 GGTCACATTCTGAAGTACTGGGG + Intergenic
1072205939 10:93205361-93205383 GGTCACATTCTGAGGTACTGGGG + Intergenic
1072260513 10:93666019-93666041 AGTCACATTCTGAGGTACTGGGG + Intergenic
1072326918 10:94307791-94307813 AGTCACATTCTGAGGTACTGAGG + Intronic
1072363962 10:94690028-94690050 AGCCACATGGGGAAGTACCAGGG - Intronic
1072694776 10:97595061-97595083 AGCAACATGGTGACTTACTGTGG - Intronic
1073232937 10:101987755-101987777 ACCCACGTGGTGAAGAACTGAGG + Intronic
1073615621 10:104991902-104991924 AGTAACATTCTGAGGTACTGGGG + Intronic
1073651834 10:105368946-105368968 AGTCACATTGTGAGGAACTGGGG - Intergenic
1073876761 10:107932493-107932515 GGTCACATTCTGAGGTACTGGGG + Intergenic
1074033495 10:109713382-109713404 AGTCACATTCTGAGCTACTGGGG + Intergenic
1074227862 10:111505197-111505219 AGTCACATTCTGAAATACTGGGG + Intergenic
1074886155 10:117695406-117695428 AGTCACATTCTGAAGTACTGGGG - Intergenic
1075022664 10:118963135-118963157 AGTCACATTCTGAGGTACTGGGG + Intergenic
1075056603 10:119223321-119223343 AGTCACATTCTGAGGTACCGGGG + Intronic
1075599450 10:123756615-123756637 AGTCACATTCTGAGATACTGGGG - Intronic
1075737990 10:124675806-124675828 AGTCACATGGTGAGGCACCTCGG - Intronic
1076193171 10:128497362-128497384 AGTCACATTCTGAGGTACTGGGG - Intergenic
1077247195 11:1545410-1545432 GGTCACATTCTGAGGTACTGGGG - Intergenic
1078005942 11:7532315-7532337 AGTCACATTCTGAGGTACTGGGG + Intronic
1078319236 11:10318836-10318858 AGTCACATTCTGAGGTACTGAGG - Intronic
1078361370 11:10670640-10670662 AGTCACATTATTATGTACTGGGG - Intronic
1078407387 11:11082293-11082315 AGTCATATTCTGAGGTACTGGGG - Intergenic
1078428528 11:11269996-11270018 GGTCACATTCTGAGGTACTGGGG - Intergenic
1078481717 11:11682182-11682204 AGTCACTTTCTGAGGTACTGAGG - Intergenic
1078540971 11:12212699-12212721 AGTCACATACTGAGGTACTGGGG + Intronic
1078709368 11:13776067-13776089 GGTCACATTCAGAAGTACTGGGG + Intergenic
1078907973 11:15705060-15705082 AGTCACATTCTAAAGTACTGGGG - Intergenic
1078942539 11:16023985-16024007 AGTCACATTCTGAGGTACTAGGG - Intronic
1079059927 11:17239711-17239733 AGTCACTTTCTGAGGTACTGAGG - Intronic
1079271093 11:18986858-18986880 AGTCACCTGGTTAAGTATTCCGG + Intergenic
1079284089 11:19113785-19113807 AGTTACATTCTGAGGTACTGGGG - Intergenic
1079449073 11:20583721-20583743 TGTCACATTTTGAGGTACTGGGG + Intergenic
1079480956 11:20879242-20879264 TGTCACATGCTGAAGAGCTGAGG + Intronic
1079551954 11:21710770-21710792 AGTCACATTCTGAAGTACTCAGG + Intergenic
1079795738 11:24800324-24800346 TGTCACATTGTGTAGGACTGTGG + Intronic
1079881386 11:25931894-25931916 AGTCACTTTCTGAGGTACTGGGG + Intergenic
1079907760 11:26269842-26269864 GGTCACATTGAGAGGTACTGGGG - Intergenic
1080014725 11:27492267-27492289 GGTCACATTCTGAGGTACTGGGG + Intergenic
1080057385 11:27920230-27920252 AGTCACATTTTGAGGTACTAGGG - Intergenic
1080368052 11:31600208-31600230 AATCACATGGTGAAGAAAAGAGG - Intronic
1080621895 11:33993612-33993634 AGTCACATTGTTCAGTACTGGGG + Intergenic
1080765933 11:35296720-35296742 AGCAACCTGGTGAAGAACTGAGG - Intronic
1080839550 11:35971362-35971384 AGTCACCTTCTGAGGTACTGAGG - Intronic
1080847924 11:36042621-36042643 AGTCACATTCTGAAATACTGGGG - Intronic
1080872432 11:36248519-36248541 AGTCAGATTCTGAAATACTGGGG + Intergenic
1081245074 11:40755901-40755923 AGTCACATTCTGAAATACTGGGG - Intronic
1081264996 11:41009843-41009865 ATTCACATTTTGAAGTCCTGGGG - Intronic
1081331638 11:41808268-41808290 AGTCACATTCTGAAGTACTCGGG - Intergenic
1081381103 11:42416346-42416368 AGTCACATTCTGAGGTACTGGGG + Intergenic
1081903381 11:46648859-46648881 AGTCATATGGTGGGATACTGTGG + Intronic
1082201575 11:49377522-49377544 AGTCACATCCTGAATCACTGAGG + Intergenic
1082230615 11:49761397-49761419 AGTCACATTCTGAGGTACTTGGG + Intergenic
1082781040 11:57287578-57287600 AGTCACATTCTGAGGCACTGGGG - Intergenic
1082865511 11:57896638-57896660 GGTCACATTCTGAGGTACTGGGG + Intergenic
1083211619 11:61190957-61190979 AGTCACATTCTGAGGTACTGGGG + Intergenic
1083396223 11:62394443-62394465 ACTCACATGCTGAGGTACTGGGG + Intergenic
1083646714 11:64175793-64175815 AGTCACATTCTGAGCTACTGGGG - Intergenic
1083692877 11:64421475-64421497 AGCCACATGGTGAGGAAGTGAGG - Intergenic
1083699944 11:64469603-64469625 GGTCACATTCTGAGGTACTGGGG - Intergenic
1083818678 11:65153067-65153089 GTTCACATGGTGAGGAACTGAGG + Intergenic
1084026280 11:66452154-66452176 AGTCACATTCTGAGGTACTGGGG + Intronic
1084423919 11:69074038-69074060 AGTCACATTCTGAGCTACTGGGG + Intronic
1084521186 11:69664022-69664044 AGTCACATTCTGAGGCACTGGGG - Intronic
1084645548 11:70455324-70455346 AGTCACTTGGAGACGTACAGGGG + Intergenic
1084662339 11:70553433-70553455 AGTCACATTCTGAAGTACTGGGG + Intronic
1084721705 11:70910175-70910197 AGTCACATTCAGAGGTACTGAGG + Intronic
1084770921 11:71342451-71342473 AGTCACATGCTGAGGTGCTGGGG - Intergenic
1085452188 11:76641090-76641112 GGTCACATTCTGAGGTACTGAGG - Intergenic
1085792653 11:79509245-79509267 GGTCACATTCTGAAGTACTGGGG - Intergenic
1086157776 11:83686872-83686894 GGTCACATTCTGAGGTACTGGGG - Intronic
1086582034 11:88410418-88410440 AGTTACATTCTGAGGTACTGGGG + Intergenic
1086619437 11:88867576-88867598 AGTCACATTCTGAGGTACTTGGG - Intronic
1086654091 11:89328708-89328730 AGTCACATCCTGAAGCACTGAGG - Intronic
1086814290 11:91349339-91349361 AGTCACATTCTGAGGTATTGGGG - Intergenic
1087557347 11:99738151-99738173 AGTCACATTCTGAGGTACTTGGG - Intronic
1087730459 11:101772746-101772768 AGTCACATTCTGAGGTACTGGGG - Intronic
1087957588 11:104307943-104307965 AGTCACATTTTGAGGTAGTGGGG - Intergenic
1088196834 11:107283436-107283458 AGACACATGCTGAAGTATTTAGG - Intergenic
1088258367 11:107922503-107922525 GGTCACATTCTGAGGTACTGGGG - Intronic
1088432955 11:109778581-109778603 GGTCACATTCTGAGGTACTGGGG + Intergenic
1088592975 11:111419149-111419171 AGTCATATCCTGAGGTACTGGGG + Intronic
1088688239 11:112303097-112303119 TGTCACATGTTGAAGTGCAGTGG - Intergenic
1088694028 11:112350871-112350893 AGTAACATTCTGAGGTACTGGGG - Intergenic
1088755571 11:112882496-112882518 AGTCACATGCTGAGGTACTGGGG + Intergenic
1088816930 11:113427808-113427830 AGTCACATTCTGAGGTACTGGGG - Intronic
1089098185 11:115937303-115937325 AGTCACATTCTGAAGTACTGGGG - Intergenic
1089136735 11:116255215-116255237 GGTCACATTCTGAAGTACAGGGG + Intergenic
1089165866 11:116476027-116476049 GATCACATTCTGAAGTACTGGGG - Intergenic
1090363972 11:126191149-126191171 CGTCACATTCTGAGGTACTGGGG - Intergenic
1090438812 11:126709501-126709523 AGACACATTCTGAAGTATTGGGG - Intronic
1090543162 11:127731105-127731127 AGTCACATTCTGAGGTACTGTGG + Intergenic
1090698880 11:129277504-129277526 GGTGACAGGGTGAAGTAGTGGGG - Intronic
1090705321 11:129330984-129331006 AGTCACATTCTGAGATACTGGGG - Intergenic
1090721480 11:129478495-129478517 AGTCACATTCTGAGGTACTGGGG - Intergenic
1091141925 11:133242676-133242698 TGTCACATTCTGAGGTACTGAGG + Intronic
1091269923 11:134300873-134300895 AGTCACATTCTGCAGTACTGAGG + Intronic
1091470631 12:723619-723641 AGTCACATTCTGAGATACTGGGG - Intergenic
1091512933 12:1148495-1148517 TGTAACATGATGAATTACTGGGG - Intronic
1091576419 12:1740559-1740581 AGTCTCATTGTAAAGTACTGGGG + Intronic
1091835747 12:3584331-3584353 AGTCACATTCTCAGGTACTGGGG + Intronic
1093044092 12:14421661-14421683 GGTCACATTCTGAGGTACTGGGG + Intronic
1093143944 12:15542023-15542045 AGTCACATTCTGAGGTACTAAGG + Intronic
1093412129 12:18879512-18879534 AGTCACACTCTGGAGTACTGGGG + Intergenic
1093518635 12:20021407-20021429 AGTCACATTTTGTGGTACTGGGG - Intergenic
1093755107 12:22843388-22843410 AGTTACATTCTGAGGTACTGGGG + Intergenic
1094182945 12:27611504-27611526 GGTCACATGCTGAGGTCCTGGGG + Intronic
1094683929 12:32691592-32691614 AGTCACATTCCGAGGTACTGGGG + Intronic
1094708676 12:32939757-32939779 AGTCACATTCTGAGGTAATGAGG - Intergenic
1095321436 12:40832986-40833008 AGCAACATGGAGAAGAACTGGGG - Intronic
1095351606 12:41220425-41220447 AGTCACATTTGGAGGTACTGAGG + Intronic
1095401306 12:41817683-41817705 GGTCACATTCTGAAATACTGGGG - Intergenic
1095482579 12:42651366-42651388 AGTCACATTCTGAGGTACTGGGG - Intergenic
1095693373 12:45116723-45116745 GGTCAAATTCTGAAGTACTGGGG + Intergenic
1095708872 12:45267416-45267438 AGTCACATTTTGAGGTACTTTGG + Intronic
1095932873 12:47646718-47646740 AGTCACATTCTGAGGTACTGGGG + Intergenic
1096108955 12:49017935-49017957 AGACACATGGTTAAAAACTGTGG + Intronic
1096315275 12:50559155-50559177 TGTCCCTTGGGGAAGTACTGGGG - Intronic
1096505496 12:52089894-52089916 GGTCACATCCTGAAGTACTCAGG + Intergenic
1096794857 12:54070197-54070219 AGTCACATTCTGAGTTACTGAGG + Intergenic
1096924815 12:55132313-55132335 AGTCACATTCTGAAGTACTAGGG - Intergenic
1097206354 12:57324829-57324851 AGTCACATTCTGAGGTACTGAGG - Intronic
1097481868 12:60137357-60137379 AGTCACATTCTGAGGTACTGAGG + Intergenic
1097577560 12:61413716-61413738 GGTCACATTCTGAAGTGCTGGGG + Intergenic
1097708529 12:62893833-62893855 AGTCACATTCTGAGGTACTAGGG + Intronic
1098096761 12:66965048-66965070 AGTCACATTCTGAGGTACTGGGG + Intergenic
1098389256 12:69951832-69951854 AGTCACATTCTGAGGTACTGGGG + Intronic
1098815780 12:75160075-75160097 AGTCACATTCTGTGGTACTGGGG - Intronic
1099099349 12:78418655-78418677 AGTTACATTCTGAAGTACTGAGG + Intergenic
1099118426 12:78656917-78656939 AATCACATTTTGAGGTACTGGGG - Intergenic
1100218566 12:92479397-92479419 GGTCACATTCTGAGGTACTGAGG + Intergenic
1100303385 12:93328174-93328196 TGTCACACTCTGAAGTACTGGGG - Intergenic
1100366599 12:93926981-93927003 AGTCACATTCTGAGATACTGGGG - Intergenic
1100447105 12:94670979-94671001 AGTCACATTCTGAAGTACTAGGG + Intergenic
1100461993 12:94808937-94808959 AGTCATATTCTGAGGTACTGCGG + Intergenic
1100699723 12:97134458-97134480 AATCACATTGTGAGGTACCGGGG - Intergenic
1100784744 12:98066907-98066929 AGTCACATTCTAAAATACTGGGG - Intergenic
1101016147 12:100502589-100502611 GGTCACATTCTGAGGTACTGGGG + Intronic
1101274518 12:103184749-103184771 AGTCACATGCTGAGTTACTGGGG - Intergenic
1101414441 12:104497179-104497201 AGTGACATTTTGAGGTACTGGGG - Intronic
1101439547 12:104693224-104693246 AGTTACATTCTGAAGTGCTGGGG + Intronic
1101558968 12:105837813-105837835 AGGCACATTCTGAGGTACTGGGG + Intergenic
1101618717 12:106362720-106362742 AGTCACATTCTGAGATACTGGGG + Intronic
1102188608 12:110968884-110968906 AGTCACATTCTGAGGCACTGGGG - Intergenic
1102282496 12:111629461-111629483 GGTCACATTGTGAGGTACTGTGG - Intergenic
1102343522 12:112142763-112142785 AGGCACATGATGAAGTACTTAGG + Intronic
1102458070 12:113083224-113083246 AGTCACATTCTGAGGTCCTGAGG + Intronic
1102482173 12:113231492-113231514 AGTCACATTCTGAGCTACTGGGG + Intronic
1102598405 12:114010901-114010923 AGTCATATTCTGAAATACTGGGG + Intergenic
1102996313 12:117353690-117353712 AGTCACAAGATGAAGTACATGGG + Intronic
1103144213 12:118580404-118580426 AGTCACATTCTGAAGTATTAGGG - Intergenic
1103196705 12:119049957-119049979 AATCACATTCTGAGGTACTGAGG + Intronic
1103227946 12:119304144-119304166 AGTCACATTTTGAAGTACTGTGG - Intergenic
1103249227 12:119485734-119485756 AGTCACACGCTGAGGTACAGAGG + Intronic
1103533104 12:121616132-121616154 GGTCACATTCTGAGGTACTGAGG + Intergenic
1103841893 12:123871861-123871883 AGCCACATGGTGAGGAACTGAGG - Intronic
1103963818 12:124625636-124625658 AGTCCCATTGTGAGATACTGGGG + Intergenic
1103978833 12:124722540-124722562 AGTCACATTCTGAGGTACTGGGG + Intergenic
1104353970 12:128068840-128068862 AGTCACATTGACATGTACTGAGG + Intergenic
1104397218 12:128444554-128444576 AGTCACACGGGGAAATACTTGGG + Intronic
1105216547 13:18290186-18290208 AGTTACATGCTGAAGTACTTAGG + Intergenic
1105673587 13:22645918-22645940 AGTCCCATTGTGACGTACTGAGG + Intergenic
1105823972 13:24105725-24105747 AGTCACATGTGGAGGTACTGGGG - Intronic
1106047784 13:26160996-26161018 AGCCACATTGTGAGGTACTGGGG + Intronic
1106084298 13:26526449-26526471 AGTCACATTCTGAGGTACTGGGG - Intergenic
1106110452 13:26772218-26772240 AGTCCCATTCTGAAGTACTGGGG - Intergenic
1106171742 13:27294606-27294628 AGTCACATTCTGAGGTGCTGGGG - Intergenic
1106229162 13:27808461-27808483 AGTCACATACTTAGGTACTGGGG - Intergenic
1106305742 13:28507783-28507805 AGTCACATTCGGAGGTACTGGGG - Intergenic
1106333849 13:28764932-28764954 AGCCACATTCTGAGGTACTGAGG + Intergenic
1106490025 13:30212850-30212872 AGTCACATTCTGAAGTACTGGGG - Intronic
1106605922 13:31228718-31228740 AGTCACATTCTGAGGTATTGGGG + Intronic
1106625926 13:31420931-31420953 AGTTACATTCTGAGGTACTGGGG + Intergenic
1106636453 13:31533741-31533763 AGTCACATTCTAAACTACTGGGG + Intergenic
1106752988 13:32794100-32794122 AGTCACATTCTGAGGTAGTGGGG + Intergenic
1106759801 13:32857535-32857557 AGTCACATTCTGAGGTACTGAGG - Intergenic
1106925899 13:34612844-34612866 AGTCACATTCTGAGGTACTGGGG + Intergenic
1107043694 13:35974222-35974244 AGTCACATTCTCAAGTACTCGGG - Intronic
1107153514 13:37139943-37139965 CGCCACATTCTGAAGTACTGGGG + Intergenic
1107339845 13:39394342-39394364 AGTCACATTCTGAGGTACTGGGG + Intronic
1107960254 13:45550928-45550950 GGTCACATTCTGAAGCACTGGGG + Intronic
1107995559 13:45856732-45856754 AGTCACATTCTGAGGTGCTGGGG - Intergenic
1108203347 13:48063340-48063362 AGTCACATTCTGAAGTACTGAGG - Intronic
1108434151 13:50385356-50385378 AGTCACATTTTGAGGTATTGGGG - Intronic
1108517594 13:51217743-51217765 AGTCGCATTCTGAGGTACTGGGG - Intergenic
1108718706 13:53107947-53107969 AGTCACATTCTGAGGTACTGCGG + Intergenic
1108723421 13:53155514-53155536 GGTCACATTCTGAAGTACTTGGG + Intergenic
1108819225 13:54326493-54326515 AGTCACATTCTAAGGTACTGGGG - Intergenic
1109139609 13:58697901-58697923 AGTTACATTGTGAAATGCTGAGG - Intergenic
1109302130 13:60600385-60600407 AGTCAGATTCTGAAGTATTGGGG - Intergenic
1109302641 13:60604976-60604998 AGTCAAATGGAGAAAGACTGTGG + Intergenic
1109899636 13:68749504-68749526 AGTCACATTCTGCTGTACTGGGG - Intergenic
1110139773 13:72114280-72114302 GGTCACTTGTTGAAGAACTGTGG - Intergenic
1110494676 13:76153201-76153223 AGTCACATTCTGAAGTACTAGGG + Intergenic
1110563050 13:76929731-76929753 AGTTACATGGTGATATAGTGTGG - Intergenic
1110687778 13:78395525-78395547 AGTCACATTCTGAGGTACTGGGG + Intergenic
1110984877 13:81954555-81954577 AGTCACATTCTGACGTCCTGTGG - Intergenic
1111454450 13:88462047-88462069 AGTCACATTCTGAGGTACTGGGG + Intergenic
1111735414 13:92132735-92132757 AGTCACATTCTGAAGTATTGGGG + Intronic
1111938548 13:94584234-94584256 AGTCACATTCTGAGGTTCTGGGG - Intronic
1111982392 13:95030499-95030521 AGTCACATTCTGATGTACTTGGG - Intronic
1112094736 13:96119969-96119991 GGTCACATTCTGAAGTACTAGGG - Intronic
1112123267 13:96436522-96436544 AGTCATATTTTGAGGTACTGGGG - Intronic
1112201917 13:97284567-97284589 AGTCACATTCTGAGGAACTGGGG + Intronic
1112411077 13:99164135-99164157 AGTCACATTCTGAAGTACTGAGG - Intergenic
1112600173 13:100847506-100847528 AGTCACATTCTGAGGTACTGGGG + Intergenic
1112601375 13:100858831-100858853 AGTCACATTCTGAGGTACTAGGG - Intergenic
1112609382 13:100940976-100940998 AGGCACATGTTGATGTACTTGGG - Intergenic
1112626123 13:101106285-101106307 AGTCACATTCTGAGGTTCTGAGG + Intronic
1112694928 13:101937305-101937327 AGTCACATTCTGAGGTACTAGGG - Intronic
1112775862 13:102843574-102843596 AGTCACATTCTGAGGTACTCAGG + Intronic
1112808854 13:103193902-103193924 AGTCACATGGTTAAGTCCATTGG + Intergenic
1112967743 13:105218772-105218794 GGTCACATCCTGAGGTACTGTGG + Intergenic
1113161717 13:107389288-107389310 GGTCACATTGTGAGGTACTGGGG - Intronic
1113223654 13:108134671-108134693 GGTCACATTTTGAAGTACTGAGG - Intergenic
1113250188 13:108444295-108444317 AGTCACATTCTGTGGTACTGGGG - Intergenic
1113273649 13:108703849-108703871 AGTCACATTCTGATTTACTGGGG - Intronic
1113355077 13:109571477-109571499 ATACACATGGGGAAGTAGTGGGG + Intergenic
1113411492 13:110094237-110094259 AGTCACATTCTGAGGTACTGGGG - Intergenic
1113615208 13:111675599-111675621 AGTCACATTGTGAAGTTCTAGGG + Intergenic
1113620675 13:111760512-111760534 AGTCACATTGTGAAGTTCTAGGG + Intergenic
1114305781 14:21421757-21421779 ACTCACATTCTGAGGTACTGGGG - Intronic
1114441920 14:22755475-22755497 AGTCACATTCTCAAGTACTGGGG - Intergenic
1114823728 14:26052531-26052553 AGTCACATTCTGCGGTACTGAGG - Intergenic
1114827037 14:26093579-26093601 AATCACATTGTGAAGTCCTGGGG + Intergenic
1114863490 14:26557160-26557182 GGTCACATTCTGAGGTACTGGGG + Intronic
1114875033 14:26706395-26706417 AGTCACATTCTGAGGTCCTGTGG - Intergenic
1115306519 14:31939167-31939189 AGTCACATTCTGAGGTACTGAGG - Intergenic
1115620816 14:35138285-35138307 AGTCACATTCTGAAATACTATGG + Intronic
1115693799 14:35874820-35874842 AGTCATATTCTGAGGTACTGGGG - Intronic
1116004690 14:39279929-39279951 AGTCACATTCTGAGGTACTGGGG + Intronic
1116095830 14:40365658-40365680 AAACACATTGTGAAGTACTATGG - Intergenic
1116178586 14:41507048-41507070 ACTCACATGGAAAAGTACTGAGG - Intergenic
1116354503 14:43911584-43911606 AGTCACATGTTGCATTAGTGTGG - Intergenic
1116433854 14:44875433-44875455 AGTTAAATGGAGAAGTAGTGAGG - Intergenic
1116700310 14:48232681-48232703 AGTCACATTCTGAGGTACTGAGG - Intergenic
1116806526 14:49499325-49499347 AGTCACATTCTGAGGTACTGAGG + Intergenic
1117623108 14:57608248-57608270 GGTCACATGCTCAGGTACTGAGG - Intronic
1117748592 14:58897345-58897367 AGCCACATTCTGAGGTACTGGGG - Intergenic
1117787322 14:59299902-59299924 AGTAGCATGCTGAAGCACTGTGG - Intronic
1117802174 14:59455675-59455697 GCCCACATGGTGAGGTACTGAGG - Intronic
1117976381 14:61301021-61301043 GGTCCCATGGTGAAGTACACAGG - Intronic
1118032093 14:61827933-61827955 AGTCACATTCTGAAGTCCTGAGG - Intergenic
1118071390 14:62250018-62250040 AGTCACATTGTTAGGCACTGGGG + Intergenic
1118374962 14:65168839-65168861 AGTCACATGATGAAGAAGAGGGG - Intergenic
1118437987 14:65788996-65789018 GGTCACATTCTGAGGTACTGGGG - Intergenic
1118997756 14:70852696-70852718 AGTCACATTCTGAGGTACTGGGG - Intergenic
1119105036 14:71915758-71915780 AGTCACATTCTGAGGTACTAGGG - Intergenic
1119129715 14:72160543-72160565 AGTCACATTCTGAGATACTGGGG - Intronic
1119144742 14:72301907-72301929 GGTCACATTTTGAAGCACTGGGG + Intronic
1119493011 14:75052876-75052898 AGTCACTTTCTGAGGTACTGGGG + Intergenic
1119616354 14:76101437-76101459 AGTCACATTCTGGGGTACTGGGG - Intergenic
1119881966 14:78106734-78106756 AGTCACATTCTGAGGTATTGGGG - Intergenic
1120014771 14:79459267-79459289 AGTCACATTCTGAGATACTGAGG - Intronic
1120148625 14:81006821-81006843 AGTCACTTTCTGAGGTACTGGGG + Intronic
1120425890 14:84347835-84347857 AGTCACATTCTGAGGTACTGGGG - Intergenic
1120528804 14:85608118-85608140 AGTCACATTCTGAGATACTGGGG + Intronic
1120688489 14:87566088-87566110 AGTCACATGGTGATATAATTGGG + Intergenic
1120715616 14:87837974-87837996 AGTCACATTCTGAGGTACTGAGG - Intronic
1120730992 14:88001651-88001673 AGCCACATTCTGAAGTATTGAGG + Intergenic
1120918070 14:89727561-89727583 AGTCACATCCTGAGGTAGTGGGG - Intergenic
1121179688 14:91919545-91919567 AGTCACATTCTGAGGTACTGGGG - Intronic
1121219150 14:92272825-92272847 AGTCACATTCAGAGGTACTGAGG + Intergenic
1121258388 14:92548809-92548831 GGTCACATGTACAAGTACTGGGG + Intronic
1121522435 14:94595265-94595287 AGTCACATTTTGAAATATTGAGG + Intronic
1121827600 14:97023109-97023131 GGTCACATTCTGAGGTACTGGGG + Intergenic
1121832259 14:97062663-97062685 AGTCACATTCGGAGGTACTGGGG - Intergenic
1121883720 14:97523684-97523706 AGTTGCATTCTGAAGTACTGGGG + Intergenic
1122439000 14:101717379-101717401 AGCCACATTCTGAGGTACTGGGG - Intergenic
1122818576 14:104327890-104327912 GGTCACATTCTGAGGTACTGGGG + Intergenic
1123430698 15:20213490-20213512 GGTCACATTCTGAGGTACTGGGG + Intergenic
1124177905 15:27443052-27443074 AGTCACATTCTGAAGTACTGGGG - Intronic
1124212613 15:27775909-27775931 AGTCACATTCTGAGGTGCTGGGG + Intronic
1124351534 15:28959344-28959366 AGTCACATTCTGAGGTCCTGGGG - Intronic
1124792628 15:32743900-32743922 GTTCACATGGTGAGGAACTGAGG - Exonic
1125085659 15:35726238-35726260 AATCACATTCTGAAGTACTGTGG - Intergenic
1125408976 15:39384905-39384927 AGTCACATTCTGAGGTACTGGGG - Intergenic
1125969573 15:43900977-43900999 GGTCACATTCTGAGGTACTGAGG - Intronic
1126277609 15:46902616-46902638 AGTCAAATTTTGAAGTACTTGGG - Intergenic
1126585927 15:50287402-50287424 AGTCACACTTTGAGGTACTGGGG - Intronic
1126676823 15:51166766-51166788 AGCCACCTGGGGAAGGACTGGGG + Intergenic
1127263363 15:57342181-57342203 AGTCACATTCGGAGGTACTGGGG - Intergenic
1127368065 15:58309897-58309919 GGTCACATGCTGAGGTACTGGGG - Intronic
1127374993 15:58376271-58376293 AGTCACATTCTAAGGTACTGGGG - Intronic
1127382861 15:58444743-58444765 AGTCACATTCTGAGGTACTGAGG + Intronic
1127848757 15:62894918-62894940 GGTCACATTGTGAGATACTGAGG + Intergenic
1128317901 15:66672609-66672631 AGTCACACTCTGAGGTACTGGGG + Intronic
1128616112 15:69111318-69111340 AGTTGCATGCTAAAGTACTGTGG - Intergenic
1129052282 15:72792363-72792385 AGTCACATTTTGAGGTACTAGGG + Intergenic
1129415482 15:75375249-75375271 GGTCACATTCGGAAGTACTGGGG - Intronic
1129449005 15:75639353-75639375 AGTAACTTGGTGCAGCACTGGGG - Exonic
1129595285 15:76959185-76959207 AGAGACATATTGAAGTACTGTGG - Intergenic
1130050163 15:80477749-80477771 AGTCACATTCTGGGGTACTGGGG + Intronic
1130097840 15:80869261-80869283 AGTCACATTCTGAGGTGCTGGGG + Intronic
1130374761 15:83318895-83318917 ATCCACATGGTGAACAACTGAGG + Intergenic
1130672606 15:85925858-85925880 AGTCACAAGGTGAACAAGTGAGG - Intergenic
1130785202 15:87088056-87088078 AGTCACATCCTGAGGTACTGGGG - Intergenic
1130832158 15:87611966-87611988 AGTTACATGCTGAAGTGCTGGGG + Intergenic
1130890540 15:88129847-88129869 AGTCACATTCTGAAGTACTAGGG - Intronic
1131028077 15:89162120-89162142 AGTCACATTCTGAGGTACCGGGG + Intronic
1131036550 15:89226202-89226224 AGTCACATTCTGAGGTCCTGGGG - Intergenic
1131040219 15:89257683-89257705 GGTCACATTCTGAAATACTGGGG + Intronic
1131275320 15:90975645-90975667 AGTCACATTCTGAGGTACTGGGG - Intronic
1131293230 15:91125227-91125249 GGTCACATTCTGAAGTTCTGGGG + Intronic
1131375722 15:91921352-91921374 AGTCACATGCTGATGTACTGGGG + Intronic
1131534701 15:93226480-93226502 AGTCCCATTCTGAGGTACTGAGG - Intergenic
1131547903 15:93331114-93331136 GGTCACATTCTGAAGTACTGGGG + Intergenic
1131585668 15:93690250-93690272 AGTCACATTCTGAGGTACTGGGG - Intergenic
1131741571 15:95398588-95398610 AGTCACATTTTGAGGTATTGGGG + Intergenic
1131972031 15:97902987-97903009 GGTCACATTCTGAGGTACTGGGG + Intergenic
1132150098 15:99453028-99453050 AGCCACATGAGGAAGTGCTGGGG - Intergenic
1132347867 15:101119287-101119309 AGTCACAGGATGGAGTACTGTGG - Intergenic
1132354869 15:101163684-101163706 GGTCACATTCTGAGGTACTGGGG - Intergenic
1132367153 15:101265929-101265951 AGTCACATTCTGGAGTACTGAGG - Intergenic
1133037884 16:3044949-3044971 AATCACATTCTGAGGTACTGGGG - Intergenic
1133145682 16:3784634-3784656 ACACACATGGTGATGGACTGTGG + Intronic
1133451095 16:5904636-5904658 AGTCACATTCTGAGGTACTGAGG - Intergenic
1133694669 16:8250465-8250487 AGTCACATTCTGGGGTACTGAGG + Intergenic
1133846832 16:9462442-9462464 AGTCACATTCTGCAGTACTGGGG + Intergenic
1133907681 16:10036921-10036943 GGTCACATCCTGAGGTACTGAGG + Intronic
1133977166 16:10607449-10607471 AGTCACATTCTGAGTTACTGGGG - Intergenic
1134217532 16:12327620-12327642 AGTCACATTCTCAAGTACTGGGG + Intronic
1134269763 16:12723356-12723378 AGTCATATGATGAGGTACTGGGG - Intronic
1134425203 16:14135658-14135680 AGTCTCATGCTGAAATGCTGAGG - Intronic
1134692862 16:16202469-16202491 AGTCACATTCAGAGGTACTGGGG - Intronic
1134759169 16:16698351-16698373 GGTCACATTCTGAGGTACTGGGG - Intergenic
1134836316 16:17364072-17364094 AGTCACATTTTGAGGTATTGGGG + Intronic
1134859748 16:17550654-17550676 GGTCACATTTTGAAGTACTAGGG + Intergenic
1134978985 16:18592226-18592248 AGTCACATTCAGAGGTACTGGGG + Intergenic
1134986904 16:18660833-18660855 GGTCACATTCTGAGGTACTGGGG + Intergenic
1135080449 16:19429965-19429987 GGTCACATTCTGAAGTACTGCGG + Intronic
1135125952 16:19809448-19809470 AGCCACATGGAGGAGAACTGTGG - Intronic
1135687193 16:24507326-24507348 AGTCACGTTCTGAAGCACTGGGG + Intergenic
1135798130 16:25465787-25465809 ACTCACATTCTGAGGTACTGGGG - Intergenic
1135829477 16:25760774-25760796 AGTCACATTCTGAGGTACTGGGG + Intronic
1135872254 16:26161815-26161837 AGTCACATTTTGAGGTGCTGGGG - Intergenic
1135946504 16:26869591-26869613 AGTCACATTCTGAGGTACTAGGG + Intergenic
1136058443 16:27707952-27707974 AGTCATATTCTGAGGTACTGGGG + Intronic
1136102385 16:28005573-28005595 GGTCACATTCTGAGGTACTGGGG + Intronic
1136853942 16:33637725-33637747 GGTCACATTCTGAGGTACTGGGG - Intergenic
1137521983 16:49202299-49202321 AGCCATATTCTGAAGTACTGAGG - Intergenic
1137878496 16:52021067-52021089 AGCCAGATGGTGGAGCACTGTGG - Intronic
1137927809 16:52557909-52557931 AGTCACATTCTGAGGTACTGGGG + Intergenic
1138145940 16:54611961-54611983 AGTCACATTCTGAGGTACTAGGG - Intergenic
1138343461 16:56305961-56305983 AGTCACATTCTGAGGTCCTGGGG + Intronic
1138634067 16:58322626-58322648 AGTCACATTCTGAGGTAGTGGGG + Intronic
1138857995 16:60719094-60719116 AGTCTGATGGTGAATTATTGTGG + Intergenic
1138877175 16:60966228-60966250 AGTCACATTCTGGAGTACTGGGG - Intergenic
1139001776 16:62519577-62519599 AGGCACATGGGGAAGCAGTGGGG + Intergenic
1140350569 16:74258299-74258321 AGTCACATTCCGAGGTACTGGGG - Intergenic
1140706304 16:77633438-77633460 AGTCACATTTTGAGGTACTGGGG + Intergenic
1140731411 16:77859905-77859927 AGTGACGTTGTGAGGTACTGGGG - Intronic
1140815661 16:78618579-78618601 AGTCACATTGTGAGGTACTGGGG + Intronic
1141170956 16:81691387-81691409 AGTCACATTCTGAAGTACTGGGG + Intronic
1141256211 16:82404615-82404637 AGTCACATCTTGAGGTACTAAGG - Intergenic
1141458145 16:84158489-84158511 AGTCACATTCTGAGGTGCTGAGG + Intronic
1141759161 16:86015970-86015992 AGTGACATGGTGAATAGCTGAGG + Intergenic
1203115524 16_KI270728v1_random:1486169-1486191 GGTCACATTCTGAGGTACTGGGG - Intergenic
1143314123 17:6018604-6018626 AGGCACGTGTTGAAGTACTCAGG - Intronic
1143767188 17:9145427-9145449 AGTCACAGGGTGGAGGTCTGGGG + Intronic
1143770012 17:9162550-9162572 GGTCACATTCTGAGGTACTGGGG + Intronic
1143901145 17:10175843-10175865 AGTCACATTCTGAGGTACTAGGG + Intronic
1143993055 17:10983134-10983156 AGTCACATTCTGAGGTACTGGGG + Intergenic
1144154986 17:12491617-12491639 AGTCACATTCTGAGATACTGGGG - Intergenic
1144160605 17:12553893-12553915 AGTCACATGCACAGGTACTGGGG + Intergenic
1144212027 17:13023759-13023781 AGTGACATCCTGAGGTACTGGGG + Intergenic
1144455145 17:15412614-15412636 AGTCACCTTCTGAGGTACTGGGG + Intergenic
1145029218 17:19491919-19491941 AGTCACATTCTGAGGTGCTGGGG - Intergenic
1145288764 17:21526450-21526472 AGGCACATTCTGAGGTACTGGGG - Intronic
1146274006 17:31503370-31503392 AGTCACATTCTGAAGTACTAGGG + Intronic
1146415750 17:32631067-32631089 AGTCACTTTCTGAGGTACTGGGG + Intronic
1146503698 17:33386273-33386295 AGTCACATGGAGAAGCAAAGTGG - Intronic
1146953038 17:36919939-36919961 AGTCACATTGTGAGTTAATGGGG - Intergenic
1147371043 17:39993307-39993329 AGTCCCATTCTGAGGTACTGGGG + Intronic
1147465788 17:40609563-40609585 AGTCCCATTATGAGGTACTGGGG + Intergenic
1147977609 17:44256911-44256933 AGTCACATGGTTATGTACACAGG + Intronic
1148162654 17:45459905-45459927 GGTCACATTCTGAGGTACTGGGG - Intronic
1148789224 17:50164089-50164111 AGTCACATGGAGAAGCTCAGGGG + Intergenic
1148969127 17:51464065-51464087 GGTCACATTCTAAAGTACTGGGG - Intergenic
1149088931 17:52753735-52753757 AGTCACATTCTGAGGTACTGAGG + Intergenic
1150204904 17:63396236-63396258 AGTCACATGGTTAGATAATGTGG + Intronic
1150393882 17:64806570-64806592 GGTCACATTCTGAGGTACTGGGG - Intergenic
1150434834 17:65145731-65145753 AGTCACAGTCTGAGGTACTGGGG + Intronic
1150650770 17:67008632-67008654 GGTCACATTCTGAAGTACTGGGG - Intronic
1150949507 17:69786418-69786440 AGTCACATTCTGAAGTACAAAGG + Intergenic
1150950627 17:69799532-69799554 AGTCACATTCTGAGGTACTGAGG - Intergenic
1151410522 17:73924421-73924443 AGTCACATTCTGAGGTACTCGGG - Intergenic
1151514437 17:74583215-74583237 AGTCACATTTTGAGGTACTGGGG - Intronic
1151643655 17:75414826-75414848 AGTCACATTCTTAGGTACTGGGG - Intergenic
1151871120 17:76837606-76837628 ACTCACATTCTGAAGTACAGGGG - Intergenic
1151903154 17:77030817-77030839 AGTCACATTCTGAAGTACTGGGG - Intergenic
1152030183 17:77837507-77837529 AGTCACATTTTGAGGGACTGGGG + Intergenic
1153185614 18:2482731-2482753 AGTGTCTTGGTGAAGTTCTGTGG - Intergenic
1153244239 18:3057848-3057870 AGTCACATATTAAGGTACTGGGG + Intergenic
1153587756 18:6640966-6640988 AGTCACATTCTGGGGTACTGCGG + Intergenic
1153599212 18:6762591-6762613 AGTCACATTCTGAGGTACTGGGG - Intronic
1153617012 18:6944481-6944503 AATCACATTCTGAGGTACTGGGG - Intronic
1153655754 18:7280716-7280738 AGTCACATTCTGAAATACTGGGG + Intergenic
1153885502 18:9461084-9461106 AGTCACATTCTGAGGTACTGGGG - Intergenic
1153930970 18:9879332-9879354 GGTCACATTCTGAGGTACTGGGG + Intergenic
1154927429 18:20951374-20951396 AGTCACATGGTTAACTGTTGAGG + Exonic
1155037294 18:22035514-22035536 AGTCACATTCTGAGGTACTGGGG + Intergenic
1155137463 18:23010136-23010158 GGTCACATAATGAAGTACTATGG - Intronic
1155318395 18:24594728-24594750 GGTCACATTCTGAGGTACTGGGG - Intergenic
1155337957 18:24784595-24784617 AGTTACATTCTGAGGTACTGGGG + Intergenic
1155514658 18:26612367-26612389 AGTTACATTCTGAGGTACTGGGG - Intronic
1155737290 18:29239496-29239518 AGTCACATTCTGAAATACTAGGG - Intergenic
1155844619 18:30690063-30690085 GGTCACATTCTGAGGTACTGAGG + Intergenic
1155865099 18:30955140-30955162 AGTCACATTGTAAGATACTGAGG + Intergenic
1155938979 18:31784624-31784646 GGTCACATTCTGAGGTACTGGGG - Intergenic
1155970788 18:32081633-32081655 AGTCACATTCTAAGGTACTGGGG + Intergenic
1156013579 18:32522408-32522430 AGCCACATTCTGAGGTACTGGGG + Intergenic
1156201986 18:34843688-34843710 AGTCACATTCTAAGGTACTGAGG + Intronic
1156566640 18:38198764-38198786 AGTCACTTCCTGAGGTACTGAGG + Intergenic
1156703233 18:39849571-39849593 AGTCACATTCTGATATACTGAGG - Intergenic
1156978539 18:43256933-43256955 AGTCACATTCTGAAGTACTAGGG - Intergenic
1157000906 18:43523384-43523406 GGTCACATTCTGAAGTACTGAGG + Intergenic
1157017580 18:43735835-43735857 AGTCACATGCTGAGGTACTAGGG + Intergenic
1157089026 18:44613450-44613472 TGTCACATGGTGAGGCCCTGTGG - Intergenic
1157541838 18:48516162-48516184 AGTCACATTGAGAGGTGCTGGGG - Intergenic
1157549169 18:48569169-48569191 AGTCATGTTCTGAAGTACTGAGG + Intronic
1157578087 18:48757254-48757276 AGTCACATTCTGAAGTATTGGGG + Intronic
1157691702 18:49687735-49687757 AGTCTCATTCTGAGGTACTGAGG + Intergenic
1157772126 18:50358479-50358501 AGTCACATTTTGAGGTATTGGGG + Intergenic
1158027530 18:52919098-52919120 AGTCACGTGGAGAATAACTGAGG - Intronic
1158208384 18:55019898-55019920 AGGCACATGGTGTAGAACAGTGG - Intergenic
1158347859 18:56533901-56533923 AGTCACATTATGAGATACTGGGG + Intergenic
1158416202 18:57251670-57251692 GGTCACATTCTGAGGTACTGGGG + Intergenic
1158500527 18:57996714-57996736 AGTCACATTCTGAGGTAGTGGGG + Intergenic
1158528267 18:58234683-58234705 GGTCACATTCTGAAATACTGGGG + Intronic
1158623808 18:59054891-59054913 AGTCACACTCTGAATTACTGGGG + Intergenic
1158698229 18:59721984-59722006 GGTCACATTCTGAAGCACTGAGG - Intergenic
1158721035 18:59924929-59924951 AGTCACATTCTGAGGAACTGCGG - Intergenic
1158811802 18:61046765-61046787 AGTCACCTTGGGAAGAACTGTGG + Intergenic
1158839414 18:61368042-61368064 GGTCACACTCTGAAGTACTGGGG + Intronic
1158866536 18:61643240-61643262 GGTCACATTCTGAAGTACTGGGG - Intergenic
1159410617 18:68071192-68071214 AGTCACATTCTGAGGTGCTGGGG - Intergenic
1159438232 18:68445541-68445563 AGTTACATTCTGAGGTACTGGGG - Intergenic
1159469853 18:68837765-68837787 AGTCACATTCTGAGGTACTGGGG + Intronic
1159609190 18:70507684-70507706 AGTCACAGTCTGAGGTACTGGGG + Intergenic
1159896647 18:74002915-74002937 AGTCACATTCTGAGGTACTGGGG - Intergenic
1159918077 18:74203588-74203610 GGTCACATTCTGAGGTACTGGGG + Intergenic
1160013282 18:75122812-75122834 GGTCACATTCTGAAGTACTGGGG + Intergenic
1160475366 18:79180414-79180436 AGTGACATGGAGAAATATTGCGG - Intronic
1160892518 19:1386833-1386855 AGTCACATTCTGAGGTCCTGGGG + Intronic
1161004524 19:1928196-1928218 AGTCACATTCTGAGGTCCTGGGG - Intergenic
1162172579 19:8803063-8803085 AGTCCCATTCTGAGGTACTGGGG - Intergenic
1162838450 19:13337584-13337606 GGTCACATTCTGAGGTACTGGGG + Intronic
1163055217 19:14712848-14712870 GGTCACATTTTGAAGTACTGGGG + Intronic
1163073077 19:14862439-14862461 AGTCACATATGGAATTACTGTGG - Intergenic
1163151372 19:15416988-15417010 ACTCACATTGTAAATTACTGTGG + Intronic
1163449517 19:17367850-17367872 AGTCACATTCTCAGGTACTGGGG - Intronic
1164411245 19:28007392-28007414 AGTCACATTCTGAGGTCCTGAGG - Intergenic
1165143618 19:33717903-33717925 AGTCACATTCAGAGGTACTGGGG + Intronic
1165534314 19:36430642-36430664 ACTCACATTGTGAGGTACTGGGG - Intergenic
1166036485 19:40171882-40171904 AGTCACATTCTGCGGTACTGGGG + Intergenic
1166657028 19:44619850-44619872 GGTCACATTCTGAGGTACTGGGG + Intronic
1166676285 19:44742974-44742996 GGTCACACGGTGAGGAACTGGGG - Intergenic
1166711567 19:44940993-44941015 GGTCACACGGTGAAGAAGTGAGG + Intergenic
1166877271 19:45905038-45905060 GGTCACATTCTGAAGCACTGGGG - Intergenic
1167206969 19:48109228-48109250 AGTCACATTCTGAGGTTCTGGGG - Intronic
1167235706 19:48313480-48313502 GGTCACATTCTAAAGTACTGGGG - Intronic
1167340030 19:48909948-48909970 GGTCACATTCTGAGGTACTGGGG + Intronic
1167857670 19:52255974-52255996 GGCCACATGCTGAGGTACTGGGG - Intergenic
1168460071 19:56547370-56547392 AGTCACATTCAAAAGTACTGGGG + Intronic
1168508295 19:56954702-56954724 AGCCACAGAGGGAAGTACTGGGG + Intergenic
925009902 2:476037-476059 AATCACATGCTGAGGTACTGGGG - Intergenic
925478821 2:4247836-4247858 AGTCACATTCTGAGGTGCTGGGG - Intergenic
925515653 2:4678004-4678026 AGTGACATTCTGAGGTACTGGGG + Intergenic
925536501 2:4923734-4923756 AGTCTCATTGGGAGGTACTGGGG + Intergenic
925973550 2:9125035-9125057 GGTCACATTCTGAGGTACTGGGG - Intergenic
926052816 2:9755626-9755648 AGTCACATCCTGAGGTACAGGGG - Intergenic
926060981 2:9804690-9804712 GGTCACATTCTGAGGTACTGGGG - Intergenic
926098949 2:10101536-10101558 AGCCACACGGTGTAGTGCTGGGG + Intergenic
926126045 2:10272455-10272477 AGTCACATTTTGAGGTACTGGGG - Intergenic
926635258 2:15171692-15171714 AGTCACATTGTGAGGTACTGAGG - Intronic
926742560 2:16124938-16124960 AGCCACATTCTGAAGTAGTGAGG - Intergenic
926776102 2:16424808-16424830 GTTCACATGGGGAAGAACTGAGG - Intergenic
926931881 2:18049070-18049092 AGTCACATTCTGAAGTATTGGGG + Intronic
926966795 2:18423720-18423742 TGTCACATGCTAAAGTATTGAGG + Intergenic
926984958 2:18612531-18612553 GGTCACATTGTGAGGTAGTGGGG + Intergenic
927028869 2:19099829-19099851 GGTCACATTGTGAGGTACTGCGG - Intergenic
927066383 2:19475339-19475361 AGTCACATTCTGAGGTACTAGGG - Intergenic
927382484 2:22495186-22495208 AGTCATATTCTGAAGTACTAGGG - Intergenic
927393683 2:22624936-22624958 AGTGACATTGTTAAGTACAGTGG + Intergenic
927454918 2:23241128-23241150 AGTCACATTCTGAGGTGCTGGGG + Intergenic
927471039 2:23376937-23376959 AGCCACATGGCAAAGAACTGAGG + Intergenic
927585142 2:24296417-24296439 TGTCACATTCTGAGGTACTGGGG - Intronic
928018713 2:27683602-27683624 AGTCATATTCTGAGGTACTGGGG + Intronic
928100380 2:28433845-28433867 TATCACATTCTGAAGTACTGGGG + Intergenic
928303034 2:30143735-30143757 AGTCACATTTTGAGGTACTGGGG + Intergenic
928825968 2:35421351-35421373 AGCCACATTCTGAGGTACTGGGG + Intergenic
929525373 2:42696767-42696789 AGTACCATGGTGAATTGCTGAGG + Intronic
929833879 2:45376041-45376063 AGTCACATTCTGAGGTACTGGGG + Intergenic
929863775 2:45700702-45700724 GGTCACATTCTGAAGTACGGGGG - Intronic
929958536 2:46479149-46479171 GGTCACATTCTGAGGTACTGGGG + Intronic
930000759 2:46860066-46860088 AGTCACATTGTGAAGTACTGGGG - Intergenic
930217595 2:48712730-48712752 AGGCACAGCGTTAAGTACTGAGG + Intronic
930397238 2:50838498-50838520 GGTCACATTCTGAAGTTCTGAGG - Intronic
930560953 2:52959121-52959143 AGTCATATTCTGAAATACTGGGG - Intergenic
930575915 2:53148773-53148795 AGTCACATTCTGAGGTAATGGGG - Intergenic
930805799 2:55488678-55488700 AGTCATATTCTGAGGTACTGGGG - Intergenic
930968154 2:57357890-57357912 CGTCACATCATAAAGTACTGGGG - Intergenic
931163424 2:59719012-59719034 AGTCACATTCTGAGGTACTAGGG + Intergenic
931532844 2:63236082-63236104 AGTCTCCTGGTGAAGTACTTAGG - Intronic
931644845 2:64412489-64412511 AGTCACATTCTGAGGTACTGGGG + Intergenic
931766677 2:65463101-65463123 AGTCACATTCTGAGGTATTGGGG - Intergenic
931986845 2:67750505-67750527 AGTCACATTCTGAGATACTGGGG + Intergenic
932268236 2:70386693-70386715 AGTCACATTCTAAGGTACTGGGG - Intergenic
932314741 2:70772409-70772431 AGTCACATTGTGGAGCACTGGGG - Intergenic
932672309 2:73748864-73748886 AGTCACATACTGAGATACTGTGG - Intergenic
932808241 2:74801231-74801253 AGTCACATTCTGAGGTACTGAGG - Intergenic
932932360 2:76057421-76057443 ATTCACATTCTGAGGTACTGTGG + Intergenic
933265078 2:80172962-80172984 GGTCACATTCTGAAGTCCTGGGG + Intronic
933568069 2:83975814-83975836 AGTCACATTCTGAGATACTGGGG - Intergenic
933648527 2:84831066-84831088 GGTCACATTCTGAGGTACTGGGG - Intronic
933655753 2:84885665-84885687 AGTCACATTCTGAAGCACTAGGG - Intronic
934049286 2:88197028-88197050 AGTCACATTCTGAAGTACTAGGG - Intergenic
934109140 2:88725689-88725711 CATCACATTCTGAAGTACTGAGG + Intronic
934297775 2:91756492-91756514 AGTTACATGCTGAAGTACTTAGG - Intergenic
934575108 2:95395283-95395305 AGTCACATTCTGAGGTACTGGGG - Intergenic
934749825 2:96786489-96786511 AGTCACATGGCCAGGTACGGTGG + Intronic
934886856 2:98032582-98032604 AGTCACATTCTGCAGTACTGAGG + Intergenic
935040009 2:99417111-99417133 AGTCACATGGTGAAGTACTGGGG - Intronic
935052615 2:99536488-99536510 AGTCACATTCTGAGGCACTGGGG + Intergenic
935092581 2:99909950-99909972 TGTCACATTGTGAGGAACTGGGG - Intronic
935293132 2:101626477-101626499 AGTCACATTCTGAGGTACTAGGG + Intergenic
935529868 2:104219119-104219141 AGTCACATTCTGAGATACTGGGG + Intergenic
935603162 2:104943003-104943025 CATCACATTCTGAAGTACTGGGG + Intergenic
935846397 2:107170236-107170258 AGTCACATTCTAAGGTACTGGGG - Intergenic
936150749 2:110020829-110020851 TGTCACATTCTGAGGTACTGGGG - Intergenic
936193927 2:110350540-110350562 TGTCACATTCTGAGGTACTGGGG + Intergenic
936691040 2:114888936-114888958 AGCCACATTCTGAAGTATTGAGG - Intronic
936818485 2:116489239-116489261 AGTCACATTATGAGGTGCTGGGG - Intergenic
937014043 2:118587356-118587378 AGTCACATCCTGAGGTACTAGGG - Intergenic
937122119 2:119447950-119447972 AGTCACATTCTGAGATACTGGGG - Intronic
937510538 2:122590064-122590086 AGTCACATTCTAAGGTACTGGGG - Intergenic
937666154 2:124489497-124489519 AGTCGCATTCTGAGGTACTGGGG + Intronic
937704620 2:124905678-124905700 AGCCACATGGAGAAGTGCTAGGG + Intronic
937888308 2:126915565-126915587 AGTCACATTCTGAGGTCCTGTGG + Intergenic
938103975 2:128517235-128517257 AGTCACATTCTGAGGTCCTGGGG - Intergenic
938105084 2:128524594-128524616 AGTCACATTCGGAAGCACTGGGG - Intergenic
938196544 2:129333903-129333925 AGTCACATCCTGAGGTACTGGGG + Intergenic
938209956 2:129459099-129459121 AGTCACATTCTGAGGTTCTGGGG + Intergenic
938719444 2:134053018-134053040 AGTCACATACTGAGGTACTGGGG + Intergenic
938797552 2:134731107-134731129 AGTCACATTCTGATATACTGGGG - Intergenic
938872896 2:135499848-135499870 GGTCACATTCTGAGGTACTGGGG - Intronic
938933017 2:136103372-136103394 AGTCACATTCTGAGGTACTGGGG + Intergenic
938971026 2:136432510-136432532 AGTCATATTCTGAGGTACTGGGG + Intergenic
939443587 2:142280022-142280044 TGTCACATGCTGAAATACTCAGG + Intergenic
939567634 2:143803321-143803343 AGTCACATTCTGAGGTACTAGGG + Intergenic
939598391 2:144156906-144156928 AGTCACCTGGTAAAGAAGTGTGG - Intronic
939779272 2:146424290-146424312 AGTCACATTCTGAAATACTGGGG + Intergenic
939956772 2:148533946-148533968 AGTCACATTCTGAGGTACTGGGG + Intergenic
940075014 2:149731870-149731892 AGTCACATTCTGAGGTACTGGGG + Intergenic
940157622 2:150675956-150675978 AGTCACATTCTGAGATACTGGGG - Intergenic
940515037 2:154673214-154673236 AGTCACATTCTAAGGTACTGAGG - Intergenic
940564308 2:155340743-155340765 ACTCACATTTTGAAATACTGGGG + Intergenic
941007339 2:160261529-160261551 AGTTACATTATGAAGTACTAGGG + Intronic
941150892 2:161914783-161914805 AGTCACATTCTGAGGTACTGAGG - Intronic
941298041 2:163764831-163764853 AGTCACATTCTGAGGTATTGGGG + Intergenic
941344632 2:164352356-164352378 GGTCACATTGTGAGGTGCTGGGG + Intergenic
941367137 2:164621953-164621975 AGGCACGTGGGGAAGGACTGGGG - Intergenic
941597684 2:167498104-167498126 ACTGACATGTTGAAGAACTGAGG + Intergenic
941874073 2:170415957-170415979 GGTCACATTCTGAGGTACTGGGG - Intronic
941874527 2:170419502-170419524 AGTCACATTCTGAAGTAGTGGGG + Intronic
941897003 2:170639201-170639223 AATCACCTAGTGAACTACTGGGG - Intronic
941984883 2:171500384-171500406 AATCACATTGTGAGGTATTGGGG + Intergenic
942413000 2:175731212-175731234 AGTCACATTCTGAGTTACTGGGG - Intergenic
942483290 2:176412889-176412911 AGTCACATTCTGAGGTAGTGAGG - Intergenic
942513962 2:176732162-176732184 AGTCACATTCTGAAATGCTGAGG + Intergenic
942752570 2:179304374-179304396 AGTCACATTCTGAGGTACTGGGG - Intergenic
943021521 2:182580192-182580214 GGTCACATTCTGAGGTACTGAGG - Intergenic
943055587 2:182974394-182974416 GGTCACATTCTGAGGTACTGGGG - Intronic
943198135 2:184782130-184782152 AGTCACATTTTTAAGTACTTGGG + Intronic
943242173 2:185399344-185399366 AGTAACATTTTGAGGTACTGGGG - Intergenic
943376846 2:187088462-187088484 AGCCACATGGAGGAGAACTGAGG - Intergenic
943465683 2:188226483-188226505 AGTCACATACTGAGGCACTGTGG - Intergenic
943515474 2:188880666-188880688 AGTCACATTCTGAGGTACTGGGG - Intergenic
943533950 2:189123376-189123398 TGTCACATTCTGAAGTACAGAGG - Intronic
943550544 2:189333571-189333593 AGTTACATTTTGAGGTACTGGGG - Intergenic
943635802 2:190305578-190305600 GGTCACATTCTGAGGTACTGGGG + Intronic
943640673 2:190354410-190354432 AGTCCCATTCTGAGGTACTGGGG - Intronic
943651883 2:190466217-190466239 AATCACATTTTGAGGTACTGGGG + Intronic
944260308 2:197668903-197668925 AGTGGGAAGGTGAAGTACTGAGG + Intronic
944285030 2:197939677-197939699 AGTCACATGTTGAGGTACTGGGG + Intronic
944557352 2:200900566-200900588 TGTCACATCCTGAAGTACCGAGG + Intronic
944589870 2:201207254-201207276 AGTCACATATTGAAAAACTGGGG - Intronic
944739766 2:202600515-202600537 AGTCACATTCTGAGGTACTGGGG + Intergenic
944832441 2:203546353-203546375 AGTCACATTCTGAGGTACTAGGG + Intergenic
944864620 2:203848326-203848348 AGTCCCTTGGGGAAGGACTGAGG - Intergenic
944883097 2:204035127-204035149 AGACACAGGGTGAAGTATTCAGG - Intergenic
945175320 2:207037932-207037954 GGTCACATTCTGAGGTACTGGGG - Intergenic
945213349 2:207407160-207407182 AGTCACATTCTGAGGTACAGGGG + Intergenic
945364780 2:208938651-208938673 AGTGACATTCTGAAGTCCTGGGG + Intergenic
945635929 2:212351049-212351071 AATCACATTCTGAGGTACTGGGG - Intronic
945710958 2:213293555-213293577 ACCCACATGGGGAAGAACTGAGG + Intronic
945742896 2:213685194-213685216 AGTCACATTCTGAGGTACTTGGG - Intronic
945943198 2:215970076-215970098 GGTCACATTCTGAGGTACTGGGG - Intronic
946048953 2:216845042-216845064 AGTCACATTCTGAAGTACTGGGG + Intergenic
946120264 2:217505629-217505651 AGTCACATTCTGAGGCACTGGGG - Intronic
946529941 2:220560072-220560094 AGCCACATACTGATGTACTGGGG - Intergenic
946594069 2:221286516-221286538 AGTCACATTCTGAAGTGCTAGGG + Intergenic
946625717 2:221610487-221610509 AGTCACATTATGAGGTACTGGGG + Intergenic
946695600 2:222355304-222355326 AGTCACATTCTGAGGTACTGGGG + Intergenic
946738700 2:222780334-222780356 GGTCACATTCTGAAGTAGTGGGG - Intergenic
946776656 2:223149293-223149315 AGTCACATTCTGAGGTACTGGGG + Intronic
946804234 2:223454103-223454125 AGTCATATTTTAAAGTACTGGGG - Intergenic
947235223 2:227934671-227934693 AATTACATTGTGAGGTACTGGGG - Intergenic
947352472 2:229260956-229260978 AGTCACATGTCGAGGTACTACGG - Intronic
947499634 2:230662502-230662524 AGTCACATTGTGAGGTACTGGGG + Intergenic
947580342 2:231312236-231312258 AGTCACGTGGCGGAGAACTGAGG - Intronic
947813306 2:233018853-233018875 AGTCACATTCTGAAGTACTGGGG + Intergenic
947860159 2:233352926-233352948 AGTCACATGCTGAGGTACTGGGG + Intergenic
947949070 2:234132054-234132076 AGTCACATTCTGAAGTAGTGGGG + Intergenic
948025320 2:234771802-234771824 GGCCACATTCTGAAGTACTGCGG - Intergenic
948030530 2:234814071-234814093 GGTCACATGAGGAAGCACTGGGG + Intergenic
948095660 2:235332237-235332259 AGTCACATTTTGAGGTACTGGGG - Intergenic
948312821 2:237001845-237001867 GGTCACATTCTGAGGTACTGAGG - Intergenic
948524814 2:238564947-238564969 AGTCACACTCTGAGGTACTGAGG - Intergenic
948767250 2:240229244-240229266 ATTCACATTCTGAGGTACTGGGG - Intergenic
1169257076 20:4107701-4107723 AGTCACATTCTGAGGGACTGGGG + Intergenic
1169374286 20:5054087-5054109 AGTTACATTTTGAGGTACTGGGG - Intergenic
1170018857 20:11813474-11813496 AGTTACATTCTGAAGTTCTGGGG - Intergenic
1170102336 20:12716136-12716158 AGTCATATGCTGCGGTACTGGGG - Intergenic
1170252937 20:14305629-14305651 AGGAAAATGGTGAAGTACTGGGG - Intronic
1170360515 20:15541003-15541025 GGTCACATTCTGAGGTACTGTGG + Intronic
1170388987 20:15851609-15851631 AGTCACATTCTGAGATACTGGGG + Intronic
1170404972 20:16026292-16026314 AGTAAAATGGTGGTGTACTGAGG - Intronic
1170475770 20:16713085-16713107 AGTCACATTCTAAAGCACTGGGG - Intergenic
1170753159 20:19170701-19170723 AGTCACATTCTGAGGTACTGGGG - Intergenic
1170771895 20:19340113-19340135 GGTCACATTGTGAGTTACTGGGG - Intronic
1170806159 20:19633755-19633777 AGTCACATTCTGAGGTACTGAGG + Intronic
1171053647 20:21884946-21884968 AGTCACATTCTGAGGTACTGGGG + Intergenic
1171369750 20:24653970-24653992 AGTCACATTCTGAGGTACTGGGG + Intronic
1172506990 20:35470325-35470347 AGTCACATGGGAAACAACTGAGG + Intronic
1172606167 20:36215611-36215633 TGACACGTGGTGAAGGACTGAGG - Intronic
1172960445 20:38795481-38795503 AGTCTCATGCTGAAATACTGGGG + Intergenic
1173068179 20:39735089-39735111 ATTCACATTTTGAAGTACTGGGG - Intergenic
1173076931 20:39828211-39828233 GGTCACATTATGAGGTACTGAGG - Intergenic
1173254536 20:41384802-41384824 AGTCACATTTTGCAGTACTAGGG + Intergenic
1173284258 20:41655990-41656012 AGTCCCATGTTGGAGTATTGAGG - Intergenic
1173292231 20:41725070-41725092 AATCACATTCTGAAGTACTAGGG + Intergenic
1173535828 20:43812562-43812584 GGTCACATTCTGAAGTACTGGGG - Intergenic
1174383263 20:50171201-50171223 AGTAACATTCTGAGGTACTGGGG - Intergenic
1174605250 20:51756707-51756729 AGTCACATTCTGAGGTGCTGGGG + Intronic
1175069873 20:56324346-56324368 AGTCACATTCTGAAGGACAGAGG + Intergenic
1175287720 20:57848876-57848898 TGTCACATTCTGAAGTACTGAGG - Intergenic
1175650571 20:60718332-60718354 AGTCACATACTGAAGTATTGGGG - Intergenic
1176377926 21:6095958-6095980 AGCCACATGGTCATGGACTGGGG - Intergenic
1176896685 21:14386946-14386968 AGTCACATTCTGAGGTACAGGGG - Intergenic
1176927901 21:14772388-14772410 AGTCACATTCTGAAGTACTGGGG + Intergenic
1177172577 21:17670480-17670502 AGTCACATACTGAGGTACTAAGG - Intergenic
1177627509 21:23682799-23682821 AGTCACATTCTGCAGTTCTGGGG + Intergenic
1177932439 21:27301573-27301595 AGTTACATGGGAAAGTACTTAGG - Intergenic
1177966472 21:27734004-27734026 AGTCACTTTCTGAAGTAGTGAGG - Intergenic
1178099887 21:29256285-29256307 AGTCAGATTTTGAAGTATTGTGG - Intronic
1178110184 21:29362637-29362659 GGTCACATTCTGAAGTAGTGGGG - Intronic
1178115550 21:29412809-29412831 AGTCACCTGCTGAGGTACTAAGG - Intronic
1178218524 21:30628293-30628315 ATTCACATGGTTCAGTACCGAGG + Intergenic
1178368207 21:32005261-32005283 AGTCACATTCTGAGGTACTGGGG - Intronic
1178368763 21:32009791-32009813 AGACACATTCTGAAGTACTGGGG - Intronic
1178402186 21:32296265-32296287 AGTCACATTCTGAGATACTGGGG + Intronic
1178492631 21:33062833-33062855 AGTCACATGGTTAATAAATGAGG + Intergenic
1178546305 21:33495676-33495698 AGTCACATTCTAAAGTACTGGGG - Intergenic
1178639217 21:34332783-34332805 AGTCACATGCTGAGTTACTTGGG + Intergenic
1178759856 21:35392090-35392112 AGTCACATTCTGAGGTACTGGGG - Intronic
1178949490 21:36974520-36974542 AGTCCCATTCTGAGGTACTGGGG - Intronic
1179011667 21:37561267-37561289 AGTCACATTATCAGGTACTGGGG + Intergenic
1179014206 21:37581376-37581398 AGTCACATTCTGAGGTACTGGGG - Intergenic
1179047743 21:37861488-37861510 AGTCCCATTCTGAGGTACTGGGG + Intronic
1179083222 21:38192756-38192778 AGTCACATTCTAAGGTACTGGGG + Intronic
1179251604 21:39675367-39675389 AGTCACATTCTGAGGTGCTGGGG + Intergenic
1179364107 21:40739652-40739674 AGTCACATCCCGAGGTACTGGGG + Intronic
1179391691 21:40998253-40998275 GGTCACATTATGAAGTACTGGGG + Intergenic
1179502757 21:41820366-41820388 AGTCACATTGTGAAGTGCCGGGG - Intronic
1179629304 21:42666742-42666764 GGTCATATCGTGAAGTGCTGGGG + Intronic
1179711543 21:43266386-43266408 AGTCACATGCACAAGTTCTGGGG + Intergenic
1179728287 21:43353229-43353251 AGTCACATTCTGAGGTACTGGGG - Intergenic
1179745548 21:43442290-43442312 AGCCACATGGTCATGGACTGGGG + Intergenic
1179991533 21:44950685-44950707 AGTCACATGGTGCCATGCTGAGG + Intronic
1180989798 22:19928664-19928686 AGTCACATTCTGAAGTGCTAGGG - Intronic
1181015661 22:20067005-20067027 AGTCACATTCTGAGGTACTGTGG - Intergenic
1181338316 22:22158200-22158222 GGTCACATTTAGAAGTACTGGGG - Intergenic
1181784375 22:25216225-25216247 GGTCACATTCTGAGGTACTGGGG - Intergenic
1181881144 22:25981181-25981203 AGTTACATTCTGAAGTCCTGGGG + Intronic
1181887311 22:26031574-26031596 AGTCACTTTATGAAGTACTGCGG + Intergenic
1181962798 22:26635049-26635071 AGTCACATTCCGAGGTACTGGGG + Intergenic
1182192140 22:28473252-28473274 AGTTACATTCTGAGGTACTGAGG - Intronic
1182240917 22:28915414-28915436 AGTCACATTTTGAGGTACTGGGG + Intronic
1182670103 22:31988603-31988625 AGTCACATTCTGAGGTATTGTGG - Intergenic
1183101495 22:35586924-35586946 ATCCACATGGTGAGGGACTGAGG + Intergenic
1183128663 22:35811285-35811307 AGTGACATTTTGAGGTACTGAGG - Intronic
1183265999 22:36825839-36825861 AGTCCCATTCTGAGGTACTGGGG - Intergenic
1183338223 22:37263154-37263176 AGTCACATGTGGAGTTACTGGGG - Intergenic
1183433956 22:37782600-37782622 AGTCCCCTCGTAAAGTACTGTGG - Intergenic
1184544339 22:45156302-45156324 AGTCACTTTTTGAGGTACTGGGG - Intergenic
1184605215 22:45569098-45569120 CGTCACATTCTGAGGTACTGGGG + Intronic
1184941840 22:47773760-47773782 GGTCACATTCTGAGGTACTGGGG - Intergenic
1184977064 22:48069869-48069891 GGTCACCATGTGAAGTACTGGGG + Intergenic
1203294224 22_KI270736v1_random:25153-25175 AGTCACATCGTGAGGTACTAGGG + Intergenic
949103720 3:178415-178437 AGTCACATTCTGAGGTTCTGGGG - Intergenic
949128390 3:472785-472807 AGTCACATTCTGAGGTACTTGGG + Intergenic
949398244 3:3637885-3637907 AGTCACATTCTGAGGTACTAGGG + Intergenic
949820625 3:8112081-8112103 AGTTACATGCTGAGGTACTGGGG - Intergenic
950749389 3:15116898-15116920 AGTCACATTCTGAGGTACTGAGG + Intergenic
950775448 3:15346036-15346058 AGACACATGGAGGAGAACTGAGG - Intergenic
950933435 3:16813902-16813924 GGTCACATGGAGGAGAACTGAGG - Intronic
951216998 3:20034610-20034632 AGTCACATTCTGAAGTACTAGGG - Intergenic
951402295 3:22248376-22248398 ACTCACAATGTGAAGCACTGAGG + Intronic
951524862 3:23644067-23644089 AGTCACATTCTGAGGTATTGTGG - Intergenic
951657558 3:25026618-25026640 AATCACATTCTGAAGTACTTAGG + Intergenic
951756704 3:26098684-26098706 GGCCACATGCTGAGGTACTGGGG + Intergenic
951911830 3:27758510-27758532 AGTCACATTCTGAAGTACTGGGG - Intergenic
951927143 3:27920909-27920931 TGTCACATTGTGAGGTACTGGGG - Intergenic
951954296 3:28237850-28237872 AGTCACATTCTGAGGTGCTGGGG - Intergenic
952059048 3:29484529-29484551 AGTCACATTCTGAGGTAGTGAGG + Intronic
952079605 3:29741977-29741999 AGTCACATTCTGAGGTATTGGGG + Intronic
952199857 3:31114844-31114866 AGTCACATTCTGAGGTACTGGGG - Intergenic
952586363 3:34897564-34897586 AGTCACATTCTGACGTTCTGAGG + Intergenic
952749879 3:36816529-36816551 AGTCACATTCTGAGGTACTGGGG - Intergenic
953236672 3:41113200-41113222 GGTCACATTCTGAGGTACTGGGG - Intergenic
953847862 3:46443206-46443228 AGCCACAGGGAGAAGCACTGCGG + Intronic
954123386 3:48514071-48514093 GGTCACATTCTGAAGTACTAGGG + Intergenic
955317694 3:57952530-57952552 AGTCACATTCTCAGGTACTGGGG + Intergenic
955539305 3:59957134-59957156 AGTCACATTGAGAGGTACTGGGG - Intronic
955547667 3:60048512-60048534 GGTCACATTCTGAGGTACTGTGG + Intronic
955849504 3:63204505-63204527 GGTCACATTTTGAGGTACTGGGG + Intergenic
956095457 3:65711560-65711582 ATTCACATTCTGAGGTACTGAGG - Intronic
956142765 3:66162293-66162315 AGTCACATTCTGAGGTCCTGGGG + Intronic
956174523 3:66460441-66460463 AGTCACATGCTGAGGTACTAGGG - Intronic
956568784 3:70670671-70670693 GGTCATATTCTGAAGTACTGAGG + Intergenic
956608759 3:71100530-71100552 AGTCACATGGTGGAGAACTTAGG + Intronic
956733582 3:72218487-72218509 AGTGACATTCTGAGGTACTGGGG + Intergenic
956932761 3:74064147-74064169 CGTCACATTCTGAAGTACTGGGG + Intergenic
957319546 3:78611706-78611728 AGTCACATTCTGAGGTACTGGGG - Intronic
957668662 3:83270995-83271017 AGTCACATTCTGAAGTACTGGGG + Intergenic
957980057 3:87497427-87497449 AATCACATTCTGAAGTACTAGGG - Intergenic
958092953 3:88901037-88901059 AGTCACATTCTGAGGTATTGGGG - Intergenic
958179267 3:90037100-90037122 AGTCACATTCTGAAGCACTGGGG - Intergenic
958432305 3:94056693-94056715 AGTCACATTCTGAGGTACTGGGG + Intronic
958469112 3:94496119-94496141 AGTCACATTCTGAGGCACTGGGG - Intergenic
958862296 3:99458525-99458547 GGTCAAATTTTGAAGTACTGTGG - Intergenic
959354987 3:105314736-105314758 AGTCACATTCTGAGGTACTGGGG + Intergenic
959497989 3:107073404-107073426 GGTCACATTCTGAAGTACCGGGG + Intergenic
959650243 3:108744251-108744273 AGCCACACGGAGAAGCACTGGGG - Intronic
959684572 3:109130442-109130464 AGTCACAATCTGAGGTACTGAGG - Intergenic
959713928 3:109412574-109412596 AGTTACCTTGTGAGGTACTGGGG + Intergenic
959731913 3:109613732-109613754 AGTCACATTCTGAGGTACTAGGG - Intergenic
959747357 3:109792261-109792283 AGTCACATTCTGAGGTACTTGGG - Intergenic
960066967 3:113384451-113384473 AGTCACATTCTGAAGTATTGAGG - Intronic
960151118 3:114249865-114249887 AGTCACATTCTGAAGTGCTAGGG - Intergenic
960240661 3:115338217-115338239 GGTCACATTCTGAGGTACTGGGG - Intergenic
960321731 3:116245043-116245065 AGTCACATTCTGAGCTACTGAGG - Intronic
960393245 3:117105028-117105050 AGTCTCATGCTGAAGTACTGGGG - Intronic
960492202 3:118331826-118331848 AGTCACATGGTGATATAGTTTGG + Intergenic
960599843 3:119445639-119445661 ACACACATGCTGAAGTATTGAGG + Intronic
960617153 3:119606425-119606447 AGTCACATTCTGAAGTATTGGGG + Intronic
960648589 3:119919808-119919830 AGCCACATGATGAAGTAATATGG + Intronic
960670787 3:120153910-120153932 AGTCACGTTCTGAGGTACTGGGG - Intergenic
960725177 3:120662837-120662859 AGTCACATTCTGAAATACAGGGG - Intronic
960843218 3:121981376-121981398 AGTTACATTCTGAGGTACTGAGG - Intergenic
960877390 3:122310818-122310840 GGTCACACTGTGAGGTACTGTGG + Intergenic
961100222 3:124192120-124192142 AGTTACATTTTGAGGTACTGGGG - Intronic
961327911 3:126120969-126120991 GGCCACATTGTGAGGTACTGGGG - Intronic
961341652 3:126227152-126227174 GGTCACATTCTGAGGTACTGGGG - Intergenic
961392576 3:126563254-126563276 AGTGATATGGTGAGGTGCTGGGG - Intergenic
961884261 3:130085636-130085658 TGTCACATTTTGAGGTACTGGGG + Intronic
961909998 3:130304604-130304626 AATAACATGGTGAAGAATTGAGG + Intergenic
961993681 3:131218597-131218619 AGTCACATTCTGAAGTACTGGGG - Intronic
962186683 3:133267773-133267795 ACACACATGGTAAAGAACTGAGG - Intronic
962215464 3:133517107-133517129 AGTCACATTCTGAGGTACTCGGG + Intergenic
962293850 3:134162196-134162218 GGTCACATTCTGAGGTACTGGGG + Intronic
962593965 3:136920984-136921006 AGTCACATTATGAACTACTGGGG - Intronic
962607958 3:137048431-137048453 GGTCACATTCTGAAGTACTGGGG - Intergenic
962755602 3:138463481-138463503 ATTCCCATAGTGAAGTACTTTGG - Intronic
962896015 3:139715480-139715502 AGTCAGATTCTGAGGTACTGGGG - Intergenic
962910719 3:139847160-139847182 AGTGATATTCTGAAGTACTGGGG - Intergenic
962940131 3:140117988-140118010 AATCACATCCTGAGGTACTGGGG - Intronic
963296372 3:143550951-143550973 AGTCACATTTTGAGCTACTGGGG - Intronic
963681094 3:148377968-148377990 AGTCACTTAGCCAAGTACTGAGG - Intergenic
963775448 3:149434458-149434480 AGCCACATGGAGGAGAACTGAGG + Intergenic
964008205 3:151856686-151856708 AATCACATTCTGATGTACTGGGG + Intergenic
964071670 3:152642041-152642063 AGTCACATTCTGAAGTACTAGGG - Intergenic
964111891 3:153096519-153096541 AGTCACATTCTGAGGTACAGGGG - Intergenic
964121750 3:153192430-153192452 AGTCACATTCTGAAGTACTGAGG - Intergenic
964276797 3:155017243-155017265 AGTCACATTCTGAGTTACTGGGG + Intergenic
964316100 3:155445706-155445728 GGTCACATTCTGAGGTACTGAGG + Intronic
964368457 3:155973689-155973711 AGTCACATTTTGTGGTACTGGGG + Intergenic
964399925 3:156288279-156288301 AATCACATTCTGAGGTACTGGGG + Intronic
964473152 3:157075275-157075297 GTTCACATTCTGAAGTACTGAGG + Intergenic
964532399 3:157682659-157682681 AGTCACATCCTGAGGTACTAGGG + Intergenic
964738072 3:159936547-159936569 ACTCAGATGGTGAACAACTGGGG - Intergenic
964795056 3:160487963-160487985 GGTCACATTCTGAGGTACTGGGG + Intergenic
964881401 3:161427325-161427347 GGTCACATTCTAAAGTACTGGGG - Intergenic
965045828 3:163575855-163575877 AGTCACAATCTGAGGTACTGGGG + Intergenic
965048987 3:163619463-163619485 AGTCACATTCTGAGGTACTCGGG + Intergenic
965410166 3:168320369-168320391 GGTCACATTCTGAGGTACTGGGG - Intergenic
965458721 3:168934110-168934132 AGTCACATTCTGAAGTACTGGGG + Intergenic
965554146 3:170002304-170002326 AGTTAGATGGTGAAGGATTGCGG + Intergenic
965806574 3:172548346-172548368 AGTCACATTCTGAGATACTGGGG - Intergenic
965836616 3:172860354-172860376 AGCCACATTCTGAGGTACTGAGG - Intergenic
966041712 3:175498792-175498814 AGTCACATTCTGGGGTACTGTGG - Intronic
966107662 3:176356677-176356699 AGTCACATTCTGAGGTACTGAGG + Intergenic
966220161 3:177543928-177543950 AGTCCCATTCTGAACTACTGGGG + Intergenic
966403205 3:179567420-179567442 AGTCACATTCTGAGGTACTAGGG + Intronic
966552685 3:181222708-181222730 GGTCACATTCTGAGGTACTGGGG - Intergenic
966611260 3:181870046-181870068 AGATACATGCTGAAGTACTTAGG - Intergenic
966622413 3:181980300-181980322 AGTCACATTCTGAGGTACTGGGG - Intergenic
966655877 3:182358345-182358367 AGTCACATTCTGGGGTACTGGGG - Intergenic
967070491 3:185958457-185958479 GGTCACATTCTGAGGTACTGGGG + Intergenic
967226390 3:187295664-187295686 AGTCACCTTCTGAAGTACTGAGG - Intergenic
967556507 3:190864478-190864500 AGTCACCTTGTTAAGTGCTGTGG - Intronic
967759363 3:193206152-193206174 GCTCACATGGGGAAGCACTGAGG + Intergenic
967817057 3:193808544-193808566 AGTCACATGCACAAGTCCTGGGG + Intergenic
967964452 3:194950038-194950060 AGCCACATTCTGAGGTACTGAGG + Intergenic
968280158 3:197471117-197471139 AGTCACATTCTTAAGTACTGGGG + Intergenic
968319968 3:197757733-197757755 AGTCTCATGCTGGAGTGCTGTGG - Intronic
968607942 4:1544401-1544423 AGTCACATTCTGAGGTGCTGGGG - Intergenic
968672775 4:1861049-1861071 ACCCACATGGGGAAGAACTGAGG + Intergenic
968681938 4:1927125-1927147 GGCCACATGGTGAAGGACCGAGG - Intronic
969145894 4:5123764-5123786 AGTCACATTCTGAGGTACTGGGG + Intronic
969277406 4:6145941-6145963 TGTCACATTCTGAGGTACTGAGG + Intronic
969322732 4:6422779-6422801 AGTCACATTCTGAGGTGCTGGGG + Intronic
969343029 4:6554117-6554139 GGTCACATGCTGAGGTATTGTGG - Intronic
969348762 4:6585807-6585829 AGTCACATGGCGAGGAACTGAGG - Intronic
969437544 4:7197291-7197313 AGTCACATTTTGAAGTGCTAAGG + Intronic
969577218 4:8043458-8043480 AGTCACATTCTGAGGTCCTGAGG - Intronic
969597081 4:8155613-8155635 AGTCACATCCTGGAGTACTGGGG - Intronic
969859490 4:10024315-10024337 AGTCACATTGTCAGGTACTTGGG - Intronic
970207645 4:13671055-13671077 AGTCACATTCTGAGGTACTGGGG + Intergenic
970306654 4:14739531-14739553 AGTCACATCCTGAGGTACTGTGG + Intergenic
970316983 4:14838662-14838684 AGTCACATTCTGAGGTACTGGGG - Intergenic
970323421 4:14898200-14898222 GGTCACATTCTGAGGTACTGAGG + Intergenic
970417212 4:15871204-15871226 AGTCACATTCTGAGGTACTGGGG - Intergenic
970438873 4:16062302-16062324 AGTCACATCCTGAGGTACTTCGG + Intronic
970639661 4:18050149-18050171 TGTCACATTCTGAGGTACTGGGG + Intergenic
970656486 4:18236159-18236181 GGTCACATTCTGAGGTACTGGGG - Intergenic
970739111 4:19212076-19212098 AGTCACATTCTGAGGTACTGGGG + Intergenic
970786457 4:19803244-19803266 AGCCACATTGTGAGCTACTGGGG + Intergenic
970878979 4:20905926-20905948 AGTCGCATTCTGAGGTACTGGGG + Intronic
970914445 4:21316276-21316298 AGGCACATGGATAAGTACTGAGG - Intronic
971022482 4:22551194-22551216 AGTCACATTCTGAGGTACTGGGG + Intergenic
971259946 4:25047011-25047033 AGTCACATTTTGATGTACTGGGG + Intergenic
971493352 4:27237701-27237723 AGTCACATTCTGATGTACTGGGG - Intergenic
972238492 4:37162090-37162112 AGTCACATTCTGAGGTACTAGGG + Intergenic
972523895 4:39889067-39889089 AGTCACATTCTGAGATACTGGGG - Intronic
972598010 4:40547248-40547270 AGTCACATTGTGAGATACTAGGG - Intronic
973087314 4:46081725-46081747 AGTCACATTCTGAAGTTCTCGGG - Intronic
973177676 4:47228014-47228036 AGTCACATACTGAAGTACTGAGG + Intronic
973362969 4:49182002-49182024 AGTTACATGCTGAGGGACTGTGG - Intergenic
973724936 4:53765684-53765706 AGTCTCATTTTGAGGTACTGGGG - Intronic
973957360 4:56076048-56076070 AGTCACATTCTGAGGTACTTGGG - Intergenic
974012099 4:56616375-56616397 AGTCACGTTCTGAGGTACTGGGG + Intergenic
974157351 4:58091628-58091650 AGTCACATTGTGTAGTACTGGGG - Intergenic
974323872 4:60388907-60388929 AGTCACATTCTGAGGTAGTGGGG - Intergenic
974361764 4:60890060-60890082 AGTCACATTCTGAGGCACTGAGG - Intergenic
974655612 4:64816382-64816404 GTTCACATGGTGAGGAACTGAGG + Intergenic
974655854 4:64820846-64820868 ATTCACATGTTGAAGTAAGGGGG - Intergenic
975344137 4:73274899-73274921 AGTCACATGGTGAATATGTGAGG + Intergenic
975396292 4:73877718-73877740 GGTCACATTCTGAAGTACTGGGG - Intergenic
975413072 4:74077627-74077649 GGTCACATTCTGATGTACTGGGG + Intergenic
975546795 4:75568529-75568551 AGTCACATGGTGAAGTATTGAGG + Intergenic
975610372 4:76196881-76196903 AGGCACATTGTGAGGTATTGGGG - Intronic
975804470 4:78097798-78097820 AGACACATTCTGAAGTACTAAGG - Intronic
975839657 4:78459966-78459988 AGTTACATTCTGAAATACTGGGG + Intronic
975923502 4:79421383-79421405 AGTCACATTCTGAGGTACTAAGG + Intergenic
976112260 4:81688572-81688594 AGCCACATTCTGAAGTACTAGGG - Intronic
976221967 4:82763165-82763187 AGTCACATTCTGAGGTACTGAGG - Intronic
976245261 4:83000849-83000871 AGTCCCAGGGTGAAGTGCAGTGG + Intronic
976281177 4:83328480-83328502 AGTCACATTCTGAGGTACTGGGG + Intronic
976285328 4:83365505-83365527 AGTCACCTTCTGAGGTACTGGGG + Intergenic
976304069 4:83542023-83542045 AGTCACATTCTGAGGTACTGGGG + Intronic
976663857 4:87569213-87569235 AGACACATTTTAAAGTACTGAGG + Intergenic
977094869 4:92728464-92728486 ACCCACGTGGTGAAGGACTGAGG - Intronic
977165424 4:93688945-93688967 AGTCATATTCTGAAGTACTAAGG - Intronic
977303869 4:95299087-95299109 AGTCACATCCTGAGGAACTGAGG - Intronic
977504476 4:97884303-97884325 AGTCACATTTTGAGGTACTGAGG - Intronic
977784468 4:101016603-101016625 GGTCACATTGTGAGGTACTGGGG + Intergenic
977886087 4:102253111-102253133 GGTCACATTCTGAAATACTGGGG + Intronic
977895558 4:102360991-102361013 AGTCACATTCTGAGGTACTGGGG - Intronic
977907564 4:102496295-102496317 AGTTACATTCTGAGGTACTGGGG - Intergenic
978524533 4:109652212-109652234 AGTCACATTCTGAGGTACTAGGG + Intronic
978580834 4:110229628-110229650 AGTCACATTCTGAGGTAATGGGG + Intergenic
978630427 4:110737932-110737954 GGTCACATTCTGGAGTACTGGGG - Intergenic
978683196 4:111408328-111408350 GGTCACATGCTGAGGTACTGGGG + Intergenic
978738107 4:112107260-112107282 GGTCACATTTTGAAGTATTGGGG - Intergenic
978817718 4:112928522-112928544 AGCCACATTCTAAAGTACTGAGG - Intronic
979033425 4:115680459-115680481 GGTCACATTTTAAAGTACTGAGG - Intergenic
979092654 4:116505058-116505080 AGTCACATTCTGAAGTCCTAAGG + Intergenic
979568964 4:122193184-122193206 AGTCACATTCTGAGGTACTGGGG + Intronic
979597334 4:122548646-122548668 GGTCACATTCTGAAGTACTGGGG - Intergenic
979611351 4:122692126-122692148 GGTCACATTCTGAGGTACTGGGG - Intergenic
980005304 4:127535301-127535323 AGTCACATTTTGAAGTACTAGGG + Intergenic
980111162 4:128638541-128638563 AGTCACTTTCTGAAGTACTGGGG - Intergenic
980133977 4:128842835-128842857 GGTCTCATGGTGCAGTGCTGAGG + Intronic
980214086 4:129828640-129828662 AGTCATATTCTGAGGTACTGGGG + Intergenic
980511878 4:133802193-133802215 AGTCACATTCTGAGGTACTGGGG + Intergenic
980598247 4:134984761-134984783 AGTCACATTCTAAGGTACTGGGG - Intergenic
980619831 4:135286370-135286392 AGTTACTTTCTGAAGTACTGAGG - Intergenic
980764682 4:137286468-137286490 AGTCACATTTTGAAGTACTGTGG + Intergenic
981160105 4:141487611-141487633 AGTCACATTCTGAGGTACGGGGG + Intergenic
981220007 4:142220980-142221002 AGTCACATTCTGTAGTACTGGGG + Intronic
981444450 4:144819457-144819479 AGTCACATTCTGAGGGACTGAGG + Intergenic
981682509 4:147415880-147415902 AGTTACATTTTGAAGTACTGGGG - Intergenic
981734794 4:147937414-147937436 AGTCACATTTGGAAGTACTGAGG + Intronic
981837977 4:149077514-149077536 AGTCACATTCCGAGGTACTGGGG + Intergenic
982260378 4:153489050-153489072 GGTCACATTCTGAGGTACTGGGG + Intronic
982693090 4:158570379-158570401 ACTCACATGGTGAAGCTCTTGGG + Intronic
982984304 4:162185781-162185803 AGTCAAATTCTGAAGTACTGGGG + Intergenic
983089178 4:163484100-163484122 GGTCACATTCTGAGGTACTGGGG + Intergenic
983259837 4:165443721-165443743 AGTCACATGCTGAGGTACTGGGG + Intronic
983394412 4:167175494-167175516 GGTCACACTCTGAAGTACTGGGG - Intronic
983437677 4:167735630-167735652 AGTCACATTTTGAAGTATTGGGG - Intergenic
983500579 4:168494883-168494905 AGTCTCATGGTGAATTCCAGAGG - Intronic
983781208 4:171672972-171672994 AGTCACATTCTGAGGAACTGTGG + Intergenic
983819210 4:172172067-172172089 AGTCACATTCTGAGGTACTGGGG - Intronic
983927144 4:173414490-173414512 GGCCACATGGTGACGTACAGGGG + Intergenic
983984927 4:174047424-174047446 AGTCACATTCTGAGGTACTGTGG - Intergenic
984058692 4:174964127-174964149 AGTCACATTCTCAAGTACTGGGG - Intronic
984271260 4:177551205-177551227 AGTCACATTCTGAGATACTGGGG - Intergenic
984449509 4:179881719-179881741 AGTCACCTTCTGAGGTACTGGGG - Intergenic
984730786 4:183066266-183066288 AGTCCCATTCTGAGGTACTGGGG - Intergenic
984934804 4:184880776-184880798 GGTCACATTCTGAGGTACTGGGG + Intergenic
985249133 4:188005569-188005591 AGTCACATTCTGAGGTACTGAGG + Intergenic
985899516 5:2777801-2777823 AGTCCCATTCTAAAGTACTGGGG - Intergenic
986030053 5:3885046-3885068 AGTCACATTCTGAGGTACTTGGG + Intergenic
986053185 5:4109179-4109201 GGTCACATCCTGAGGTACTGGGG + Intergenic
986074211 5:4318017-4318039 AGTCCCATTCTGAGGTACTGGGG - Intergenic
986123297 5:4863185-4863207 GGTCACATTCTGAGGTACTGGGG - Intergenic
986455875 5:7917449-7917471 AGCCACATTCTGAAGTACCGGGG + Intergenic
986576569 5:9219446-9219468 AGTTACATTCTGGAGTACTGGGG - Intronic
986643477 5:9893995-9894017 AGTTACATTCTGAGGTACTGGGG - Intergenic
986716592 5:10528729-10528751 AGTCACATACTGAGGTACTGGGG - Intergenic
986766211 5:10930625-10930647 AGTCACATTGACAAGTACTGGGG + Intergenic
986769220 5:10956683-10956705 GGTCACATTCTGAACTACTGTGG + Intergenic
986803112 5:11281862-11281884 AGTCATATTCTGAGGTACTGGGG + Intronic
986808284 5:11329493-11329515 AGTCACATTCTGAGGTACTGGGG + Intronic
986853866 5:11845379-11845401 AGTCATATTCTGAGGTACTGGGG - Intronic
986860619 5:11922722-11922744 AGTCACATTCTGAGGAACTGAGG - Intergenic
986980113 5:13437594-13437616 AGTCACATTATGGGGTACTGGGG + Intergenic
987081819 5:14431993-14432015 AGTCACATTCTGAGATACTGGGG + Intronic
987117276 5:14735829-14735851 GGTCACATTCTGAGGTACTGGGG + Intronic
987207248 5:15640488-15640510 GGTCACATTCTGAGGTACTGGGG + Intronic
987253388 5:16123190-16123212 AGCCACATTGTAAAGTACCGGGG - Intronic
987313439 5:16701977-16701999 AGTCACATTCTGCAGTATTGGGG - Intronic
987362869 5:17122421-17122443 GGTCACATTTTGAGGTACTGGGG - Intronic
987393370 5:17397818-17397840 GGTCACATTTTGAAGTACAGGGG - Intergenic
987575867 5:19727221-19727243 GGTCACATTCTGAGGTACTGGGG - Intronic
987841097 5:23223589-23223611 GGTCCCATTCTGAAGTACTGGGG - Intergenic
987869551 5:23597516-23597538 AGTCACATTCTGAGGTAGTGAGG - Intergenic
988075268 5:26344220-26344242 AGTCACATTCTGAGATACTGGGG + Intergenic
988241072 5:28609870-28609892 GGTCACATCTTGAAGTAATGAGG - Intergenic
988274299 5:29060527-29060549 AGACACATTCTGAGGTACTGGGG + Intergenic
988351093 5:30107948-30107970 GGTCACATTCTGAAGTACTAAGG + Intergenic
988451762 5:31351015-31351037 AGTCACATGCTGAGGCACTGGGG - Intergenic
988602221 5:32650337-32650359 AGTCACACAGGGAAATACTGAGG - Intergenic
988739880 5:34059749-34059771 AGTCATATGCTGAGGTGCTGGGG + Intronic
989002032 5:36771130-36771152 AGTCACAATCTGAGGTACTGGGG + Intergenic
989294136 5:39804160-39804182 AGTCACATTCTAAGGTACTGGGG + Intergenic
989492489 5:42073996-42074018 AGTCACATTCTGAGGTACTTGGG + Intergenic
990063928 5:51688756-51688778 AGTCACACTCTGAGGTACTGAGG - Intergenic
990388962 5:55299097-55299119 AGTTATTTGGTGAAGTATTGGGG - Intronic
990442530 5:55861082-55861104 AATCACATTTTGAGGTACTGGGG + Intronic
990495001 5:56338421-56338443 AGTCACATTCTGAGGTACCGGGG + Intergenic
990575061 5:57116174-57116196 AGTCGCATTCTGAGGTACTGGGG + Intergenic
990640832 5:57781791-57781813 GGTCACATCTTGAGGTACTGGGG + Intergenic
990842169 5:60094481-60094503 AATCACATTCTAAAGTACTGGGG - Intronic
991043029 5:62194970-62194992 AGTCACATTCTGAGGTACCGGGG + Intergenic
991047933 5:62242456-62242478 GGTCACATTCTGAGGTACTGGGG + Intergenic
991207932 5:64071318-64071340 AGACACATGCTGAGGTACTGCGG - Intergenic
991492257 5:67194855-67194877 AGTCACATTCTGAGGTCCTGTGG - Intronic
991569995 5:68043760-68043782 AGTCACATTCTGAGGTACTGGGG - Intergenic
991570095 5:68044762-68044784 AGTCACATTCTGAGGTACTGGGG + Intergenic
992179340 5:74181620-74181642 AGTCACATTCTGAGGTACTGAGG - Intergenic
992263345 5:74992545-74992567 GGTCACAGGCTGAGGTACTGGGG + Intergenic
992523980 5:77587664-77587686 AATCACATTCTGAGGTACTGGGG - Intronic
992727274 5:79620724-79620746 AGTCACATTCTGAGCTACTGGGG + Intronic
993441506 5:87962349-87962371 GGTCACATTCTGAGGTACTGGGG + Intergenic
993687573 5:90958804-90958826 AGTTACATACTGAAGTACTGGGG + Intronic
993732361 5:91437575-91437597 AGTCACATTCTGAGGTAGTGGGG + Intergenic
993804808 5:92392553-92392575 AGCCACATTGTGAAGAATTGTGG + Intergenic
994030023 5:95130813-95130835 AGTCACATTCTGAAGTGCTGGGG + Intronic
994300724 5:98143849-98143871 GGTCACATTCTAAAGTACTGAGG + Intergenic
994475080 5:100257263-100257285 AGTTACATTTTGAAGTACTGGGG + Intergenic
994787548 5:104183434-104183456 GGTCACATTCTGAGGTACTGAGG + Intergenic
995016704 5:107318148-107318170 AGTCACATTCTGAAATACTGGGG - Intergenic
995419009 5:111941580-111941602 AGTCACATTCTGAAGTATTAGGG + Intronic
996104692 5:119486085-119486107 AGCCACATGGTGAGAAACTGAGG - Intronic
996371482 5:122757801-122757823 TGTCACATTGTGAGGAACTGGGG - Intergenic
996436542 5:123439378-123439400 AGTCACATTCTGAGGTTCTGGGG - Intergenic
996581535 5:125037077-125037099 AGTCCCATGGTTAGGGACTGAGG - Intergenic
996620539 5:125496704-125496726 AGTCATATTCTGAGGTACTGGGG - Intergenic
997444248 5:133929764-133929786 AGTCACATTCTGAAATAATGGGG + Intergenic
997483009 5:134203642-134203664 AGTCACATTCTGAGGTGCTGTGG + Intronic
998513063 5:142729704-142729726 GGTCACATTCTGAAGTACTAGGG + Intergenic
998733882 5:145112460-145112482 AGTCACATATTGAAGTACTAGGG + Intergenic
999070012 5:148734601-148734623 AATCATATTCTGAAGTACTGGGG - Intergenic
999115998 5:149163709-149163731 AGTCATATTCTGAGGTACTGAGG + Intronic
999844837 5:155468291-155468313 ATTTACATTATGAAGTACTGTGG + Intergenic
1000017349 5:157289718-157289740 AGTCACATTCTGAGGTCCTGTGG + Intronic
1000028459 5:157380760-157380782 ATTCACATGGTGAATTACATTGG - Intronic
1000201160 5:159012446-159012468 AGTCACATTCTGAGGTACTGGGG - Intronic
1000225409 5:159256417-159256439 AGTTACATGGGGCAGTAATGAGG + Intergenic
1000238812 5:159389975-159389997 AGTCATATTCTGAGGTACTGGGG - Intergenic
1000346468 5:160318422-160318444 GGTCACATTGTGAGCTACTGAGG + Intronic
1000356568 5:160401840-160401862 AGTCAAATTGTCAAGTACTTTGG - Exonic
1000424793 5:161077808-161077830 AGTCACATTCTGAGGTATTGGGG + Intergenic
1000467623 5:161599735-161599757 AGTCACATTCTGAGGTACTGGGG - Intronic
1000471046 5:161642364-161642386 AGTCACATTATGAGGTACTTGGG + Intronic
1000749566 5:165076880-165076902 AGTCAGCTGCTAAAGTACTGGGG + Intergenic
1000798971 5:165700808-165700830 AGTCACATGCTGTGATACTGAGG - Intergenic
1001056211 5:168452315-168452337 AGTCACATTCTGAGGTACTAGGG - Intronic
1001179164 5:169502618-169502640 AGTCACATTCAGAGGTACTGAGG - Intergenic
1001581673 5:172802726-172802748 ATTCACATACTGAAGTATTGGGG - Intergenic
1001665002 5:173425391-173425413 AGTCACATTCTGAGGTCCTGGGG + Intergenic
1001756659 5:174175530-174175552 AGTCACATTCTGAAGTCCTGAGG + Intronic
1001773698 5:174313426-174313448 AGTCACATTCTGAGGTACTAGGG + Intergenic
1002702629 5:181136357-181136379 AGTCACATTTGGAGGTACTGAGG - Intergenic
1002911834 6:1496756-1496778 AGTTACATTCTGAGGTACTGGGG + Intergenic
1002959093 6:1897355-1897377 GGTCACATTCTGAGGTACTGGGG + Intronic
1003136791 6:3440297-3440319 AGTCACATTCTGAGGTCCTGGGG - Intronic
1003197895 6:3931107-3931129 TGTCAAATGGAGAAGCACTGGGG + Intergenic
1003272151 6:4616749-4616771 GGTCACATTCTGAGGTACTGAGG + Intergenic
1003428981 6:6021864-6021886 GGTCACATTCTGAGGTACTGGGG - Intergenic
1003466009 6:6380737-6380759 AGTCACATTCTGAGGTACTGGGG - Intergenic
1003617485 6:7668736-7668758 AGTCACATTCTGAAGTTCTAGGG - Intergenic
1003862505 6:10335402-10335424 AGTCACATTCTGAGGTACTGGGG - Intergenic
1003991043 6:11486846-11486868 AGTCACATTCTGAAGAACTGGGG + Intergenic
1004184717 6:13412182-13412204 AGTCACATTCTGAGGTACTGGGG - Intronic
1004299834 6:14447183-14447205 AGTCACATTTTGAGGCACTGGGG + Intergenic
1004308367 6:14521652-14521674 AGTCACATTCTGAAGTACTGAGG - Intergenic
1004393978 6:15232240-15232262 AGTCATATTCTGAGGTACTGGGG + Intergenic
1004404859 6:15323536-15323558 AGTCACATACTGAGGTACTAGGG + Intronic
1004456148 6:15793147-15793169 AGTCACATTCTGAGGTACTGGGG + Intergenic
1004637465 6:17482828-17482850 GGTCACATTCTGAAGTACTTAGG + Intronic
1004715834 6:18215599-18215621 AGTCACATTCTGAGGCACTGAGG + Intronic
1004816378 6:19315809-19315831 AGTCACATTCTGAGGCACTGGGG - Intergenic
1004890311 6:20095019-20095041 ATTCACATTCTGAAGTCCTGGGG - Intergenic
1004985241 6:21074422-21074444 GGTAACATTCTGAAGTACTGGGG + Intronic
1005085946 6:22006774-22006796 AGTCACATTCTGAGGTTCTGAGG - Intergenic
1005146387 6:22695318-22695340 AGTCACATTCTGAGGTTCTGAGG + Intergenic
1005273040 6:24186836-24186858 AGTCACTTTATGAGGTACTGGGG - Intronic
1005351300 6:24938076-24938098 GGTCACATTCTGAGGTACTGGGG - Intronic
1005806349 6:29477369-29477391 AGTCACATTCTGAAGTATTAGGG - Intergenic
1005810617 6:29512683-29512705 AGTCACATTCTGAGATACTGGGG - Intergenic
1006868672 6:37230428-37230450 AGTCACATTCTGCAGTGCTGCGG - Intronic
1007655214 6:43447531-43447553 AGGGACATGGTGAAGAATTGTGG - Intronic
1007765635 6:44158282-44158304 GGTCACATTCTGAAGTACTGGGG - Intergenic
1008006104 6:46410981-46411003 GGTCACATGGTGAAGAAATGGGG - Intronic
1008085012 6:47235285-47235307 AGTCGCATTCTGAAGTACTGGGG - Intronic
1008262499 6:49384374-49384396 AGTCACATTCTAAAGTACTGGGG - Intergenic
1008331342 6:50248086-50248108 AGTCACATTCTGAGGTATTGGGG - Intergenic
1008972370 6:57384488-57384510 GGTCACATTCTGAGGTACTGGGG + Intronic
1009161280 6:60286012-60286034 GGTCACATTCTGAGGTACTGGGG + Intergenic
1009288315 6:61851420-61851442 AGTCACATTGTAAGGTACTGGGG - Intronic
1009390559 6:63138827-63138849 AGTGACATTCTGAAGTACTGAGG + Intergenic
1009413033 6:63388392-63388414 GGTCACACTCTGAAGTACTGAGG - Intergenic
1009422954 6:63483894-63483916 AGTCACATTCTGAGGTACTAGGG + Intergenic
1009467088 6:63985023-63985045 AGTCACATTCTGAGGTACTAGGG - Intronic
1009555050 6:65152348-65152370 AGTCACATTTTGAGGTACTAGGG - Intronic
1009612927 6:65970111-65970133 AGTTACATTCTGAGGTACTGGGG - Intergenic
1009786452 6:68346349-68346371 AATCACATCCTGAGGTACTGAGG - Intergenic
1010002500 6:70961995-70962017 GGTCACATTCTGAGGTACTGGGG - Intergenic
1010101454 6:72112776-72112798 TTTCACAGGGTGAAGTACTGTGG - Intronic
1010121565 6:72381336-72381358 AGTCACATTCTGAGGTACAGTGG + Intronic
1010211537 6:73366210-73366232 AGTCATATTCTGAGGTACTGGGG + Intergenic
1010277510 6:73986915-73986937 AGTCACATTCTGAAGTACTGGGG - Intergenic
1010380865 6:75223386-75223408 AGTCACATCCTGAGGTACTGGGG + Intergenic
1011204429 6:84876462-84876484 AGTAACATTCTGAGGTACTGGGG + Intergenic
1011314249 6:86014263-86014285 AGTCATATTCTGAGGTACTGGGG - Intergenic
1011345483 6:86365344-86365366 AGTCACATTCTGAGGTATTGGGG + Intergenic
1011670574 6:89679472-89679494 AGTCACATTCTGAAGTTCTAGGG - Intronic
1011879589 6:92008003-92008025 AGTCACATTCTGGAATACTGGGG + Intergenic
1011885648 6:92091809-92091831 AGTCACATTCTGAGGTACAGAGG - Intergenic
1012024551 6:93972174-93972196 AGTCACATTCTGAGGTACTGGGG + Intergenic
1012167431 6:95975384-95975406 AGTCACATTGCAAAGTAGTGGGG - Intergenic
1012405595 6:98893547-98893569 AGTCACATTCTTAGGTACTGGGG + Intronic
1012777563 6:103517007-103517029 AGTCACATTCTGAAGTTCTGGGG - Intergenic
1013140561 6:107329633-107329655 GGTCACATTGTGAGGTACTAGGG + Intronic
1013147952 6:107413494-107413516 TGTCACCAGGTGAAGTACAGTGG - Intronic
1013320408 6:108982438-108982460 ATTCACATGTTGAAGCCCTGTGG - Intergenic
1013538021 6:111081239-111081261 AGTCACATTCTGAGGCACTGGGG + Intergenic
1013610622 6:111791418-111791440 AGTCAGATGCTGAGGTACTTGGG - Intronic
1013635565 6:112026245-112026267 AGTCACATTCTAAGGTACTGAGG + Intergenic
1013709352 6:112879612-112879634 AGTCACATTCTAAAGTACTGGGG - Intergenic
1013794227 6:113867651-113867673 AGTCACATTCTGAGGTACTGGGG - Intergenic
1013799281 6:113922544-113922566 AATCACATTCTGAGGTACTGGGG - Intergenic
1014153683 6:118087356-118087378 AGTCACATTCTGAGGTACTGGGG + Intronic
1014220203 6:118792118-118792140 AGTCACATTCTGAGGTACTGGGG + Intergenic
1014229883 6:118891671-118891693 AGTCACATTCTGAGGTACTAGGG + Intronic
1014409154 6:121092829-121092851 AGTCACATTCTGAAGTAGTGGGG + Intronic
1014451873 6:121591472-121591494 AGTCACATTCTGAGGTACTAGGG + Intergenic
1014516785 6:122388772-122388794 AGTCACATTCTGAGGTACTGGGG + Intergenic
1014637795 6:123870220-123870242 TTTCAAATGGTGAAGTACTATGG + Intronic
1014698517 6:124654593-124654615 AGTCACATTCTGAGGTACTGGGG - Intronic
1015104714 6:129522256-129522278 AGTCACTTTTTGAAGTACTGCGG - Intergenic
1015188464 6:130445917-130445939 AGTCACATTCTTAAGTACTGGGG + Intergenic
1015364416 6:132381099-132381121 AGTCACTTTGTTAGGTACTGAGG - Intronic
1015389548 6:132665594-132665616 AATCACATTTTGAGGTACTGGGG + Intergenic
1015470606 6:133601471-133601493 AGTTACTTGGTTAAGTCCTGAGG - Intergenic
1015552885 6:134430695-134430717 GGTCACATGCTGAGGTACTGAGG + Intergenic
1015561529 6:134521218-134521240 TGTCACATGCTGATGTATTGTGG + Intergenic
1015658749 6:135548928-135548950 TGTCACATTATGAAATACTGAGG + Intergenic
1016145390 6:140665836-140665858 AGTCACATATTGAAGTACTAGGG - Intergenic
1016303754 6:142660669-142660691 AGACACATTCTGAAGCACTGGGG + Intergenic
1016348062 6:143137402-143137424 AGTCACATTGTGAGATTCTGGGG + Intronic
1016631115 6:146232783-146232805 AGTCACATTCTGATGTACTGGGG + Intronic
1016674556 6:146748985-146749007 GGTGACATTGTGAAGCACTGGGG + Intronic
1016758006 6:147708104-147708126 AGTCACATTCTGAGGTTCTGGGG - Intronic
1016789457 6:148052734-148052756 GGTCACATGGTGAGGTACTGAGG - Intergenic
1016852615 6:148636418-148636440 AGTCACATTCTGAAATACTGGGG - Intergenic
1016921096 6:149294448-149294470 AGTCACATTCTGAGATACTGAGG + Intronic
1016939892 6:149474981-149475003 AGTCACACTCTGAGGTACTGGGG - Intronic
1017183705 6:151578584-151578606 AGGCACATTCTGAGGTACTGGGG + Intronic
1017274190 6:152546983-152547005 AGTCACTTGGAGGAGAACTGAGG + Intronic
1017332279 6:153213695-153213717 AGTCACATTCTGAGGTACTGGGG + Intergenic
1017424638 6:154307505-154307527 AGTCACATTCTGATGTACTGGGG + Intronic
1017433216 6:154391568-154391590 AGTTACATTCTGAGGTACTGGGG + Exonic
1017615279 6:156240674-156240696 AGTCATATTCTGAGGTACTGGGG - Intergenic
1017809745 6:157976429-157976451 AGTCCCATTCTGAGGTACTGGGG + Intergenic
1017937063 6:159015107-159015129 AGTCACATTCTGAGGTAGTGGGG - Intergenic
1018063957 6:160112729-160112751 GGTCACATTCTGAAGTACTGGGG - Intronic
1018240589 6:161770412-161770434 AGTCACATCCTGAGGAACTGGGG - Intronic
1018566539 6:165161053-165161075 AGTCACATTCTAAGGTACTGGGG - Intergenic
1018603307 6:165570057-165570079 AGTCACATTCTGAGGTACTGGGG - Intronic
1019800005 7:3081347-3081369 AGTCACATTCTGAGGTCCTGGGG - Intergenic
1019949082 7:4356526-4356548 AGTCATATTCTGAGGTACTGGGG - Intergenic
1020891570 7:13884815-13884837 GGTCACATTCTGAGGTACTGGGG - Intergenic
1021423913 7:20476857-20476879 AGTCACATTCTGAGTTACTGGGG + Intergenic
1021427733 7:20521789-20521811 AGTCACATTCTGAGGTAATGTGG - Intergenic
1021602092 7:22374214-22374236 AGTCACATTCAGAGGTACTGGGG + Intergenic
1021605526 7:22405814-22405836 AGTCACATTCAGAGGTACTGGGG - Intergenic
1022054001 7:26710169-26710191 AGGCACTTGGTCAAGTACTCTGG + Intronic
1022071362 7:26918604-26918626 ACAGACATGATGAAGTACTGAGG + Intronic
1022387874 7:29918390-29918412 GGTCACATTCTGAGGTACTGGGG - Intergenic
1022499916 7:30876388-30876410 AGTCACATTCTGAGGTACTGGGG + Intronic
1022795721 7:33730061-33730083 AGTCACACTCTGAGGTACTGAGG - Intergenic
1022808377 7:33845609-33845631 AGTCACATTCTGAGGTACTGGGG - Intergenic
1022945929 7:35283691-35283713 AGCCACATTGTGAGGTACTGGGG - Intergenic
1023040286 7:36167189-36167211 AGTCACATTCTGAAGTACTGGGG + Intronic
1023134138 7:37034150-37034172 AGTCACATTCTGAGGTACTGGGG - Intronic
1023226629 7:37976276-37976298 AGTCACATTCTTAAGCACTGAGG - Intronic
1023275104 7:38510365-38510387 AGTCACATTCTGAGGTACTGGGG + Intronic
1023378758 7:39585295-39585317 AGTCACCTTCTGAGGTACTGAGG - Intronic
1023380276 7:39600264-39600286 GGTCACATTCTGAAGTACTGGGG - Intronic
1023646844 7:42326570-42326592 AGTCACATTCTGAGGTACTGAGG + Intergenic
1024028031 7:45430947-45430969 AGTCACATCCTGAGGTCCTGGGG - Intergenic
1024212304 7:47216421-47216443 AGTCACATTGTGAGGTCCTGGGG + Intergenic
1024349749 7:48351675-48351697 AGTCACATTCTGAGGTACTGGGG + Intronic
1024352879 7:48385010-48385032 AGTCACATTTTGAAGTACAGGGG + Intronic
1024358418 7:48442944-48442966 AGTCACATGCTGAGGTACTGAGG - Intronic
1024365083 7:48510859-48510881 AGTCACATCTTGAAATACTGGGG + Intronic
1024394735 7:48853037-48853059 AGTCACATTCTGAAGTTCTGAGG - Intergenic
1024395019 7:48856245-48856267 AGTCACATGGTAAAGAGCAGAGG - Intergenic
1024400248 7:48916430-48916452 AGTCACATGGTAAAGAGCAGAGG + Intergenic
1024400525 7:48919604-48919626 AGTCACATTCTGAAGTTCTGAGG + Intergenic
1024510722 7:50202673-50202695 AGTCACATGGAGAAGAACTGAGG - Intergenic
1024574785 7:50754815-50754837 AGTCACATTCTGAAGTGCTGGGG - Intronic
1024831563 7:53465414-53465436 TGTCACATTCTGAAGTACTAGGG - Intergenic
1024886407 7:54147512-54147534 AGTCACATTCTGATATACTGAGG + Intergenic
1025064261 7:55839794-55839816 GGTCACATTCTGAGGTACTGGGG - Intronic
1025603759 7:63024054-63024076 AGTCACATTCTGAGCTACTGGGG - Intergenic
1025900429 7:65739995-65740017 AGTCACATTCTGAGGTATTGGGG - Intergenic
1026105299 7:67416315-67416337 AGTCACATTTTGAGGTACTTGGG + Intergenic
1026342083 7:69443191-69443213 AGTCACATTGTGAGGTACTGGGG + Intergenic
1026365904 7:69648050-69648072 GGTCACATTGTGACATACTGAGG + Intronic
1026897734 7:74019953-74019975 AGTCACATTCTGAGGTCCTGGGG - Intergenic
1027338561 7:77181135-77181157 TGTCACATGGCAAAGTAGTGGGG + Intronic
1027715307 7:81662117-81662139 AGAAACATGTTGAAGTACAGAGG + Intergenic
1027771838 7:82416758-82416780 GGTCACATTCTGAAGTACTGGGG + Intronic
1027821140 7:83046195-83046217 AGTCACATTCTGAGGCACTGAGG + Intronic
1028097405 7:86778846-86778868 AGTCACATTCTAAGGTACTGGGG - Intronic
1028367819 7:90054787-90054809 ATTCACATGTTGAACTTCTGAGG + Intergenic
1028749898 7:94371660-94371682 AGTCACATTCTGAGGTACTAGGG - Intergenic
1028809302 7:95066064-95066086 AGTCACATTCTGAGGTGCTGGGG - Intronic
1028882011 7:95890977-95890999 AGTCACATTCTGAGGTACTGGGG - Intronic
1028954031 7:96668777-96668799 GGTCACATTCTGAAGTACTAGGG - Intronic
1028965356 7:96795999-96796021 AGTCACATTCAGAGGTACTGGGG - Intergenic
1029187022 7:98746671-98746693 AGTCACATTCTGAGGTCCTGGGG + Intergenic
1029188278 7:98754851-98754873 AGCCACATTCTGAAGTACTGGGG + Intergenic
1029193842 7:98790537-98790559 AGCCACATTCTCAAGTACTGGGG + Intergenic
1030045716 7:105493568-105493590 AGTCACATTCTGAGGTCCTGGGG - Intronic
1030600252 7:111584074-111584096 ATTCACATTCTGAGGTACTGGGG + Intergenic
1030646230 7:112064713-112064735 AGTCACATTCTGAGGTATTGAGG - Intronic
1030706642 7:112699588-112699610 AGTCACATTCTGAGGTATTGAGG - Intergenic
1030736543 7:113055482-113055504 GGTCATATTGTGAGGTACTGGGG - Intergenic
1030825429 7:114150926-114150948 ATTCACATGATGGATTACTGTGG + Intronic
1030840873 7:114352752-114352774 AGTCACATTCTGAGGTACTGAGG + Intronic
1030899532 7:115105214-115105236 AGTCACATTCTGAAGTTCTGGGG - Intergenic
1030988328 7:116268782-116268804 AGACACATGGAGACGAACTGAGG + Intergenic
1031395088 7:121263952-121263974 AGGCACATTATGAGGTACTGGGG - Intronic
1031478337 7:122249160-122249182 GGTCACATTCTGAGGTACTGGGG - Intergenic
1031581818 7:123485408-123485430 AGTCACATTCTGAGGTAATGAGG + Intronic
1031656004 7:124356483-124356505 AATCACATTTTGAGGTACTGGGG - Intergenic
1031766699 7:125786974-125786996 AGTCACATTCTGAAGTACTGGGG + Intergenic
1031785260 7:126022382-126022404 GGTCCCATCCTGAAGTACTGGGG - Intergenic
1031809868 7:126353059-126353081 AGTCACATGGTTCTGTATTGTGG - Intergenic
1031817370 7:126454611-126454633 AGTCACATTCTGAGGTACTGGGG - Intronic
1031981902 7:128133270-128133292 AGTCACATTCTTAGGTACTGAGG + Intergenic
1032508624 7:132454597-132454619 AGTCACATTCAGAGGTACTGGGG - Intronic
1032672603 7:134099087-134099109 GGTCACATTCTGAGGTACTGGGG - Intergenic
1032757147 7:134901932-134901954 GGTCACATCCTGAGGTACTGGGG + Intronic
1033094103 7:138414624-138414646 GGTCACATTCTGATGTACTGGGG + Intergenic
1033212271 7:139468797-139468819 GGTCACATTTTGAGGTACTGGGG - Intronic
1033249807 7:139748729-139748751 GGTCACATGCTGAAGTACTGGGG + Intronic
1033306032 7:140226372-140226394 GGTCACATTCTGAGGTACTGGGG + Intergenic
1033592089 7:142817765-142817787 AGTCACATTCTGAGGTACTGAGG + Intergenic
1033898241 7:146102478-146102500 AGTTACATTTTCAAGTACTGAGG + Intergenic
1034191135 7:149214366-149214388 GGTCACATTCTGAAGTCCTGGGG + Intronic
1034378677 7:150669111-150669133 AGTCACATTGTGTAGAAATGAGG - Intergenic
1034396957 7:150833652-150833674 AGTCACATTCTGAGGTACTAGGG + Intronic
1034403692 7:150886879-150886901 AGTCACATTCTGAAGAACTGGGG - Intergenic
1034545755 7:151787723-151787745 AGTCACATTCTGAGGTCCTGGGG - Intronic
1034675807 7:152891747-152891769 AGTCACATTCTGAGGTCCTGGGG - Intergenic
1034927804 7:155136933-155136955 AGTCCCATGGTGAGGAACTGAGG + Intergenic
1034938686 7:155216116-155216138 AGTTACATTCTGAAGTCCTGGGG + Intergenic
1035116786 7:156531576-156531598 AGTCACCTTCTGAAGTCCTGGGG + Intergenic
1035576795 8:713226-713248 AGTCACATTCTGAAGTATGGGGG + Intronic
1035664296 8:1369442-1369464 AGTCACATTCTGAGGTCCTGGGG + Intergenic
1036475943 8:9093368-9093390 AGTCGCCTTCTGAAGTACTGGGG + Intronic
1036524390 8:9521315-9521337 GGTCACATTCTGAGGTACTGGGG - Intergenic
1036728721 8:11243182-11243204 GGACACATGGAGAAGCACTGGGG + Intergenic
1036811953 8:11873145-11873167 AGTCACATTCTGAGGTACTAGGG + Intergenic
1036982135 8:13481732-13481754 AGTCACATTGTGAGGTACTGGGG - Intronic
1037006369 8:13785916-13785938 AGTCACATTCTGAGGTACTGAGG + Intergenic
1037131752 8:15414905-15414927 GATCACATGCTGAAGTACTGAGG + Intergenic
1037156996 8:15713794-15713816 AGTCATATTCTGAGGTACTGGGG + Intronic
1037266762 8:17071518-17071540 AGTCAGATTCTGAGGTACTGGGG + Intronic
1037381073 8:18285789-18285811 AGTCACATTCTGAAGTGTTGGGG + Intergenic
1037477630 8:19272583-19272605 AGTCCCATTGTGCGGTACTGGGG + Intergenic
1037700364 8:21268180-21268202 GCCCACATGGTGAAGAACTGAGG + Intergenic
1037737986 8:21582079-21582101 AGTCACATTCTGAGGTACAGGGG - Intergenic
1037779598 8:21858711-21858733 AGTGCCAAGGTGAAGAACTGTGG - Intergenic
1037851336 8:22331892-22331914 AGTCACATTCTGAGGTACTGGGG + Intronic
1037949347 8:23008671-23008693 GGTCACATGGGGAAGCTCTGGGG + Intronic
1037983101 8:23269203-23269225 AGTCACATTCTGACGTGCTGGGG + Intergenic
1038253321 8:25926555-25926577 ACTCACAGTGTGCAGTACTGAGG + Intronic
1038280907 8:26163581-26163603 AGTCATACTGTGAAATACTGAGG + Intergenic
1038341923 8:26693403-26693425 AATCACATTCTGAAGTACTGGGG + Intergenic
1038349235 8:26761401-26761423 AGTCACATTCTGAGGTCCTGGGG - Intronic
1038409579 8:27347707-27347729 AGTCCCATTGTGAAGTACTGGGG + Intronic
1038432026 8:27507991-27508013 AGTCACATTCTAAAGTATTGGGG + Intronic
1038730152 8:30119643-30119665 AGTCACATTCTGAGGTACTGGGG + Intronic
1038731991 8:30136170-30136192 AGTCACATTCTGAGGTACTGGGG - Intronic
1039622433 8:39010643-39010665 AATGACATGGTGAATTGCTGGGG + Intronic
1039720799 8:40162124-40162146 AGTTGCATTCTGAAGTACTGGGG + Intergenic
1040010450 8:42657078-42657100 AGTCACATTCTGAGGTACTGGGG + Intergenic
1040518069 8:48150621-48150643 AGTCACATGGTCTAGCACTAGGG + Intergenic
1040716191 8:50255795-50255817 TGTCACATTCTGAAGCACTGAGG + Intronic
1040800077 8:51330640-51330662 ATTCACATTATGAGGTACTGGGG + Intronic
1040822189 8:51573783-51573805 AGTCACATTCTGAGGTACTGGGG - Intronic
1040870751 8:52098258-52098280 AGTCACATTCTGAGATACTGTGG - Intergenic
1040980829 8:53244839-53244861 AGTCACATTCTGAAGTACTGGGG - Intronic
1041003892 8:53480940-53480962 AGTCACATTTTGAGGCACTGGGG - Intergenic
1041006157 8:53498604-53498626 GGTCACATGCTGAGGTCCTGGGG - Intergenic
1041214468 8:55585993-55586015 AGTCACATTCGGAGGTACTGGGG + Intergenic
1041214841 8:55590332-55590354 AGTCACATTCTGAGGCACTGGGG - Intergenic
1041240297 8:55843479-55843501 AGTCACATTCTGAGGTCCTGAGG - Intergenic
1041585675 8:59514714-59514736 AGTCACATTCTAATGTACTGGGG + Intergenic
1041715479 8:60928143-60928165 AGTCACATTTTGAAGTACTGGGG + Intergenic
1042029277 8:64457135-64457157 GGTCACATACTGAAATACTGAGG + Intergenic
1042102261 8:65286203-65286225 AGACTGATGGTGAAGTACTTGGG - Intergenic
1042182773 8:66108506-66108528 AGTCACATTCTGAAGTACTAGGG + Intergenic
1042192204 8:66198403-66198425 AGTCACATTCTGAGGTACTGGGG - Intergenic
1042381256 8:68116768-68116790 AGTCACATTCTGAGGTACTAGGG + Intronic
1042485723 8:69343529-69343551 TGTCATATTCTGAAGTACTGGGG + Intergenic
1042690328 8:71491450-71491472 AGTCACCTGCTGAGGTACTGGGG - Intronic
1042737895 8:72009334-72009356 AGTCACATTCTGAAGTACCTTGG - Intronic
1042877090 8:73449476-73449498 AGCCACATTCTGAGGTACTGGGG + Intronic
1042972858 8:74429722-74429744 AGTCATACTTTGAAGTACTGGGG + Intronic
1043185669 8:77145788-77145810 AGTCACATTCTGAGGTAATGGGG - Intergenic
1043402247 8:79895325-79895347 AGTCACATTCTGAGGTTCTGGGG - Intergenic
1043950177 8:86300055-86300077 GGTCACATTTTGAGGTACTGGGG - Intronic
1043957956 8:86384204-86384226 CGTCACATTTTGAGGTACTGGGG + Intronic
1044364453 8:91326575-91326597 AGTCACATTCTGAAGTACTGGGG + Intronic
1044364771 8:91331166-91331188 AGTCACATTCTGAGGCACTGGGG + Intronic
1044387086 8:91601894-91601916 AGTCACATTCTGAGGTACTAAGG + Intergenic
1044534026 8:93339207-93339229 GGTCTCATTCTGAAGTACTGGGG + Intergenic
1044713256 8:95076931-95076953 GGTCACACTGTGAGGTACTGAGG - Intronic
1044790727 8:95844274-95844296 AGTCACATTCTGGGGTACTGGGG + Intergenic
1045429149 8:102096974-102096996 AGTCACATTCTGAGGTACTGGGG + Intronic
1045487226 8:102640843-102640865 AGTCGCATTCTGAGGTACTGGGG - Intergenic
1045704094 8:104899985-104900007 GGTCACATTTTGAGGTACTGGGG + Intronic
1045754734 8:105529295-105529317 AGTCACATTCTGAGGTACTGGGG + Intronic
1045980777 8:108184817-108184839 AGTTACATTCTGAGGTACTGAGG - Intergenic
1046001428 8:108424967-108424989 AGACATATTGTGAGGTACTGAGG + Intronic
1046049128 8:109000362-109000384 AGTCATATCCTGAAGTACTGAGG + Intergenic
1046616723 8:116486048-116486070 AGTCACATTTTGAAGTATTGGGG - Intergenic
1046760531 8:118015729-118015751 AGTCATATGCTGAGGTGCTGGGG - Intronic
1046852733 8:118993789-118993811 AGTCACATTCTGAGATACTGGGG + Intergenic
1047002240 8:120584692-120584714 GGTCACATTCTGAGGTACTGGGG - Intronic
1047567240 8:126059215-126059237 AGTCCCATTTTGAGGTACTGGGG - Intergenic
1047583867 8:126247573-126247595 AGTCACTTGGTTAAATAATGAGG + Intergenic
1047599837 8:126414903-126414925 AGTCACATTCTGAGGTACTGGGG + Intergenic
1047612870 8:126538249-126538271 AGTCACATTCTGAAATACTAGGG - Intergenic
1047619775 8:126594561-126594583 GATCACATTCTGAAGTACTGGGG - Intergenic
1047786079 8:128154930-128154952 AGTCACATTCTGAAGTACTGGGG + Intergenic
1047920739 8:129632022-129632044 AGTCACATTCTGAGGTATTGAGG - Intergenic
1047928997 8:129708033-129708055 AATGGCATGGTGAGGTACTGTGG + Intergenic
1047997449 8:130350222-130350244 AGTTACATGGAGTGGTACTGGGG + Intronic
1048314506 8:133352199-133352221 AGTCACATTCTGAGGTCCTGGGG + Intergenic
1048473400 8:134722818-134722840 AGTCACATTTGGAAGTATTGGGG - Intergenic
1048696506 8:137034511-137034533 AATCACATTGTGAAGTACTTGGG - Intergenic
1048768894 8:137874016-137874038 GGTCACATGCTGATGTACTGGGG - Intergenic
1048925576 8:139267969-139267991 GGTCATATTGTGCAGTACTGGGG - Intergenic
1049352742 8:142172754-142172776 AGTCACATTCTGAGGGACTGGGG - Intergenic
1050146320 9:2571875-2571897 AGTCACATTCTGAAATACTAGGG + Intergenic
1050285708 9:4099581-4099603 TGTCACATTCTGAGGTACTGGGG + Intronic
1050383400 9:5056801-5056823 AGTCCCATGGAGAAGTTCTTTGG - Intronic
1050513584 9:6419124-6419146 AGTCACATTCTGAGGTACTGGGG + Intronic
1050631082 9:7559529-7559551 AGTCACATTCTGAAGTACTAGGG - Intergenic
1051113933 9:13673013-13673035 GGTCACATTCTGAGGTACTGGGG + Intergenic
1051472384 9:17459876-17459898 AGTCACATTCTAAAGTACTGAGG + Intronic
1051621719 9:19057156-19057178 GGTCACATTCTGAGGTACTGGGG - Intronic
1051656409 9:19386022-19386044 AGTCACATTCTGAGGTACTGAGG + Intergenic
1051667043 9:19475366-19475388 AGTCACATTCTGAAGTACAGGGG + Intergenic
1051778173 9:20658886-20658908 AGTCACATTCTGAGGTACTAGGG - Intronic
1051974875 9:22937518-22937540 ATTCACATGGTGAAGTGGAGGGG - Intergenic
1052752164 9:32502961-32502983 AATCACATTCTGAAGTACTGGGG + Intronic
1053006078 9:34605505-34605527 AGTCACATTCTGAGGTACTGGGG - Intergenic
1053282491 9:36829994-36830016 AGTCACATTCTAAGGTACTGAGG - Intergenic
1054757715 9:68975966-68975988 GGTCACATTCTGAGGTACTGGGG + Intronic
1054968416 9:71056541-71056563 AGTCACATTCTGCAGTACTAGGG - Intronic
1055161038 9:73128460-73128482 AGTCACATTCTGATGTACTGTGG + Intergenic
1055167691 9:73217710-73217732 GGTCACATTCTGAGGTACTGGGG - Intergenic
1055250891 9:74304063-74304085 AGTCACAAGGTCAAGTGCTGCGG + Intergenic
1055330383 9:75177526-75177548 AGTCACATTCTGAGGTACTCGGG + Intergenic
1055902125 9:81252687-81252709 AGTCACATTCTGAAGTACTGAGG - Intergenic
1056179594 9:84069212-84069234 AGTCACATTCTGAGGTACTGGGG + Intergenic
1056388831 9:86121613-86121635 AGTCACATTCTGAGGTACAGGGG + Intergenic
1056515777 9:87347969-87347991 AGTCATATTCTGAGGTACTGGGG + Intergenic
1056683575 9:88741242-88741264 AGTCATATTCTGAGGTACTGGGG - Intergenic
1056879666 9:90379288-90379310 AGTCGCATTCTGAAGTACTAGGG - Intergenic
1056958717 9:91103134-91103156 AGTCACATTCTGAGATACTGGGG - Intergenic
1057105025 9:92406775-92406797 AGTCACATGGCAAGGAACTGAGG - Intronic
1057210234 9:93197215-93197237 AGACACAGGCTGAAGTACTCAGG - Intronic
1057308813 9:93928492-93928514 AGTCACGTTCTGAGGTACTGGGG + Intergenic
1057521562 9:95764452-95764474 AGTCATATTCTGAGGTACTGGGG - Intergenic
1057530030 9:95837070-95837092 AGTCACATTCTGAAGTACTGGGG + Intergenic
1057705903 9:97394879-97394901 AGTCACATTATGAGGTCCTGGGG - Intergenic
1057891839 9:98875517-98875539 AGCCACATTCTGAGGTACTGTGG + Intergenic
1058217000 9:102246939-102246961 AGTCACATTCTGAGGTACTGGGG + Intergenic
1058236218 9:102493271-102493293 AGTCACATTTTGAGCTACTGAGG + Intergenic
1058388230 9:104463379-104463401 AGTTACATTCTGAGGTACTGGGG - Intergenic
1058456400 9:105141811-105141833 GTTCACATGGTGAGGAACTGAGG + Intergenic
1058840255 9:108900323-108900345 TGTCCCATGGGGAAGTTCTGCGG - Exonic
1058883104 9:109302462-109302484 AGTCACATTCTGAGGTACTGGGG + Intronic
1058933818 9:109749008-109749030 AGTCACATTCTGAGATACTGGGG + Intronic
1059091908 9:111368531-111368553 AGTCAAATTCTGAGGTACTGGGG - Intronic
1059130666 9:111745457-111745479 AGTCACATTCTGAGGTACTGAGG - Intronic
1059180836 9:112210642-112210664 AGTCAGATTTTGAGGTACTGTGG - Intergenic
1059498788 9:114732572-114732594 AGTTACATTCTGAAGTACTGGGG - Intergenic
1059649601 9:116303487-116303509 AGTCCCTTGGGGAAGAACTGTGG - Intronic
1059811269 9:117858190-117858212 TGACACAAGTTGAAGTACTGAGG + Intergenic
1059909226 9:119023790-119023812 AGTCACATTCTGAGATACTGGGG + Intergenic
1060141920 9:121217657-121217679 AGTCACATTCTGAGGTACTGGGG + Intronic
1061094611 9:128448369-128448391 GGTCACATTCTGAGGTACTGGGG - Intergenic
1061240986 9:129372264-129372286 AATCACATTCTGAAGTAGTGGGG + Intergenic
1061620712 9:131809729-131809751 AGCCACATGCTGAAATCCTGGGG + Intergenic
1061632971 9:131885198-131885220 AGTCACATGGGCCAGTTCTGGGG - Intronic
1061977862 9:134080923-134080945 AGTCACATTCTGAGGTACTGAGG - Intergenic
1185606228 X:1368546-1368568 AGTCACATTCTGAGGTCCTGGGG - Intronic
1185616633 X:1425982-1426004 AGTCACATCCTGAGGGACTGGGG - Intronic
1185663559 X:1746127-1746149 AGTCACAGTCTGAAGTCCTGGGG - Intergenic
1185682101 X:1897224-1897246 AGTCACATCTTGAGGTCCTGGGG + Intergenic
1185800720 X:3008005-3008027 AGTCACATTCTGAGGTCCTGGGG + Intronic
1185869590 X:3652722-3652744 AGTCACATTCTGAAGTTCTGGGG - Intronic
1185945635 X:4372698-4372720 GGTCACATAATGAAGTACTAGGG + Intergenic
1186044159 X:5516224-5516246 AGTCACATACTAAGGTACTGGGG + Intergenic
1186146795 X:6632530-6632552 AGTCACATCCTGAAATTCTGGGG + Intergenic
1186186863 X:7029285-7029307 AGTCACATTCTGAGGTCCTGGGG + Intergenic
1186197752 X:7126717-7126739 AGTCACATTCTGAGGTCCTGGGG + Intronic
1186371701 X:8953463-8953485 AGTCACATACTGAGGTCCTGGGG + Intergenic
1186425196 X:9458879-9458901 AGTCACATTCTAAGGTACTGGGG + Intergenic
1186434725 X:9532852-9532874 AGTCACATTCTGAGGTCCTGGGG + Intronic
1186513739 X:10150442-10150464 AGTCACATTCTGAGGTACTGGGG + Intergenic
1186586237 X:10876198-10876220 AGTCACCTGGGGAATCACTGAGG + Intergenic
1186906905 X:14120429-14120451 AATCACAAGGTGAAGTACCATGG + Intergenic
1186940540 X:14502073-14502095 AGTCACATTCTGAGGTACTGGGG + Intergenic
1187049041 X:15678006-15678028 GGTCACATTCTGAGGTACTGGGG - Intergenic
1187053163 X:15714309-15714331 AGTCACATTTTAAGGTACTGGGG + Intronic
1187096852 X:16157762-16157784 AGTCACATGGGGAAGTTGAGTGG + Intergenic
1187185821 X:16984263-16984285 ACCCACATGGTGAGGAACTGAGG - Intronic
1187440816 X:19318207-19318229 AGACACATGCTGAAGTATTCAGG + Intergenic
1187448440 X:19377003-19377025 GGTCACATTCTGAGGTACTGGGG + Intronic
1187471624 X:19574858-19574880 AGTCACATTTTGAGGTATTGAGG - Intronic
1187495227 X:19789702-19789724 AGTCACATTATGAGGTACAGGGG + Intronic
1187548197 X:20274163-20274185 GGTCACATTCTGAAGTACTGAGG - Intergenic
1187597436 X:20788692-20788714 AGTCACATTTTCAGGTACTGGGG - Intergenic
1187682577 X:21782554-21782576 GGTCACATTCTGAGGTACTGAGG - Intergenic
1187824492 X:23321056-23321078 AGTCATATTCTGAGGTACTGGGG - Intergenic
1187892001 X:23945237-23945259 GGTCACATTCTAAAGTACTGGGG - Intergenic
1187928845 X:24275647-24275669 GGTCACATTCTGAGGTACTGGGG - Intergenic
1188067819 X:25682925-25682947 AGTCACATTCTGAGATACTGGGG + Intergenic
1188113789 X:26220727-26220749 AGTCACATTCTGAGGTACTGGGG + Intergenic
1188159729 X:26784604-26784626 AGTCCCATGGTGAAGTGCACGGG + Intergenic
1188384931 X:29544826-29544848 AGTCACATTCTGAGGTATTGGGG - Intronic
1188945208 X:36292176-36292198 AGTCATATGGTGGAGGATTGGGG + Intronic
1189211836 X:39290383-39290405 GGTCACATTCTGAGGTACTGGGG + Intergenic
1189312497 X:40029695-40029717 GGTCACATTCTGATGTACTGGGG - Intergenic
1189563325 X:42213693-42213715 AGTCACATTCTGAGGTACTGAGG + Intergenic
1189568765 X:42272984-42273006 GGTCACATGGAGGAGCACTGAGG + Intergenic
1189728776 X:43996994-43997016 AGTCACATTCTGAGGTTCTGTGG - Intergenic
1189738887 X:44098709-44098731 AGTCGCATTTTGAGGTACTGTGG + Intergenic
1190009819 X:46774850-46774872 AGTCACATTCTGAGGTACTAGGG + Intergenic
1190224169 X:48532969-48532991 AGTCACATTCTGAAGTATTGGGG + Intergenic
1190251963 X:48733635-48733657 GGTCACATTCTGAGGTACTGGGG - Intergenic
1190253479 X:48745180-48745202 ACTCACATTCTGAAGTACTAGGG + Intergenic
1190430532 X:50374122-50374144 GGTCACATTCTGATGTACTGGGG - Intronic
1190622942 X:52306273-52306295 AGTCACATTCTGAGGTACTAGGG + Intergenic
1190792192 X:53710862-53710884 AGTCACATTCTGAGGTACTAGGG - Intergenic
1190872570 X:54436894-54436916 AGTCACATTCTGAGGTACTGGGG + Intergenic
1191846791 X:65552698-65552720 AGTCACATTCTGAGGTGCTGGGG + Intergenic
1191965518 X:66752926-66752948 AGTCACATTCTGAGTTACTGAGG + Intergenic
1192300478 X:69896288-69896310 AGCCACATTGTGAGGTACTGGGG + Intronic
1193456926 X:81743291-81743313 AGTCAGAGGGTGCAGTACAGTGG + Intergenic
1193543580 X:82800374-82800396 AGTCACACTCTGAGGTACTGGGG - Intergenic
1193589791 X:83375092-83375114 AATCACATTCTGAGGTACTGGGG - Intergenic
1193926965 X:87499487-87499509 AGTCACATTCTGAGGTACCGAGG - Intergenic
1193993106 X:88333203-88333225 AGCCACATTCTGAGGTACTGGGG - Intergenic
1194027608 X:88772713-88772735 AGTCACATTCTGAGTTACTGGGG + Intergenic
1194035524 X:88866007-88866029 AGTCGCATCTTGAGGTACTGGGG + Intergenic
1194412713 X:93577323-93577345 AGTCACATTCAAAAGTACTGGGG + Intergenic
1194458226 X:94130993-94131015 AGTCACATTCTGAAGTACTGAGG + Intergenic
1194458305 X:94132386-94132408 AGTCACATTCTGAAGTACTGAGG - Intergenic
1194759195 X:97774075-97774097 AGTCACATTCTGAGGTACTGGGG + Intergenic
1195361684 X:104088312-104088334 TGTCACATTATGAGGTACTGGGG - Intergenic
1195655740 X:107329884-107329906 AGTCACATTCTGAAGTACTGGGG - Intergenic
1195843527 X:109201463-109201485 GGTCACATTCTGAGGTACTGGGG - Intergenic
1196276832 X:113776119-113776141 GATCACATTTTGAAGTACTGGGG - Intergenic
1196352913 X:114754155-114754177 AGCCACATTCTGAGGTACTGGGG + Intronic
1196603716 X:117631400-117631422 AGTCACATGGCAAAGGAGTGGGG - Intergenic
1196833375 X:119793387-119793409 AGTCACATTCTGAGGTCCTGGGG + Intergenic
1197443151 X:126514559-126514581 AGTCACATTCTGAAGTATTGGGG + Intergenic
1198464936 X:136896589-136896611 AGTCACATTCTGAGGTTCTGGGG + Intergenic
1198487943 X:137107065-137107087 AGTCACATTCTGAAGTACTGGGG - Intergenic
1198640918 X:138755862-138755884 AGTCACATTGTGAGGTATTGGGG - Intronic
1198874403 X:141207574-141207596 GGTCACATTCTGAGGTACTGGGG - Intergenic
1198895086 X:141444798-141444820 ATTCGCATTCTGAAGTACTGTGG + Intergenic
1198962667 X:142199253-142199275 AGTGACATTCTGAGGTACTGGGG - Intergenic
1199161420 X:144616706-144616728 GGTCACATTCTGAAATACTGGGG - Intergenic
1199323881 X:146474656-146474678 AGTCACGTTCTGAAGTACTTGGG - Intergenic
1199525481 X:148786692-148786714 GGTCACACTGTGAGGTACTGGGG + Intronic
1199694231 X:150332133-150332155 AGTCACATTCTGAGGTACTGGGG - Intergenic
1199813754 X:151377938-151377960 AATCACATTCTGAGGTACTGGGG + Intergenic
1199848373 X:151707845-151707867 AGCCACATGTTGAGGTCCTGGGG + Intergenic
1199903864 X:152205144-152205166 GGTCACATTTTGCAGTACTGGGG + Intronic
1199935914 X:152573486-152573508 AGTCACATATTGAAGTACAGGGG - Intergenic
1199936203 X:152575989-152576011 AGTTACATTCTGAAGTACTTGGG + Intergenic
1199964884 X:152811606-152811628 AGTCACATTCTGAGGTACTAGGG - Intergenic
1200298981 X:154953222-154953244 AGTCACATGCTGAGGTACTGGGG - Intronic
1200325149 X:155230308-155230330 AGTCACATTCTGAGCTACTGGGG + Intronic
1200768227 Y:7099323-7099345 ATTGACATGGTTAAGTGCTGAGG + Intergenic
1201223831 Y:11797219-11797241 AGTCACATTCTAAAGTACTCAGG + Intergenic
1201666000 Y:16455303-16455325 AGTCACATCTTCACGTACTGGGG + Intergenic