ID: 935040645

View in Genome Browser
Species Human (GRCh38)
Location 2:99423412-99423434
Sequence TGTGAATGGAAAGCAGCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935040645_935040648 22 Left 935040645 2:99423412-99423434 CCCGTGGCTGCTTTCCATTCACA 0: 1
1: 0
2: 1
3: 29
4: 235
Right 935040648 2:99423457-99423479 TGAGTGACAGAAACTTTATCTGG 0: 1
1: 0
2: 0
3: 23
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935040645 Original CRISPR TGTGAATGGAAAGCAGCCAC GGG (reversed) Intronic
901210738 1:7524740-7524762 TGTGAATGAAAAGCAGTCCTGGG - Intronic
901301243 1:8201371-8201393 TTTGAATGGAATGCAGTCACTGG + Intergenic
902210294 1:14900001-14900023 TCTGCTTTGAAAGCAGCCACAGG - Intronic
902481209 1:16712849-16712871 TTTCAATTGAAAGCAGTCACGGG - Intergenic
906643089 1:47453158-47453180 TGTGAGTGGAGAACAGGCACAGG + Intergenic
907300577 1:53484154-53484176 TTTAAATGGAAAGCAGCCTCGGG - Intergenic
908800151 1:67871737-67871759 TGAGCATGGAAAGAAGTCACAGG - Intergenic
909167157 1:72241987-72242009 TGGGAAAGGAAAGCAGATACAGG - Intronic
911034339 1:93523877-93523899 TGTGATGCAAAAGCAGCCACAGG - Intronic
911390716 1:97237784-97237806 TGTGTATGTAAAGAAGCCATTGG - Intronic
911648590 1:100361701-100361723 TTTGAATGGAGAGGAGTCACAGG + Intronic
912626041 1:111204886-111204908 TTTGAATGGAAGGCAGCGACAGG - Intronic
915281722 1:154827353-154827375 TGTGGAGGGAAAGAAGCCTCAGG - Intronic
915329924 1:155104715-155104737 TGTGAATGGAGAGCCACCAAGGG - Intergenic
916056815 1:161073737-161073759 TGTGATGGGAATGCAGCCTCCGG + Exonic
916164910 1:161957980-161958002 TGTGAATGGTAAGGAGACCCTGG - Intronic
916926662 1:169528385-169528407 TGTTAATGGAAAGTATACACGGG - Intronic
922235281 1:223717903-223717925 TGGGAAGGGAGAGAAGCCACAGG - Intronic
922536640 1:226385926-226385948 AATGAAGGGAAAGCAACCACTGG + Intronic
924093345 1:240525056-240525078 TGTGAATGTAAAGCACCTAGTGG + Intronic
1065033468 10:21612375-21612397 AGAGAAAGCAAAGCAGCCACTGG + Exonic
1066026895 10:31367104-31367126 GGTCATTGGAAAGCAACCACTGG + Intronic
1067804197 10:49381950-49381972 GGTGAATTGCAAGCTGCCACGGG + Intronic
1068040299 10:51815842-51815864 GGTGCAGGGAAAGCAGCCCCTGG + Intronic
1068286624 10:54945764-54945786 TGTGAACGTAATGCAGCCCCTGG - Intronic
1069715092 10:70515475-70515497 TGTGAATGGCCAGCAGTCCCTGG - Intronic
1071122863 10:82299640-82299662 TGTAACAGGATAGCAGCCACTGG - Intronic
1072062198 10:91824306-91824328 TGGTCATGGAAAGCAGTCACTGG - Intronic
1072823036 10:98577149-98577171 CGAGAATGGAAACCATCCACAGG + Intronic
1073504063 10:103967924-103967946 TGCGAAGGTAAAACAGCCACTGG + Intronic
1073993773 10:109293157-109293179 TGTAGCTTGAAAGCAGCCACAGG - Intergenic
1074062029 10:109975323-109975345 TCTGAAAGGGAAGCAGCCAGTGG + Intergenic
1074287361 10:112110669-112110691 TGTTAATTAAAAGCAGCCCCAGG - Intergenic
1074388404 10:113035841-113035863 TGTAACTCGAAAGCAGCCACAGG - Intronic
1075059345 10:119244118-119244140 TGTAGTTTGAAAGCAGCCACAGG + Intronic
1075884013 10:125881349-125881371 TGTGAATGGAAAGCAACAGGAGG + Intronic
1076550929 10:131277841-131277863 GGAGAATGGAAAGGAGCCAGTGG + Intronic
1078177790 11:8983395-8983417 TCTGAATGGGAAGGAGCCCCTGG + Exonic
1080778533 11:35408667-35408689 TGTGATGGGGAAGGAGCCACTGG + Intronic
1081416725 11:42824222-42824244 TGTGGAGTGAAAGCAGCCACAGG + Intergenic
1085517461 11:77119703-77119725 TGAGAACGGAATGAAGCCACCGG + Intronic
1085762252 11:79252171-79252193 TGTGAATTGAAAGCAGCACACGG + Intronic
1086077447 11:82869549-82869571 AGTGAATGAAAAACATCCACTGG + Intronic
1088876823 11:113943185-113943207 TCTGATTGGTAAGCAGCCTCGGG + Exonic
1090702115 11:129305763-129305785 TGGGAATGGAAAAAATCCACAGG + Intergenic
1091023033 11:132118269-132118291 TGTGCATTGATTGCAGCCACTGG - Intronic
1091108830 11:132946285-132946307 GGTGATTGTAAAACAGCCACAGG - Intronic
1091815234 12:3432600-3432622 TGGGGCTGGAAAGCAGCAACAGG + Intronic
1093757770 12:22871557-22871579 TGTTACTGGAAGGCAGACACTGG + Intergenic
1093970176 12:25369366-25369388 TGTGAACGGAGAGCAGGAACCGG + Intergenic
1094123336 12:26997153-26997175 TGTGGCAGGAAAGCAGCCACAGG + Intronic
1095377981 12:41554366-41554388 AGGGAAGGGAAAGAAGCCACAGG + Intronic
1101157116 12:101938362-101938384 TGTGAATGGAAAACAGATAAAGG - Intronic
1102300743 12:111769171-111769193 TGATAAAGAAAAGCAGCCACAGG - Intronic
1102576945 12:113861645-113861667 TGTGCATGGTAAGCAGCTAAGGG + Intronic
1102825406 12:115944259-115944281 TGTGGCAGGAAAGCAGCCATAGG + Intergenic
1102966808 12:117134126-117134148 TGTAGCGGGAAAGCAGCCACAGG - Intergenic
1103083810 12:118046046-118046068 TTTTATTGGAACGCAGCCACAGG + Intronic
1105461260 13:20590699-20590721 TGTAAAGCAAAAGCAGCCACAGG + Intronic
1106962871 13:35021240-35021262 TGTAACTTGAAAGCAGACACAGG - Intronic
1107431028 13:40340466-40340488 TGTGAATGGACACTAGCCACAGG + Intergenic
1110241607 13:73273402-73273424 TGTGAATGCAAAGCAGGTTCTGG + Intergenic
1111247679 13:85562325-85562347 TATAAATGGAAAGCAGCCGCTGG + Intergenic
1112181957 13:97091815-97091837 TGTCAAGGGAAATAAGCCACAGG + Intergenic
1113385367 13:109843150-109843172 AGGGAAGAGAAAGCAGCCACAGG + Intergenic
1113752608 13:112786761-112786783 TGTGAATGGTGGGCCGCCACAGG - Intronic
1114201498 14:20525301-20525323 TCTGAAAGGACAGCAGCCACAGG + Intergenic
1116743556 14:48788729-48788751 TGTGACTGGAAATATGCCACAGG - Intergenic
1117748819 14:58899524-58899546 TGGGAATGAAGAGAAGCCACAGG - Intergenic
1119322294 14:73739272-73739294 TGTGGAGGGAAGGCAGCCACCGG + Exonic
1120311640 14:82835606-82835628 TGGGAATGAAAAGCACCCAGCGG - Intergenic
1122006602 14:98709919-98709941 TGTATCAGGAAAGCAGCCACAGG + Intergenic
1122357476 14:101132314-101132336 TGAGCCTGGCAAGCAGCCACGGG - Intergenic
1122421589 14:101581293-101581315 TGAGAAGGAAAAGCAGCCAGTGG + Intergenic
1122676557 14:103419565-103419587 TGTGAATGCAGAGCAGACACAGG - Intronic
1123755616 15:23395532-23395554 GGAGAACGGAAAGCACCCACGGG + Intergenic
1125491174 15:40149629-40149651 TGTGTCAGGAAGGCAGCCACTGG - Intergenic
1127358852 15:58227058-58227080 GGAGAATGGAATGCAGCCAGGGG + Intronic
1127447590 15:59081049-59081071 TGAGAATGGAAAGCATGTACAGG - Exonic
1131564855 15:93476859-93476881 AGTGAGTGGAAACCAGCCCCAGG + Intergenic
1131917701 15:97288432-97288454 TGTGAATGAAAACAAGCCCCAGG - Intergenic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1134095970 16:11418702-11418724 TGTGTTGTGAAAGCAGCCACAGG - Intronic
1134460761 16:14427493-14427515 GGAGAATAGAAAGCACCCACGGG - Intergenic
1135877065 16:26212573-26212595 AATGAATGGAAAGAAGTCACAGG + Intergenic
1136088969 16:27904674-27904696 TGTGGCTGGAAAGGAGCCTCAGG - Intronic
1138184171 16:54963630-54963652 TGTGAGTGACAAGCAGCCGCAGG - Intergenic
1139301879 16:65952100-65952122 TGGGAATGTAAATCAGCAACTGG - Intergenic
1139302005 16:65953306-65953328 TGGGAATGTAAATCAGCAACTGG - Intergenic
1139696978 16:68682073-68682095 CGTGTAGGGAAAGCAGGCACAGG + Intronic
1140628054 16:76818511-76818533 TGTCAATGGAAAAGGGCCACAGG - Intergenic
1140995160 16:80252082-80252104 TAAGAATGAAAAGCAGCCCCAGG + Intergenic
1142440553 16:90094890-90094912 TGAGAATGGGCAGGAGCCACCGG + Intergenic
1142888483 17:2928188-2928210 TGTGAATGGGAAGCGGACAGTGG - Intronic
1143739955 17:8945256-8945278 TGTGCCAGGAAACCAGCCACTGG + Intronic
1144728120 17:17511840-17511862 TGGGAAAGAAAAGCAGCCATGGG - Intronic
1149656570 17:58312321-58312343 TGTGAATGGGGAGCTGCGACAGG - Exonic
1151163031 17:72181832-72181854 AGTGAATTAAAAGCAGCCACAGG - Intergenic
1152140633 17:78534415-78534437 TGTGGATGGAAAGAAGCCACAGG + Intronic
1155534657 18:26804738-26804760 TGTGCATGGAAACCAGCAGCAGG + Intergenic
1156419492 18:36935266-36935288 TTTGAGTAGAAATCAGCCACTGG + Intronic
1156712823 18:39967054-39967076 TGTGAATGCACATCAGCCACAGG - Intergenic
1157220440 18:45825408-45825430 TGTGAGGGGATGGCAGCCACAGG + Intergenic
1158652919 18:59303762-59303784 TGGGGATGGGAAGCAGTCACTGG - Intronic
1160154270 18:76421505-76421527 TGTGTTTGCAAAGCTGCCACCGG + Intronic
1161730373 19:5956826-5956848 TGTGAGGGGACAGAAGCCACAGG + Intronic
1165319225 19:35075528-35075550 TGTGAAAGGAAGGCTGGCACAGG + Intergenic
1166562708 19:43743953-43743975 TGAGAATGGATAGTAGCCACTGG - Intronic
1202715251 1_KI270714v1_random:38760-38782 TTTCAATTGAAAGCAGTCACGGG - Intergenic
925597936 2:5575134-5575156 TGTAAATGGACAACAGACACAGG - Intergenic
927789965 2:26002137-26002159 TCTGAATGGCAAGCACCCAGTGG - Intergenic
928638258 2:33270245-33270267 AGTGAATAGAAAGCAGACAGGGG + Intronic
928848710 2:35714549-35714571 TGTATCTGGAAAGCAGCCATAGG - Intergenic
930417237 2:51103979-51104001 TGTCACAGGAAAGCAGCCATAGG + Intergenic
931378622 2:61731498-61731520 TCAGAATGGACACCAGCCACAGG - Intergenic
934676284 2:96252120-96252142 AGTGAACTGCAAGCAGCCACTGG + Exonic
935040645 2:99423412-99423434 TGTGAATGGAAAGCAGCCACGGG - Intronic
936239857 2:110777921-110777943 TGTGGCAGGAAGGCAGCCACTGG - Intronic
936532069 2:113283362-113283384 GGTGAAAGGAAAAGAGCCACTGG + Intergenic
936674836 2:114702829-114702851 AGTGGATGGAAAGGAGCCAAAGG + Intronic
937373646 2:121320164-121320186 TGTTAAGGCACAGCAGCCACAGG - Intergenic
937858093 2:126687130-126687152 CGTGGATGGCAAGCAGACACTGG + Intronic
938746945 2:134288420-134288442 TGTGATGTGAAAGCAGCCACAGG - Intronic
940088126 2:149885036-149885058 CATGAAAGGAAAGCAGCCACAGG + Intergenic
940281314 2:151992633-151992655 TGTGAATGCAAACCAGCACCCGG + Intronic
941779499 2:169428617-169428639 TGAGAAAGGAAAGGATCCACAGG + Intergenic
942765610 2:179452876-179452898 TGTAGCAGGAAAGCAGCCACTGG + Intronic
943597055 2:189871035-189871057 TGTAAAAGGAAAGCAGACGCTGG - Intronic
945849013 2:214983230-214983252 TGAGCATGGAAGGAAGCCACTGG + Intronic
946400732 2:219467152-219467174 GCTGAGGGGAAAGCAGCCACGGG - Exonic
947074819 2:226331047-226331069 TCTGAATCAAAAGCAGCCAAAGG - Intergenic
947766557 2:232641609-232641631 TGTGATATGAAAGCAGCCACAGG + Intronic
947815700 2:233034784-233034806 GGTGAGTGTAGAGCAGCCACTGG - Exonic
1169506749 20:6219827-6219849 TCAGAGTGGCAAGCAGCCACTGG + Intergenic
1169804663 20:9547123-9547145 TGTGAAGGCAAAGCAGAGACTGG + Intronic
1170450570 20:16479305-16479327 TGTGAATATAAAGAAGACACAGG + Intronic
1173144528 20:40513298-40513320 TGTTTATGGAAAGCAGCCCCTGG + Intergenic
1173389730 20:42621290-42621312 TGCTAATGGAAAGGAGCCAGTGG - Intronic
1173889696 20:46496746-46496768 GGGGAAAGGAGAGCAGCCACAGG - Intergenic
1175060058 20:56233754-56233776 TGTGACTGGCCAGCATCCACAGG - Intergenic
1175437760 20:58966395-58966417 TGGGCAGGGAAAACAGCCACAGG - Intergenic
1175820437 20:61906265-61906287 TGGGGCAGGAAAGCAGCCACGGG + Intronic
1178687101 21:34720615-34720637 TGTGAAGGGAAATTGGCCACAGG - Intergenic
1179664749 21:42903314-42903336 TGTGAATAGCACGCTGCCACTGG - Exonic
1179768708 21:43596530-43596552 GGGGAATGGAAAGCAGCCAAAGG + Intronic
1180008016 21:45032324-45032346 TGTGATTGGACAGCAGCACCTGG - Intergenic
1181294782 22:21828185-21828207 TGTGAAGGCAAACCAGGCACAGG + Intronic
1181463454 22:23098481-23098503 TGGGCAGGGACAGCAGCCACTGG + Intronic
1183269186 22:36850109-36850131 TGTGGAGGGAAAGGAACCACTGG + Intergenic
1184921909 22:47611052-47611074 TGTCAATGGAAACCACACACAGG + Intergenic
949643756 3:6069359-6069381 TATGGATGGAAAGCAACCATAGG + Intergenic
950334713 3:12184341-12184363 TGGGAACAGAAAGCAGCCTCAGG - Intronic
950442724 3:13019361-13019383 TGTGAATGGGACCCAGCCAGGGG + Intronic
950493101 3:13318086-13318108 TCTGAATGCAATGCAGCCTCGGG + Intronic
950611930 3:14132519-14132541 AGGGAAAGCAAAGCAGCCACGGG - Intronic
953343142 3:42152617-42152639 TGTCCATGGAAAGCAGCCTCAGG + Intronic
954443031 3:50532017-50532039 TGTGAATGGGAACAAACCACAGG - Intergenic
955045960 3:55359961-55359983 TGTTAAGAGAAAGCAGCTACAGG + Intergenic
955548919 3:60061796-60061818 TATGAAAGGAAAGCAGACAAGGG + Intronic
957762839 3:84581629-84581651 TGTGAATGGTCTGCTGCCACAGG - Intergenic
960723386 3:120646367-120646389 CTGGAATGGAAAGCAGACACTGG + Intronic
960995812 3:123339434-123339456 TGTGAACTGGCAGCAGCCACAGG + Intronic
962337636 3:134550687-134550709 TGAGACTGGAAAGCAGGGACTGG + Intronic
965945149 3:174231972-174231994 TGTACATGCAAAGCAGCCCCCGG + Intronic
966301779 3:178487005-178487027 TGTGAATTGAGAGCATCCAGTGG + Intronic
966934219 3:184695202-184695224 TGTGGATGGAGAGGAGCCCCTGG - Intergenic
967421688 3:189280196-189280218 TGTAGAGTGAAAGCAGCCACGGG + Intronic
968382820 4:110001-110023 TGTGACTTGGAAGCAGACACTGG + Intergenic
972235787 4:37132583-37132605 TGAGAATGGAAACCTGCCACTGG + Intergenic
973095830 4:46198128-46198150 TATGAGTGGAAAGGAGTCACAGG - Intergenic
974284661 4:59848260-59848282 TGTGAATGTATAGCAACCATTGG + Intergenic
974695711 4:65367891-65367913 TGTGAGTGGAAAACAGCCAGTGG - Intronic
975342722 4:73259136-73259158 TGTGATTAGAACGCAGCCGCAGG + Intergenic
975624345 4:76328907-76328929 TGTGAATGTGAAGCAACCAGAGG + Exonic
977254584 4:94726718-94726740 TGTGAATGCAGATCAGCCTCTGG - Intergenic
978779345 4:112533691-112533713 TGTGAATGGAAGGGAGTAACTGG - Intergenic
980073659 4:128270022-128270044 TGGAAATGAAAAGCAGGCACTGG - Exonic
980959539 4:139461258-139461280 TGTGAATGGAAAGCAGGGGAGGG + Intronic
981092375 4:140744937-140744959 TGTGAATAGAAAGGAGTGACTGG - Intronic
981324845 4:143434072-143434094 TGTGATTGTAAACCAGCCAAGGG + Intronic
982433772 4:155356713-155356735 TTTAACAGGAAAGCAGCCACAGG - Intronic
985167253 4:187109842-187109864 TGTGATGCAAAAGCAGCCACAGG + Intergenic
985234016 4:187852834-187852856 TGTGAATGCCAAGCGGCCAAAGG - Intergenic
985351613 4:189069520-189069542 TGTGTATGGAATGCTGCAACCGG - Intergenic
985909825 5:2870259-2870281 TGTAAATGTAAAGCAGTCTCAGG - Intergenic
986399662 5:7368616-7368638 TGAGATAGGAAAGCAGTCACTGG + Intergenic
986792924 5:11181088-11181110 TGTGAATGCAAACCAGCCAGCGG + Intronic
988499281 5:31770693-31770715 TGTAAATGGAAACCAGCGGCTGG + Intronic
988604756 5:32669541-32669563 AGGGAATGCAAAGCAGCCAGCGG - Intergenic
989691404 5:44149282-44149304 TGTAAATTGAATGCAGGCACCGG + Intergenic
992595428 5:78342285-78342307 TGTGAATGAAAATTAGCCAAAGG + Intergenic
992685645 5:79196978-79197000 TGTGGATGGAATTCAGCCATGGG - Intronic
992803067 5:80310539-80310561 TTTTAATGAAAAGCAGCCCCAGG - Intergenic
993131871 5:83908484-83908506 TTTGAGAGGAAAGCAGCCCCAGG + Intergenic
993481826 5:88433324-88433346 TGTCAATGGAAATGAGCCATGGG + Intergenic
994092981 5:95824920-95824942 TCTCAATGGAAAGCCGCCATGGG + Intergenic
994273271 5:97807264-97807286 TGTGAAGGGGAAGCAGACAAAGG + Intergenic
997020217 5:129991656-129991678 TGTAACTGGCAAGCAGCCATGGG + Intronic
1000540230 5:162530699-162530721 TGTGAATGTAATGCATACACAGG + Intergenic
1002426313 5:179178281-179178303 TGTGAATGGAGAGCTGGAACCGG + Intronic
1004035280 6:11917419-11917441 TGTAAAGAGAAAGAAGCCACAGG + Intergenic
1005122417 6:22404104-22404126 TCTGACTGGCAAGCAGACACTGG + Intergenic
1005850934 6:29820636-29820658 TGTGAATGGGCAGCAGCCCAGGG + Intergenic
1006079616 6:31557885-31557907 TGCAGATGGAAAGCAGCCAGTGG - Intronic
1006591606 6:35162118-35162140 TGTGAGTGGAAAGCAGTGGCCGG + Intergenic
1007748349 6:44056901-44056923 TGTGATTGGACAGCCGCCCCAGG + Intergenic
1007964204 6:45988580-45988602 TTTTAATGGCAAGTAGCCACAGG - Intronic
1008595576 6:53038727-53038749 TGTAGTTTGAAAGCAGCCACAGG - Intronic
1010716344 6:79234173-79234195 TGTGAAGGGAAAACAGCGAGAGG - Intronic
1011167271 6:84463185-84463207 TGGGAATGGAAACCAGCTTCGGG - Intergenic
1012377606 6:98581210-98581232 TTTTAATGCAAAACAGCCACAGG + Intergenic
1012697539 6:102407118-102407140 TGTGAATGGAAATCAGAGAAGGG - Intergenic
1013377026 6:109527150-109527172 TGTGACTGTAAGGCAGCCCCTGG - Intronic
1013611466 6:111799873-111799895 CGTGCAGGGAAGGCAGCCACGGG + Intronic
1014066653 6:117134873-117134895 TGTGAGTGGGATGTAGCCACTGG + Intergenic
1014078293 6:117263035-117263057 TGTGAATGTAAAGCAGCCTTAGG + Intergenic
1014175978 6:118331840-118331862 TGCGAATGAAAAGCTTCCACTGG + Intergenic
1014278659 6:119416908-119416930 TGGGAAGGGAAGGCAGCCAGTGG - Intergenic
1015001699 6:128224640-128224662 TGTTAATGGAAAGAAGACTCAGG - Intronic
1017017183 6:150110910-150110932 TGTGAATGGAAAGTAGGGACGGG - Intergenic
1017692808 6:156983942-156983964 TGTAGATGGAAAGCAAACACAGG - Intronic
1018486342 6:164244597-164244619 TGTGGAGAGAAAGCAGACACTGG - Intergenic
1018863619 6:167731212-167731234 TGTCAATTGAATGCAGGCACCGG + Intergenic
1018886186 6:167940164-167940186 TGAGAGTGGAAACCATCCACAGG + Intronic
1019217039 6:170450598-170450620 TGTGATTGCAAAGCTGTCACAGG - Intergenic
1019477190 7:1249659-1249681 TGGCACTGGAAAGCACCCACCGG + Intergenic
1019942990 7:4305871-4305893 TGTGATTTGAAGACAGCCACAGG - Intergenic
1021585291 7:22201293-22201315 TCTGAATGGGATGCAGCCAGTGG - Intronic
1023127196 7:36966126-36966148 TCTGAAAGGAAGGCAGCCAGAGG - Intronic
1023489430 7:40722562-40722584 TGTGATTTGAAAACAGCCAGTGG - Intronic
1023708603 7:42968203-42968225 TGGGAATGGAAAGGAGGCAGTGG - Intergenic
1023923067 7:44645054-44645076 TGTTGATGGAAGGCGGCCACAGG + Intronic
1024971473 7:55075296-55075318 AGTGAATGAAAAGTGGCCACCGG - Intronic
1025023491 7:55497719-55497741 ACTGAATTGGAAGCAGCCACCGG + Intronic
1028519915 7:91718346-91718368 TATGAGAGGAAAGCAGACACTGG - Intronic
1029652129 7:101900694-101900716 TGAGAAGGGAACACAGCCACAGG + Intronic
1032392377 7:131563991-131564013 TGAGAATGGAAAGCAGCTTGGGG - Intergenic
1032802449 7:135327811-135327833 TGTGGGTAGCAAGCAGCCACAGG - Intergenic
1033069246 7:138186965-138186987 GATGAATGGAAAGAAGTCACTGG + Intergenic
1036696144 8:10976364-10976386 AATGAAGGGAAAGCTGCCACCGG + Intronic
1036980934 8:13469117-13469139 TGGGAATAAAAAGCAGACACAGG - Intronic
1039521640 8:38176773-38176795 TGCGAATGGAGAGCAGCGAAGGG - Exonic
1041141360 8:54823169-54823191 TGTAAAGGGACAGCACCCACCGG - Intergenic
1044498479 8:92921062-92921084 GAAGAATGGAAAACAGCCACAGG - Intronic
1046721697 8:117627373-117627395 TGTAACGGGAAAGCAGCCATAGG + Intergenic
1048340512 8:133534999-133535021 AGTGAAAGGAAGGCAGACACAGG + Intronic
1048650741 8:136474003-136474025 TTTGAATGGAAAGCAGGCATAGG + Intergenic
1048741701 8:137567891-137567913 TAGGAATGGAAAGCATCCCCTGG + Intergenic
1051005962 9:12345005-12345027 TGTTAAGTGAAAGAAGCCACAGG + Intergenic
1051730496 9:20137790-20137812 GTTGAATGAAAAACAGCCACAGG + Intergenic
1053024899 9:34721240-34721262 TGTTAATGGAAAACATCCAGTGG - Intergenic
1054707118 9:68473929-68473951 TGCTAAGGGAAAGCAGCCATGGG - Intronic
1056558878 9:87712371-87712393 TGTGAGGGGGAAGAAGCCACAGG + Intergenic
1057416459 9:94867996-94868018 TCAGAATGGAAAACAGCCAGGGG - Intronic
1058447197 9:105064599-105064621 TGTGTCTGGGAATCAGCCACTGG + Intergenic
1058704049 9:107624337-107624359 TGTGAAGGGAAGGCAGCCCCAGG + Intergenic
1058879072 9:109271121-109271143 TGTGAATGCACACCAGCCACAGG - Intronic
1062662312 9:137644207-137644229 TATGGCAGGAAAGCAGCCACGGG + Intronic
1187716574 X:22108124-22108146 TGTGAATGCAAAAGAGCCAAAGG + Intronic
1193299745 X:79876136-79876158 TGTGGATAGAAAGAAGCCAGTGG + Intergenic
1194296838 X:92136589-92136611 TGTGGGATGAAAGCAGCCACAGG - Intronic
1199565037 X:149206921-149206943 TGAGAATGGAAGGCAGACAGTGG + Intergenic
1200305542 X:155022750-155022772 TATCAGTGGGAAGCAGCCACAGG + Exonic
1200614352 Y:5361166-5361188 TGTGGGATGAAAGCAGCCACAGG - Intronic
1200762528 Y:7053415-7053437 TCTGGAGGGAAAGCAGGCACTGG - Intronic
1202072048 Y:21002109-21002131 TTTGAATGGAAACCAGTCACTGG + Intergenic