ID: 935041807

View in Genome Browser
Species Human (GRCh38)
Location 2:99437458-99437480
Sequence GAGGGTAGTAAGGAAGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935041807 Original CRISPR GAGGGTAGTAAGGAAGTATC TGG (reversed) Intronic
900389292 1:2427128-2427150 CAGGGTAGCAGGGAAGTAGCAGG + Intronic
900909726 1:5586549-5586571 GAGGAGAGTTAGGAAGTGTCTGG + Intergenic
902949390 1:19870007-19870029 GAGGGGAGGACGGAAGCATCAGG - Intergenic
903326382 1:22571103-22571125 TAGGGTAGTGAGGAATTGTCAGG + Intronic
905022595 1:34828134-34828156 GAGGGTAGTAAGGGAAGATGAGG - Intronic
907113916 1:51951882-51951904 GAGGGTAGAAAAGAAGTCACTGG + Intronic
908491444 1:64648179-64648201 CAGGGTAATAAGGAAGAACCTGG - Intronic
908521804 1:64951332-64951354 CAGTGGAGTAAGGAAGGATCAGG - Intronic
910291349 1:85603082-85603104 AAGGGGACTAAGCAAGTATCAGG - Intergenic
911271423 1:95806316-95806338 GAGGGAAGTAAAGTAGTAGCAGG - Intergenic
911372504 1:97010936-97010958 GAGGGAAGGAAGGAAGGGTCTGG - Intergenic
911440049 1:97914660-97914682 GATGGTACAAAGGAAGTATATGG - Intronic
917526335 1:175791648-175791670 GAGGGTAGTAGGGAAGAGACCGG + Intergenic
918241813 1:182627036-182627058 GAGGGTACAAGGGAACTATCTGG - Intergenic
919529630 1:198700877-198700899 GAGGGAAGGTAGGAAGTTTCGGG + Intronic
922669946 1:227501977-227501999 GAGCGGAGGCAGGAAGTATCAGG - Intergenic
924046033 1:240031709-240031731 GAGAGTAGTGAGAGAGTATCAGG - Intronic
1064161624 10:12951484-12951506 CAGGGTGGACAGGAAGTATCAGG + Intronic
1067399265 10:45956028-45956050 GAGAGAAGTAATGAAGCATCTGG + Intergenic
1067867584 10:49925244-49925266 GAGAGAAGTAATGAAGCATCTGG + Intronic
1070228900 10:74542645-74542667 GAGGGTAGGTAGGAAGAAACAGG - Intronic
1070286593 10:75087936-75087958 GAGGGCAGGAAGGAGGTCTCGGG + Intergenic
1075934632 10:126328951-126328973 GAGGGTAGGAAGGAGGAAGCTGG + Intronic
1076834051 10:133012122-133012144 GAGGGCAGTGAGGAGGGATCTGG + Intergenic
1078619573 11:12894563-12894585 GAAGGTAGGAAGCAGGTATCTGG + Intronic
1079301656 11:19284132-19284154 GAGGGGAGGAAGGAAGTCACTGG - Intergenic
1080986049 11:37467461-37467483 GAGTGCAGCAAGGAAGTATTAGG + Intergenic
1090826578 11:130391407-130391429 GGGGGTTGTAAGGACATATCTGG + Intergenic
1095102228 12:38197139-38197161 GAGTGGAGGCAGGAAGTATCAGG - Intergenic
1095821793 12:46486603-46486625 GATGGTGGGAAGGAAGTACCAGG + Intergenic
1096889479 12:54753668-54753690 GAGGCTAGGAAGGAAGGATGAGG - Intergenic
1099337207 12:81377811-81377833 CACTGAAGTAAGGAAGTATCAGG - Intronic
1099753745 12:86812816-86812838 CAGTGGAGTAAGGAAATATCAGG + Intronic
1101824290 12:108208639-108208661 GAGGGTACAAAGGGAGTATCAGG + Intronic
1102739821 12:115197202-115197224 CAGGGTTGCAAGGAAGCATCAGG - Intergenic
1105251706 13:18704687-18704709 CAGGGAAGTAAGAAAGGATCGGG - Intergenic
1106027753 13:25971481-25971503 GAGGGTAGGAAAGAAGGAACAGG - Intronic
1108444311 13:50491927-50491949 GGGGGCAGTAAGGAGATATCTGG + Intronic
1109113750 13:58354943-58354965 GAGAGAAGGAAGGAGGTATCAGG - Intergenic
1109248732 13:59991454-59991476 AAGGGAAGTCAGGAAGTGTCAGG - Intronic
1111578414 13:90189923-90189945 GTGGGGAGCAAGGGAGTATCTGG + Intergenic
1114386928 14:22265291-22265313 GAGGGGAGTGAGGGAGTTTCAGG + Intergenic
1117464096 14:55975154-55975176 GATGGCAGTAAGGAAGTTTCAGG + Intergenic
1118063858 14:62169108-62169130 GAGGATAGTAAGGAAGCAGGAGG + Intergenic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1121792219 14:96707246-96707268 GAGGGAAGAAAGGAAGACTCAGG + Intergenic
1123986300 15:25649297-25649319 TAGGGTAGGAAGGAAGCAGCAGG - Intergenic
1124211904 15:27770710-27770732 GAGGGAAGTAAGAAAGGAGCGGG - Intronic
1127787177 15:62365869-62365891 GAGGGCAGGAAGAAAGTCTCGGG - Intergenic
1128067140 15:64772408-64772430 GAGGGCAGTAAGGAATTAAGGGG - Intronic
1129479360 15:75810781-75810803 CAGGAGAGAAAGGAAGTATCAGG - Intergenic
1130375207 15:83322849-83322871 GAGGGGAATAAGGGAGTCTCTGG + Intergenic
1130987548 15:88854647-88854669 GAAGGAAGGAAGGAAGTATAGGG - Intronic
1131206003 15:90447985-90448007 GAGTGTGTTCAGGAAGTATCAGG + Intronic
1136470217 16:30474564-30474586 CAGGGGAGTAAGGGAGTGTCAGG - Intronic
1137022558 16:35442960-35442982 CAGGGTAGGAAGGAAGGCTCAGG + Intergenic
1138410858 16:56838909-56838931 GGGGGTAGTAAGAGTGTATCAGG - Intronic
1138696403 16:58817531-58817553 GATAGTGGTAAGGAATTATCTGG - Intergenic
1142104352 16:88294334-88294356 GAAGGAAGTAAGGAAGGAGCGGG - Intergenic
1144449983 17:15368789-15368811 CAGGGTAATAAGGAAATACCAGG + Intergenic
1146113351 17:30111911-30111933 GAGGGTAGTAACCAAGTTTAAGG - Intergenic
1146511081 17:33449265-33449287 GAGGGGAGGAAGGAAGCAGCTGG - Intronic
1148071106 17:44909139-44909161 GAAGGAAGGAAGGAAGGATCAGG + Intronic
1149667517 17:58376015-58376037 GAGGGCAGGAAGGAGGTGTCTGG + Intronic
1149730721 17:58943561-58943583 GAGGGTAGAAAGGAAGGAGGAGG - Intronic
1158367578 18:56755807-56755829 GAGGGTAATAAAGATTTATCTGG - Intronic
1161701515 19:5798415-5798437 GAGGGAAGGAAGGAAGGATAAGG - Intergenic
1163576355 19:18113103-18113125 GAGGGGAGGGAGGAAGTATCTGG + Intronic
1164084137 19:21886400-21886422 AAGGAATGTAAGGAAGTATCAGG + Intergenic
1164517567 19:28949082-28949104 GAAGGAAGGAAGGAAGAATCAGG - Intergenic
1165786093 19:38462864-38462886 GAGAGTATTAAGGAATTATCTGG - Intronic
1167696321 19:51017405-51017427 GAGGGTGGTAGGGAAATATTGGG + Intronic
925730042 2:6913217-6913239 GAGGGCTGTGAGGAAGAATCTGG + Intergenic
927013006 2:18926144-18926166 GAGGGGATGAAGGAAGTAACTGG - Intergenic
928918214 2:36497326-36497348 GAGCGTAGAAGGCAAGTATCAGG - Intronic
929950321 2:46405234-46405256 GAGGAAGGTAAAGAAGTATCAGG + Intergenic
932715473 2:74098147-74098169 GAGGGTAGTCTGGCAGTATGTGG + Intronic
935041807 2:99437458-99437480 GAGGGTAGTAAGGAAGTATCTGG - Intronic
935812273 2:106810082-106810104 GAGGATAGCAAGGATGTATAGGG - Intronic
942172383 2:173300736-173300758 GAGAGTAGAAAGGAAGAAACTGG - Intergenic
942255049 2:174088615-174088637 GAGGTTATTAAGGAAGTCTGTGG + Intronic
945496405 2:210512001-210512023 GTGGGTGGTAAGGAAATATCAGG - Intronic
945557606 2:211298664-211298686 GAGGGGAGGAGGGAGGTATCCGG + Intergenic
1169460498 20:5790229-5790251 TAGGGGAGGAAGGAAGTTTCAGG - Intronic
1171817748 20:29803465-29803487 GAGCGGAGGTAGGAAGTATCAGG + Intergenic
1171900489 20:30851806-30851828 GAGCGGAGGTAGGAAGTATCAGG - Intergenic
1174935968 20:54869063-54869085 GCAGGTAGGATGGAAGTATCTGG - Intergenic
1176837232 21:13804573-13804595 CAGGGAAGTAAGAAAGGATCGGG - Intergenic
1180191342 21:46165082-46165104 AAGGATAATAAGGAAGTATTAGG + Intronic
1181271619 22:21661933-21661955 GAGGATAGAAAGGAAATCTCAGG + Intronic
1181406003 22:22685625-22685647 GAGGGTAGGCAGGGTGTATCTGG - Intergenic
950245430 3:11412205-11412227 GAGAGGGGTAAGGAAGCATCTGG + Intronic
951480774 3:23159997-23160019 GAGGGAAGTAATGACGTGTCAGG + Intergenic
953330657 3:42050437-42050459 GAGGGTAGTAAGGGAGAATCAGG - Intronic
957657030 3:83093468-83093490 GAAGGTAATCACGAAGTATCAGG - Intergenic
961562245 3:127738616-127738638 GAGGTTAGAAAGGGATTATCTGG + Intronic
965672408 3:171160176-171160198 GATGGTAGGAAAGAAGTATTCGG + Intronic
966231283 3:177655269-177655291 GAGGATAGAAAGGGAGGATCTGG - Intergenic
966549648 3:181190415-181190437 GAGGATAGTAAGAAAGTAGTTGG - Intergenic
969180016 4:5433179-5433201 GAGGATAGAGAGGAAGTTTCTGG + Intronic
977035280 4:91943419-91943441 TAGGGTAGTAAGGGAATAACTGG + Intergenic
979549283 4:121972419-121972441 GAATGTAGCAAGGAAGTATTAGG - Intergenic
980933916 4:139208091-139208113 GAGGAAAGGAAGCAAGTATCTGG + Intergenic
981404701 4:144354613-144354635 GACTGGAGTATGGAAGTATCTGG + Intergenic
983714862 4:170768267-170768289 GAGGGTTGTTAGGAGGTATTAGG - Intergenic
984019667 4:174469867-174469889 GAGGGTAGTAAAGAAGAGTGTGG + Intergenic
985750830 5:1673327-1673349 GAGGGTGGCACGGAAGTGTCAGG - Intergenic
989397108 5:40969036-40969058 GCGGGAAGTAAGGAAGTAGATGG - Intronic
990725217 5:58745507-58745529 GATGGAAGAATGGAAGTATCAGG - Intronic
991299859 5:65119825-65119847 GAGGGAAGGAAGGAGGTAGCAGG - Intergenic
993508714 5:88744748-88744770 AAGGGTAATAAAGAAGTAGCAGG - Intronic
995260286 5:110096035-110096057 GAGGGAAGGAAGGAGGTACCAGG + Intergenic
996316008 5:122161412-122161434 GAGAGTAGAAAGGAAGGATAAGG + Intronic
997239719 5:132297377-132297399 GAGGGAAGGAAGCAAGTACCAGG + Intronic
997439547 5:133899547-133899569 GAGGGGAGAAAGAAAGTACCAGG - Intergenic
999590307 5:153137836-153137858 GAGAGAAGCAAGGAAGTATTTGG + Intergenic
1000181692 5:158817696-158817718 GAGGAGAGTAATGAAGTGTCAGG - Intronic
1000889769 5:166788517-166788539 AAGAGTTGTAAGGAAGTTTCAGG - Intergenic
1003313604 6:4990942-4990964 AAGGATAGTAAGGAAATATTAGG - Intergenic
1006259362 6:32854848-32854870 GAAGGGAGTAAGGCAGCATCTGG - Intronic
1009963856 6:70556965-70556987 GTGGGTGGAAAGGAAGTAACAGG - Intronic
1012662656 6:101922048-101922070 AAAGGTAGGAAGGAAGAATCTGG - Intronic
1013549638 6:111194856-111194878 GAGCCTAGCAAGGAAATATCTGG - Intronic
1016632846 6:146252020-146252042 GAGGGATGTAAGGAAGTGTCAGG - Intronic
1017056944 6:150445133-150445155 GAAGATAGTAAGGAATAATCAGG + Intergenic
1020478104 7:8623028-8623050 CAGAGTGGTAAGGAAGTATGTGG + Intronic
1021947340 7:25741191-25741213 AAGGGTAGTTAGTAAGTATTGGG - Intergenic
1022011376 7:26310651-26310673 GAGGGGACTGAGGAAGGATCTGG + Intronic
1022301067 7:29103042-29103064 GAGGGTGGAAAGGAAGACTCAGG - Intronic
1023265273 7:38398546-38398568 AAGGGTAGTGAGGAAGTAGGGGG + Intronic
1024180967 7:46894507-46894529 CAGGGTAGTAAATAAGTCTCAGG + Intergenic
1024205311 7:47154421-47154443 GGGGGTAATAAGGAAATATCAGG - Intergenic
1025854622 7:65266477-65266499 GGGGGCAGTCAGGAAGGATCTGG - Intergenic
1027402457 7:77822700-77822722 GAGGGCAGCATGGAAGTACCTGG - Intronic
1028354473 7:89888747-89888769 AATGGTAGTAAAGTAGTATCTGG - Intergenic
1031021703 7:116635733-116635755 GTGGGGAGTAAAGAAGAATCAGG + Intergenic
1032209389 7:129899317-129899339 GATGGTAGTTAGAAAGTAACTGG - Intronic
1036764959 8:11543606-11543628 GGGTGTCGTAAGGAAGGATCCGG + Intronic
1038994530 8:32906844-32906866 GAGAGTAGGAAGGAAGAATCAGG - Intergenic
1041988071 8:63950823-63950845 AGGGGTTATAAGGAAGTATCTGG + Intergenic
1042074865 8:64981278-64981300 GAAGGTAGTGAGGAAGAATGGGG + Intergenic
1046696331 8:117343958-117343980 GAGTGTAGTAAGTGAGCATCTGG + Intergenic
1047689992 8:127342180-127342202 AAGGGGAGTAAGCAAGTATTTGG + Intergenic
1047928593 8:129704383-129704405 GAGGGAAGGAAGGAAGGAACAGG - Intergenic
1047964460 8:130035735-130035757 GAGACTGGTAAGAAAGTATCTGG - Intergenic
1052881319 9:33602472-33602494 GAGGGTGGAAAGGCTGTATCTGG - Intergenic
1053336049 9:37272561-37272583 GAGGGGAGGAATGAAGTATGTGG - Intronic
1053494999 9:38543370-38543392 GAGGGTGGAAAGGCTGTATCTGG + Intronic
1056343762 9:85668336-85668358 GATTGTATTAAGTAAGTATCAGG + Intronic
1057064721 9:92038117-92038139 GAGGGTAGAAAGGAAGATGCTGG - Intronic
1057561866 9:96134308-96134330 GAGAGTAGTGAGGAAGTACTGGG - Intergenic
1060804526 9:126566167-126566189 CAGGGTAGAAGGGAAGTGTCAGG + Intergenic
1061469595 9:130813711-130813733 CAGCGAAGTAAGTAAGTATCTGG + Intronic
1061840987 9:133358469-133358491 GTGTGTATTAGGGAAGTATCGGG + Intronic
1187036994 X:15550609-15550631 GAGGTTGTTAAGGAAGTATGAGG + Intronic
1187044401 X:15632155-15632177 GAGGGGAGGAAAGAAGTATCAGG + Intronic
1187178487 X:16918768-16918790 GAGGGTAGGAAGGGTGTATGGGG + Intergenic
1187363077 X:18645776-18645798 GAGGATGGGAAGGGAGTATCGGG - Intronic
1192036112 X:67564669-67564691 GAGAGTAGCATGGAAGTGTCAGG + Intronic
1192696248 X:73419058-73419080 TAGGGTAGCTAGGAAGTGTCTGG - Intergenic
1193089458 X:77478403-77478425 GAGAGTAGAAAGGAAGAATCAGG - Intergenic
1193413801 X:81197557-81197579 GAGGAAAGTGAGGAATTATCAGG + Intronic
1193516478 X:82471934-82471956 GATTGTAGTAAGGTATTATCAGG - Intergenic
1194488658 X:94518854-94518876 GAGGAGAGGAAGCAAGTATCAGG + Intergenic
1195273741 X:103257871-103257893 GAGGGTAGGGAGCAAGGATCAGG + Intergenic
1196316700 X:114234903-114234925 GAGGGTAGTATTTAAGTGTCTGG - Intergenic
1196580517 X:117374038-117374060 GAGGGTAGTAACTAAATATAGGG - Intergenic
1198276010 X:135097165-135097187 GGGGGAAGCAAGGACGTATCTGG - Intergenic
1200037734 X:153344320-153344342 GAGGGTAGGAAGGCAGCAGCTGG - Intronic
1200204774 X:154307972-154307994 GAGGGTAGGAAGCAAGAAGCAGG + Intronic