ID: 935041897

View in Genome Browser
Species Human (GRCh38)
Location 2:99439113-99439135
Sequence GGACACACTCCTAGCTCTAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935041897_935041901 4 Left 935041897 2:99439113-99439135 CCATTAGAGCTAGGAGTGTGTCC 0: 1
1: 0
2: 1
3: 5
4: 101
Right 935041901 2:99439140-99439162 AAAATGGCAGTGCTCCCTCTGGG 0: 1
1: 0
2: 0
3: 20
4: 211
935041897_935041902 10 Left 935041897 2:99439113-99439135 CCATTAGAGCTAGGAGTGTGTCC 0: 1
1: 0
2: 1
3: 5
4: 101
Right 935041902 2:99439146-99439168 GCAGTGCTCCCTCTGGGATGCGG 0: 1
1: 0
2: 4
3: 30
4: 357
935041897_935041900 3 Left 935041897 2:99439113-99439135 CCATTAGAGCTAGGAGTGTGTCC 0: 1
1: 0
2: 1
3: 5
4: 101
Right 935041900 2:99439139-99439161 AAAAATGGCAGTGCTCCCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935041897 Original CRISPR GGACACACTCCTAGCTCTAA TGG (reversed) Exonic
903499253 1:23792592-23792614 GGACACACTCCTGGCCCAAGAGG - Intronic
907873327 1:58463146-58463168 GGACACACTCTTGACTCCAAAGG - Intronic
910278976 1:85477387-85477409 GGACACTCTTCTAGTTGTAAAGG - Intronic
916115830 1:161484427-161484449 GTTCACAGTCCTAGATCTAAAGG - Intergenic
916174941 1:162030376-162030398 AGACATACTCCTAGCTCTCTGGG - Intergenic
916491354 1:165305065-165305087 AGACACACTCCTTGATCTCAGGG - Intronic
919973809 1:202598069-202598091 CCACACACTCCTTGCTCTCAAGG - Intronic
920340165 1:205270672-205270694 GGACACAATCCCGGCTCTGAAGG - Intronic
921164744 1:212498724-212498746 GGTCTCAGTCCCAGCTCTAAAGG + Intergenic
921290171 1:213649718-213649740 AGACACAGTCCTAGCTCTCGAGG - Intergenic
922696297 1:227732713-227732735 GGACACAGTCCAAGCTGCAAAGG + Intronic
923428475 1:233895764-233895786 TGAGACACTCCTTTCTCTAAGGG + Intergenic
1072186149 10:93041016-93041038 GGACACACACCTAAGTCAAATGG - Intronic
1072288682 10:93941857-93941879 TAACTCACTCCTAGCTCTCAAGG - Intronic
1074759408 10:116655087-116655109 GGACTCATTCCTGGCTCTGAAGG - Intergenic
1076555438 10:131318210-131318232 GGACAAGCTCCTGGCTCTGAGGG + Intergenic
1080601612 11:33826314-33826336 GGACAAAGTCCCAGCTCTCATGG + Intergenic
1082812046 11:57484349-57484371 GGACTCCCTCCAAGCACTAAGGG + Intergenic
1089751882 11:120657553-120657575 GGACACAGTCCTTGCCCTTAAGG + Intronic
1090181365 11:124702978-124703000 AGACACACTCCTATCTCAGAAGG + Intergenic
1091044534 11:132313861-132313883 GGAGACTGTCCTGGCTCTAAAGG + Intronic
1099215899 12:79853130-79853152 GGTCACACTCATAGCTGCAAAGG - Intronic
1100001538 12:89842915-89842937 GGACACACTCCTCCTTATAAAGG + Intergenic
1101899286 12:108779326-108779348 GGACCCACTTCTTGCTCCAAAGG - Intergenic
1107583984 13:41823999-41824021 GGAAACACTGCTAGCTCAGAAGG + Intronic
1107720135 13:43239523-43239545 GGACACACCCTTGACTCTAATGG - Intronic
1116993558 14:51300275-51300297 GTAAACACTCCTAGCTGCAAGGG + Intergenic
1119483038 14:74971154-74971176 GGCCACACTCCTAAATGTAAAGG - Intergenic
1124902495 15:33837308-33837330 GGGCACCCTCCTAGGTCTAAGGG + Intronic
1127966947 15:63929636-63929658 GGACACCCTCATGGATCTAAGGG + Intronic
1129331546 15:74830389-74830411 TGACACACTCTTAGCCCTCATGG - Exonic
1130516554 15:84630327-84630349 GGAGACACTCCTTCCTCTTAAGG - Intergenic
1139325267 16:66147836-66147858 AGACACACTCCCTGCTCTCATGG + Intergenic
1150759179 17:67944887-67944909 GTACACTCTCCTAACTCTAGAGG - Intronic
1150898385 17:69240161-69240183 GCACATTCTCCTAGCTCTTATGG + Intronic
1151226322 17:72650857-72650879 GGACACACTCGTGGCCCTGAAGG + Intronic
1151314870 17:73315663-73315685 AGACACACGCCTAGGCCTAAAGG - Intergenic
1154092597 18:11379094-11379116 GGACACACTCGTAGCTGCAGAGG + Intergenic
1156827996 18:41456176-41456198 GGCCATACTCCTAGCTCTAAGGG - Intergenic
1158819521 18:61143494-61143516 GGACACACTGCTAGGTCTTGAGG + Intergenic
1161434820 19:4256930-4256952 GGACAAGCTACTTGCTCTAATGG - Intronic
1165762817 19:38332020-38332042 CCACACACTGCTAGCTCTAAGGG - Intergenic
1166675668 19:44739125-44739147 GGACAGACTCCTCCCTCTCAGGG - Intergenic
926940555 2:18131732-18131754 GAACCCACTCCCAGCTCTAGAGG - Intronic
929872730 2:45772411-45772433 GGACAGTCTCCTATCTCCAAGGG + Intronic
930302824 2:49638548-49638570 GGACACAGGCCTAGCTCCAGGGG + Intergenic
934917170 2:98309559-98309581 GGACACACTCCCAAATCCAATGG - Intronic
935041897 2:99439113-99439135 GGACACACTCCTAGCTCTAATGG - Exonic
937242717 2:120472853-120472875 GGACACACTGGTAGCTCCAGAGG + Intergenic
940989751 2:160085472-160085494 GTTCACAGTCCTAGATCTAAAGG - Intergenic
942250155 2:174040430-174040452 GGACAGTCACTTAGCTCTAATGG - Intergenic
943594509 2:189839746-189839768 GGACAAGGTCCCAGCTCTAAAGG - Intronic
1169862831 20:10170896-10170918 AGACAAAGTCCTTGCTCTAAGGG + Intergenic
1174062797 20:47844379-47844401 GGACTCTCTCCTAGCTCTGGAGG - Intergenic
1176365849 21:6032359-6032381 GGACACACCACAAGCTCCAAGGG - Intergenic
1177125170 21:17185024-17185046 GGACTCAAACCTAGCTTTAAAGG - Intergenic
1177241328 21:18462147-18462169 AGACAAACTCTTAGCTCTCAAGG + Intronic
1179406625 21:41131780-41131802 GGACACACTCCAAGCCCAGAAGG - Intergenic
1179757667 21:43506186-43506208 GGACACACCACAAGCTCCAAGGG + Intergenic
1182127421 22:27826197-27826219 AGACACACTCCTAGTCCTTAAGG - Intergenic
1185331208 22:50252789-50252811 GGCCCCCCTCCTGGCTCTAAGGG + Intronic
950545099 3:13633564-13633586 GGACAGCCTCTTAGCTCTGAAGG - Intronic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
959349421 3:105242456-105242478 GGACACAGTGCTAGATCTAAAGG + Intergenic
962359494 3:134725908-134725930 GGACACCATCCTGGCTCTAGTGG - Intronic
962431140 3:135321100-135321122 TGACACACTCCCAGCTCAAGAGG + Intergenic
962601104 3:136991374-136991396 GGACAAAGTCCTTGCTCTCATGG - Intronic
964186754 3:153954856-153954878 GTAGACAATGCTAGCTCTAAAGG - Intergenic
965290850 3:166877705-166877727 GGAGACATTCTTAACTCTAAGGG + Intergenic
973166448 4:47083856-47083878 AGACACACCCCTATGTCTAAGGG + Intronic
973324599 4:48846082-48846104 GGACACACTCTTTACTCTCATGG - Intronic
976561429 4:86505997-86506019 AGACATACTCCTTGCCCTAAAGG + Intronic
976601428 4:86941153-86941175 GGATAGTCTCCTAGCACTAAGGG - Intronic
979833373 4:125329304-125329326 GGACACATTGCTAGATCCAATGG + Intronic
982344828 4:154345690-154345712 AGACACAGTCCTTGCTCTCATGG - Intronic
990996856 5:61741019-61741041 GGACAACCTCCAAACTCTAAGGG - Intronic
995764934 5:115604205-115604227 AGACACAGTCCTAGTTCTCATGG + Intronic
997525573 5:134550959-134550981 GGACACTCTCCTAACTCGACCGG - Intronic
998063656 5:139139051-139139073 TGCCACTCTCCTACCTCTAAGGG + Intronic
999510842 5:152250186-152250208 GGAAACACATCTAGCCCTAAAGG + Intergenic
1000393933 5:160753077-160753099 TGGCACACTCCTAAATCTAATGG - Intronic
1001015359 5:168136217-168136239 GGACACACTCGTAGGGCTTAGGG - Intronic
1001710037 5:173771199-173771221 AGACACACTCCAAGCTCGTATGG + Intergenic
1002592792 5:180302858-180302880 AGACTCACTCCTAACTCTAGCGG + Intronic
1002702031 5:181130992-181131014 GGACACAGTCCTTGCTCAAGGGG + Intergenic
1005726621 6:28655426-28655448 GGAGACGCTCTTAGCTCTTAGGG + Intergenic
1006134469 6:31887465-31887487 GGACACAGTCCTTGCCCTGAAGG - Intronic
1009030163 6:58047372-58047394 GGACATAATCCTTGCTCTCAGGG + Intergenic
1009205691 6:60798600-60798622 GGACATAATCCTTGCTCTCAGGG + Intergenic
1011226922 6:85118001-85118023 GGGCACACTCCTAGACCTAGGGG + Intergenic
1011747776 6:90423197-90423219 GGACACGTTTCTATCTCTAAAGG + Intergenic
1012331804 6:98000114-98000136 GGTCATACTCTTAGGTCTAATGG - Intergenic
1012901232 6:105008858-105008880 GAAACCACTTCTAGCTCTAAGGG + Intronic
1025231599 7:57206532-57206554 GGACTCTCTCCTAGCTCTGAAGG + Intergenic
1030081970 7:105786096-105786118 GGACACACACCTAGAGCTGAGGG + Intronic
1032017900 7:128391588-128391610 GGATACACTCCTATGGCTAAGGG - Intergenic
1035168687 7:157006089-157006111 GGACATAGTCCTAGCTCCCACGG - Intronic
1042287671 8:67132136-67132158 GGCCACACTCTGAGCTCTAAGGG - Intronic
1044454032 8:92370784-92370806 GGTCACAGTTCAAGCTCTAAGGG - Intergenic
1047305021 8:123645668-123645690 GGACACAAACCCAGCTCCAAAGG - Exonic
1047412400 8:124634578-124634600 GGATACACTCCTCACCCTAAGGG + Intronic
1051501641 9:17784625-17784647 GGACACAGTCCCAGCCCTCAAGG - Intronic
1057892286 9:98878482-98878504 GGACACACTCCTCTCTTCAAAGG - Intergenic
1059927279 9:119222636-119222658 GGACACAATCCTTGCTGTCATGG + Intronic
1062195343 9:135270354-135270376 GCACACACACCTTGCTTTAAAGG + Intergenic
1186607538 X:11107673-11107695 AGACAGACTCCTTGCTCTCAGGG - Intergenic
1192999923 X:76552742-76552764 GTTCACAGTCCTAGATCTAAAGG - Intergenic
1198737097 X:139798816-139798838 TGACACACACCTATCTCCAAGGG + Intronic