ID: 935041897

View in Genome Browser
Species Human (GRCh38)
Location 2:99439113-99439135
Sequence GGACACACTCCTAGCTCTAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935041897_935041901 4 Left 935041897 2:99439113-99439135 CCATTAGAGCTAGGAGTGTGTCC 0: 1
1: 0
2: 1
3: 5
4: 101
Right 935041901 2:99439140-99439162 AAAATGGCAGTGCTCCCTCTGGG 0: 1
1: 0
2: 0
3: 20
4: 211
935041897_935041900 3 Left 935041897 2:99439113-99439135 CCATTAGAGCTAGGAGTGTGTCC 0: 1
1: 0
2: 1
3: 5
4: 101
Right 935041900 2:99439139-99439161 AAAAATGGCAGTGCTCCCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 176
935041897_935041902 10 Left 935041897 2:99439113-99439135 CCATTAGAGCTAGGAGTGTGTCC 0: 1
1: 0
2: 1
3: 5
4: 101
Right 935041902 2:99439146-99439168 GCAGTGCTCCCTCTGGGATGCGG 0: 1
1: 0
2: 4
3: 30
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935041897 Original CRISPR GGACACACTCCTAGCTCTAA TGG (reversed) Exonic