ID: 935044804

View in Genome Browser
Species Human (GRCh38)
Location 2:99471289-99471311
Sequence TTTTAAACACAGATGACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 279}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935044804_935044810 29 Left 935044804 2:99471289-99471311 CCCAGGGTCATCTGTGTTTAAAA 0: 1
1: 0
2: 0
3: 21
4: 279
Right 935044810 2:99471341-99471363 AGGACAATCTTTTCAACAAATGG 0: 16
1: 180
2: 1007
3: 2856
4: 4700
935044804_935044807 4 Left 935044804 2:99471289-99471311 CCCAGGGTCATCTGTGTTTAAAA 0: 1
1: 0
2: 0
3: 21
4: 279
Right 935044807 2:99471316-99471338 CTCTTCATGACCATTCAATGAGG 0: 1
1: 0
2: 1
3: 16
4: 275
935044804_935044808 9 Left 935044804 2:99471289-99471311 CCCAGGGTCATCTGTGTTTAAAA 0: 1
1: 0
2: 0
3: 21
4: 279
Right 935044808 2:99471321-99471343 CATGACCATTCAATGAGGAAAGG 0: 1
1: 9
2: 64
3: 195
4: 637

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935044804 Original CRISPR TTTTAAACACAGATGACCCT GGG (reversed) Intronic
900877608 1:5356021-5356043 ATTGAAACACAGATGTCCTTCGG + Intergenic
902526559 1:17062228-17062250 TTTTACACACAGTAGACACTTGG + Intergenic
903659877 1:24970457-24970479 ATTTAAGCAAAGATGACACTGGG - Intergenic
904229718 1:29058401-29058423 TGGTAAACACAGATGACTTTTGG + Intronic
905052692 1:35065556-35065578 CTTTAAATACAGTTGACTCTTGG - Intronic
905160217 1:36026401-36026423 ATTTAAAAACAGATGAGGCTGGG - Intronic
905662270 1:39736752-39736774 TTTTGAAGAAAGATAACCCTAGG + Intronic
905685306 1:39903096-39903118 TCTTCTACACAGATGACCTTTGG + Intergenic
907390868 1:54157439-54157461 TTTTGAACACATATGAACATGGG - Intronic
907538841 1:55193358-55193380 TTCTAAATACAGTTGTCCCTTGG - Intronic
908801344 1:67883957-67883979 TTTTAGAAACAGATCACCCAGGG + Intergenic
911554612 1:99328523-99328545 TTTTAAATGTAGATCACCCTGGG - Intergenic
911780849 1:101876117-101876139 TTTTAAACAGAGAGGTCCTTAGG - Intronic
911998795 1:104802882-104802904 TTTGAAACCCAGATCACCATGGG + Intergenic
912241117 1:107910282-107910304 TTTTAATAACTGATGACCCATGG - Intronic
913183619 1:116346207-116346229 TTTGTATCACAGATGGCCCTGGG + Intergenic
913357106 1:117934044-117934066 TTTTAACCACAAAGGACTCTTGG - Intronic
914330860 1:146670089-146670111 ATTTAAATGCAGATGACACTTGG + Intergenic
916363508 1:163997885-163997907 TTTTAAAGTCAGATGGGCCTGGG + Intergenic
918399691 1:184151370-184151392 ATGTAAACACAAATGACCCGCGG - Intergenic
918783829 1:188737742-188737764 TTTAAAATACAGTTGACCCTTGG + Intergenic
919598067 1:199589330-199589352 TTCTATACACAGATAACTCTTGG - Intergenic
919854177 1:201694426-201694448 CATTAAAGATAGATGACCCTGGG + Intronic
919885466 1:201930859-201930881 TTTTAAACACTCATTTCCCTCGG - Intronic
921718282 1:218441460-218441482 TTTTTAACACTGATGAACCAAGG - Exonic
921898290 1:220423860-220423882 TTTCAAATACAGTTGTCCCTTGG - Intergenic
923893074 1:238237156-238237178 ATATATACACAGTTGACCCTCGG - Intergenic
924406521 1:243753499-243753521 ATATACACACAAATGACCCTAGG + Intronic
924479994 1:244421312-244421334 ATTTAAACATAGTTGAACCTAGG - Intronic
1063521596 10:6746361-6746383 TCTTCAAGACAGATGAACCTTGG - Intergenic
1066702755 10:38147318-38147340 GTTTAAACACAGTCGTCCCTTGG - Intergenic
1066988122 10:42486457-42486479 GTTCAAACACAGTTGTCCCTTGG + Intergenic
1070686352 10:78485717-78485739 GTATAAATACAGTTGACCCTTGG - Intergenic
1070862122 10:79679369-79679391 TTTTAAATTAAGATGACTCTTGG + Intergenic
1070875016 10:79795087-79795109 TTTTAAATTAAGATGACTCTTGG - Intergenic
1070966256 10:80533243-80533265 TTTTAAAAATGGATTACCCTGGG + Intergenic
1071447698 10:85764182-85764204 TATTGAACACAGTTGCCCCTTGG - Intronic
1071641940 10:87317252-87317274 TTTTAAATTAAGATGACTCTTGG - Intergenic
1073201283 10:101737896-101737918 TTTTAAAAAGAGATGGCTCTGGG + Intergenic
1078775097 11:14386522-14386544 TTTTAGACATAGACAACCCTGGG + Intergenic
1079353302 11:19711689-19711711 TTATAAACAGAGATGACTTTGGG + Intronic
1080298843 11:30761110-30761132 TTTAAAACACATATGATTCTTGG + Intergenic
1080673856 11:34406087-34406109 TTTTAAAAAAAGAAGACCCAAGG - Intergenic
1081415257 11:42807232-42807254 TTCCAAACACAGATGACTTTGGG - Intergenic
1087660963 11:100987450-100987472 TTTTAAATATAGATGTCCTTAGG + Intronic
1088242463 11:107786251-107786273 TTTAAAACAAAGATGAGGCTGGG - Intergenic
1089917878 11:122176596-122176618 TTTTAAATCCTGATTACCCTTGG - Intergenic
1090969561 11:131628712-131628734 TTTTCAACTCAGGTGTCCCTTGG - Intronic
1091238757 11:134038765-134038787 TGTTAAAGACTGATCACCCTGGG + Intergenic
1092002982 12:5046169-5046191 TTTTAAAAATAGGCGACCCTTGG - Exonic
1092823360 12:12374289-12374311 TTTTAAACTAAGAATACCCTTGG - Intronic
1093118259 12:15237006-15237028 TTTTAACCACAGAGGAAACTGGG + Intronic
1095868458 12:46999259-46999281 TTTGAACCACAGTTGACCTTAGG + Intergenic
1097152445 12:56988848-56988870 CTTTAAAAAAAAATGACCCTTGG - Intergenic
1101521903 12:105491602-105491624 GTGAAAACACAGATGAACCTGGG - Intergenic
1101963482 12:109266454-109266476 TTTTAAACAAAGAAAATCCTGGG + Exonic
1102624119 12:114220732-114220754 TTCTGAAAACAGATGACCCCAGG - Intergenic
1102661937 12:114536697-114536719 TTCTAAACACCCATGACCATCGG - Intergenic
1104214245 12:126720550-126720572 TATTGAAGACAGATCACCCTTGG + Intergenic
1104533599 12:129596436-129596458 TTTTATATACAGTTGTCCCTTGG + Intronic
1105385582 13:19926259-19926281 TTTTAAAAAATGATAACCCTTGG - Intergenic
1105537614 13:21283338-21283360 TTTTAAGTACAGTTGACCCTTGG + Intergenic
1106687434 13:32075828-32075850 TTTCAAACACAGATCAGCGTAGG - Intronic
1108056203 13:46487898-46487920 TCTCCAACACAGATGACTCTCGG + Intergenic
1108418296 13:50223186-50223208 TATTCAACAGAGATGGCCCTAGG + Intronic
1108525250 13:51280760-51280782 TTTCAAACACAGGTGCCCCAGGG + Exonic
1108781463 13:53841218-53841240 TTTTCATCATAGTTGACCCTTGG + Intergenic
1111282523 13:86045373-86045395 TATTAAAAAAAAATGACCCTAGG + Intergenic
1111415300 13:87933705-87933727 TTTTATCCACAGATGACTTTGGG + Intergenic
1112808448 13:103188397-103188419 TTTTTAACACAGAGAACCCGGGG - Intergenic
1113104325 13:106756825-106756847 TTGTCAACACAGATGGCGCTGGG + Intergenic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1114340609 14:21738990-21739012 TTTTAACCACAGAAGAACCCTGG - Intergenic
1115946360 14:38665695-38665717 TGTTAAACACATATGGGCCTGGG - Intergenic
1116691404 14:48111387-48111409 ATTGATACACAGATGACTCTTGG + Intergenic
1116868230 14:50048536-50048558 TTTTCAGCACAGGTTACCCTTGG + Intergenic
1119051380 14:71372737-71372759 TTTTAAACACAGAATGGCCTGGG + Intronic
1119247169 14:73120960-73120982 TTTTAAACACTAATGAGCCAAGG - Exonic
1120612796 14:86663658-86663680 TTTTAGACTCAGAAGACTCTAGG + Intergenic
1121727030 14:96159910-96159932 TAGTAGACACAGGTGACCCTAGG - Intergenic
1122053166 14:99073999-99074021 TTTAAGACACACATAACCCTTGG - Intergenic
1123817622 15:23995860-23995882 TTTCAAACACAGAAGACACAAGG + Intergenic
1124820280 15:33038315-33038337 TTTTAAACACAGAAGATGCAGGG - Intronic
1124895968 15:33777855-33777877 TTTTACACAGAGATGAACCTAGG - Intronic
1127434790 15:58946456-58946478 TTTAAAACACAGATAACAATAGG + Intronic
1127991498 15:64121705-64121727 ATTTAAACACAAATCACTCTTGG + Intronic
1128879398 15:71229330-71229352 ATTTAAATACAGTTGTCCCTTGG + Intronic
1131286017 15:91058251-91058273 TTTTGAAGACACTTGACCCTTGG + Intergenic
1133457934 16:5959367-5959389 TTTTAATAACAGTTGACCTTTGG - Intergenic
1134314169 16:13102845-13102867 TTTTAAATTAAGATGACTCTTGG - Intronic
1135432505 16:22397659-22397681 TTTTGAAATCAGATGTCCCTAGG - Intronic
1135687556 16:24510297-24510319 ATTTATATACAGTTGACCCTTGG - Intergenic
1138004229 16:53315944-53315966 TTTTAATCAAAGATGAGGCTGGG + Intronic
1138155386 16:54698239-54698261 TTTTAATCATACATCACCCTTGG + Intergenic
1138312003 16:56033723-56033745 TTTTAAACACAGGATTCCCTGGG - Intergenic
1139493014 16:67297162-67297184 TGTTAAACAGAGCTGTCCCTGGG - Intronic
1140002694 16:71040817-71040839 ATTTAAATGCAGATGACACTTGG - Intronic
1142722609 17:1786736-1786758 TCCTAAACACTGATCACCCTTGG + Intronic
1144142007 17:12358765-12358787 TTACAACCACAGAGGACCCTGGG - Intergenic
1146150518 17:30465337-30465359 TTTTAAACACATATAACAGTAGG + Exonic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1148340272 17:46869276-46869298 TTTAAAAAACAGATGCCTCTGGG + Intronic
1148403420 17:47387890-47387912 TTTTAAACCCAGATTTGCCTTGG + Intronic
1148917237 17:50992326-50992348 GTTATAACACAGATGAACCTTGG - Intronic
1148957290 17:51364380-51364402 TGTTAAACACACCTGAGCCTGGG + Intergenic
1151529262 17:74694152-74694174 TTTTACAGACAGAGAACCCTAGG - Intronic
1156120880 18:33841449-33841471 ATTTTAACACATATCACCCTAGG + Intergenic
1156897252 18:42259791-42259813 CTTTAAACAAAAATGACTCTTGG + Intergenic
1157159662 18:45301950-45301972 TTTCAAAGACAGGTGACTCTAGG - Intronic
1158020263 18:52833388-52833410 TTCTAAACACAAATGACCACTGG + Intronic
1158039815 18:53079383-53079405 ATATAGAAACAGATGACCCTTGG + Intronic
1158211181 18:55052124-55052146 TTTTAAAAAAATATGACTCTTGG - Intergenic
1159143108 18:64420971-64420993 TTTTAAACAAATATGAGGCTTGG - Intergenic
1161942101 19:7411605-7411627 TTTTAAAAAAAGATGCCACTTGG - Intronic
1165302511 19:34979686-34979708 TTTTGACCAAAGATGACTCTTGG - Intergenic
1166001618 19:39880905-39880927 TCTTGAACACAGAGAACCCTGGG - Intronic
1166004400 19:39897156-39897178 TCTTGAACACAGAGAACCCTGGG - Intronic
1166268695 19:41700568-41700590 TTGGAATCACAGATGCCCCTTGG - Intronic
1167409603 19:49337171-49337193 TTTGCCACACAGATCACCCTGGG + Exonic
1167533561 19:50034167-50034189 TGTGAAAGACAGAAGACCCTGGG - Intronic
1167703021 19:51061761-51061783 TTTTAAAGAAAGTTGAGCCTGGG - Intronic
1168427176 19:56248131-56248153 TTTGAAACACAGATTTCCCCAGG - Intronic
925610630 2:5697925-5697947 TTTTAATCATAGATGAATCTTGG + Exonic
928740517 2:34346817-34346839 TATTAAGTACAGATGACTCTTGG - Intergenic
929725369 2:44420609-44420631 TTTTATACACAGTTGACTCCTGG - Intronic
930657506 2:54020870-54020892 TCTTTAACACAAATGACCTTTGG - Intronic
931605293 2:64046448-64046470 TTTTAAAAACAGTTGAGGCTGGG + Intergenic
932099843 2:68888845-68888867 TTTAAAACACACATGTTCCTTGG - Intergenic
932888974 2:75573939-75573961 ATTGAATCAGAGATGACCCTAGG - Intergenic
934608266 2:95714233-95714255 GTTTAAACATAGATGGCCCAAGG - Intergenic
935014874 2:99172580-99172602 TTTTAAAAAAATATGACCCCTGG + Intronic
935044804 2:99471289-99471311 TTTTAAACACAGATGACCCTGGG - Intronic
936541598 2:113356119-113356141 GTTTAAACACAGATGGCCCAAGG - Intergenic
942067391 2:172284552-172284574 TTTTAAACTCAGATGTGCATAGG - Intergenic
942259301 2:174141693-174141715 TTTTTAACAGAAATAACCCTTGG + Intronic
943218334 2:185069337-185069359 CTTTAAACACAGGTGGCCCAGGG - Intergenic
943571347 2:189578981-189579003 TTTTAAATACATATGAGCCATGG + Intronic
945227082 2:207542959-207542981 TTTGAAGCACAGTTGTCCCTTGG + Intronic
946004906 2:216516211-216516233 TTTTAAAAAAAGATGAGCATTGG - Intronic
946467132 2:219921849-219921871 TTTTAGACTCAGATGAACCTAGG + Intergenic
946651857 2:221900245-221900267 TTTTACACTCAGATGAACCAGGG - Intergenic
946677967 2:222182398-222182420 TTATAACCACAGTTGTCCCTCGG - Intergenic
946991844 2:225340887-225340909 TTTTAAAAACAAATAACCTTGGG + Intergenic
947601951 2:231457347-231457369 TTTTGAACTCAGATGATTCTAGG - Intronic
1169803172 20:9532368-9532390 TTTTAAACACAAATGCCTGTGGG + Intergenic
1170837643 20:19898259-19898281 TTTTAAACAAAGAAGTCCCCTGG - Intronic
1173154032 20:40592801-40592823 ATTGAAATACAGAAGACCCTAGG + Intergenic
1174066743 20:47871374-47871396 TTTTACAAACAGATAAACCTTGG - Intergenic
1174073423 20:47914871-47914893 TATTAAACACATATTTCCCTTGG - Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175106539 20:56619074-56619096 TTTTAAATAGAGATGAGGCTGGG - Intergenic
1176947355 21:14998961-14998983 TTGTGAATACAGTTGACCCTTGG - Intronic
1178285424 21:31321644-31321666 TTTAAAACACAGAAGAGGCTGGG - Intronic
1178713073 21:34937266-34937288 TTAAAAACACAGATGGACCTGGG + Intronic
1181666569 22:24402320-24402342 TGTTAAACACAGAATGCCCTGGG - Intronic
1181687731 22:24541245-24541267 TTTGGAGCACAGATGACTCTGGG - Intronic
1182874599 22:33680134-33680156 TTTTAAACACAGAGTTCCCTTGG + Intronic
1185099945 22:48834541-48834563 TTTAAAACATAGATGACACCTGG + Intronic
1185392813 22:50571791-50571813 CTCTAAACACAGATGGCCCCAGG + Intronic
949240109 3:1860948-1860970 ATATAATCACAGATGAACCTCGG - Intergenic
949314796 3:2740569-2740591 TTTTAAACACAGATCTTCATTGG + Intronic
949363475 3:3255926-3255948 TTTTAAAGTCAGATGACACTGGG + Intergenic
950700935 3:14745653-14745675 TTATAAATGCACATGACCCTTGG - Intronic
950955466 3:17048256-17048278 TTGAAAATACAGTTGACCCTTGG + Intronic
951002132 3:17574971-17574993 ATTTAAACACAAAACACCCTAGG + Intronic
951670790 3:25179721-25179743 TCTTAAATACACATGACTCTGGG - Intronic
954060943 3:48066752-48066774 TTTCAAATACAGTTGTCCCTCGG - Intronic
955375441 3:58392075-58392097 TTTTAAACAAAGATGAGAGTAGG + Intronic
956255260 3:67276669-67276691 TTTGAACCACAGTTGACCATGGG - Intergenic
956314385 3:67917765-67917787 TTTGGACCACAGTTGACCCTGGG + Intergenic
956397106 3:68837642-68837664 ATTCAAACACAAGTGACCCTAGG + Intronic
956764894 3:72476378-72476400 GTTTAAAAACACATGAGCCTGGG - Intergenic
956860209 3:73315760-73315782 ATTCAAACTCAGATGCCCCTTGG + Intergenic
957402535 3:79734856-79734878 TTTTAAAAATAGCTAACCCTGGG + Intronic
957892239 3:86375547-86375569 TTTCAAAAACAGATAACCTTGGG - Intergenic
958822066 3:98986961-98986983 TCTGAAACACATCTGACCCTAGG - Intergenic
959854737 3:111138380-111138402 TTTTAAAAACAGATGAAAGTTGG - Intronic
959901340 3:111665138-111665160 TGTTAAAGACAGATGAATCTAGG + Intronic
962894044 3:139698203-139698225 TTTGAAAAACAGAAGTCCCTTGG - Intergenic
964988579 3:162775500-162775522 ATTCAAACTCATATGACCCTTGG + Intergenic
966298454 3:178451408-178451430 TTTTATTAAAAGATGACCCTTGG + Intronic
966344202 3:178960408-178960430 GTTTCACCACACATGACCCTAGG + Intergenic
966898417 3:184463025-184463047 TTTTGAATACAGTTGTCCCTTGG - Intronic
967377664 3:188823378-188823400 TTTTAAAGAGAGTTCACCCTGGG + Intronic
967772295 3:193347416-193347438 TTTTAGAGTCAGATGAACCTAGG - Intronic
968909461 4:3470139-3470161 TGTTAGACACAGGTGTCCCTTGG + Intronic
970240950 4:14008313-14008335 ATTTAAATACATTTGACCCTGGG - Intergenic
971557278 4:28029671-28029693 TTTTAACCACAGTTGACCTCAGG - Intergenic
973172524 4:47163360-47163382 TTTTAATCACCGATACCCCTGGG - Intronic
974000931 4:56509966-56509988 TTTTAAAAACAGATGAACTTGGG - Intronic
975624503 4:76330856-76330878 TTCTAAACACAGTTGTCCCTTGG - Intronic
978300195 4:107259814-107259836 TTTTAAACAATGAAGACCCCAGG - Intronic
979375744 4:119944529-119944551 TTAAAAACACAGATGAGACTGGG - Intergenic
979418300 4:120471220-120471242 TATAAAACACAGATGATCATTGG - Intergenic
980272203 4:130599471-130599493 TTTTAAAGTCAGATGAACCTGGG - Intergenic
983456572 4:167972353-167972375 TTATAAACCCATATGAACCTTGG + Intergenic
983839715 4:172442072-172442094 TTTTAAACACATATGAAACAAGG + Intronic
984993040 4:185400005-185400027 TTTTAAAAACAGATGTCACGTGG + Exonic
987351649 5:17027251-17027273 TTTTAAAAACAAATGAGGCTAGG - Intergenic
987513926 5:18881148-18881170 TTTGAAACATAGATGTCCCATGG - Intergenic
988097643 5:26638165-26638187 TTTTAAACACAGTTGAGCTTTGG - Intergenic
988102367 5:26697303-26697325 TTTTATACAGAGAAAACCCTAGG + Intergenic
988484292 5:31655691-31655713 ATTTAAACACTGATGCCCCAGGG + Intronic
988617832 5:32792684-32792706 TTTTAAAGACACATGGCCATTGG - Intergenic
988964637 5:36403816-36403838 TTCTTCACTCAGATGACCCTGGG + Intergenic
992384749 5:76273716-76273738 TCTTAAAGACAGATGACTATTGG + Intronic
992918774 5:81489799-81489821 TTTTGACTACAGATGACCCTTGG - Intronic
993234781 5:85290479-85290501 TTTCAAACACAGATTACTCTTGG - Intergenic
993513729 5:88803230-88803252 TTTTAAGCACATATCACCCTAGG + Intronic
993526286 5:88969821-88969843 TTTTAGACACAGATGATGGTGGG - Intergenic
993933094 5:93967179-93967201 ATTTGAACACAGATGACATTTGG - Intronic
994994362 5:107041006-107041028 TTGTGAACAGAGATGAACCTAGG + Intergenic
995167096 5:109056416-109056438 GTCAAAACACAGATGAGCCTGGG + Intronic
995680753 5:114716748-114716770 TTTTAAACACAGAAGAGCTCAGG - Intergenic
996797020 5:127358548-127358570 TTCTAAAAACAGAAGAGCCTGGG + Intronic
997132107 5:131287293-131287315 TTTAAAATACAGCTGACCCAAGG - Intronic
997787417 5:136726172-136726194 TTTTACACACAGACTACCTTTGG - Intergenic
998081329 5:139277321-139277343 TTTTGAGAAGAGATGACCCTCGG + Intronic
998503013 5:142649984-142650006 TTTTAAAAACAAATGTCCCATGG - Intronic
1000532610 5:162442594-162442616 TTTCAAACACAGAACACCTTTGG + Intergenic
1000693791 5:164355012-164355034 TTTTAAACACAGATAACTTATGG + Intergenic
1003005631 6:2378444-2378466 TTTTAAATGCATGTGACCCTAGG + Intergenic
1004273084 6:14212107-14212129 CTTTGAACCCAGCTGACCCTGGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005637137 6:27763021-27763043 TTTTAAACACATATGAAAATGGG - Intergenic
1007905071 6:45451433-45451455 TTTGAAACCCAGATCACCTTCGG - Intronic
1008363959 6:50653960-50653982 TTTTTAAAACAGAAGACACTGGG + Intergenic
1011530421 6:88314945-88314967 TTTTAAACACAAATGGCTCCGGG + Intergenic
1012765516 6:103362706-103362728 TTGCAAACACATATGAGCCTAGG - Intergenic
1012781323 6:103561388-103561410 TTTGAAGCCTAGATGACCCTGGG - Intergenic
1012969038 6:105706922-105706944 TCCTAAATACAGTTGACCCTTGG + Intergenic
1013229040 6:108144734-108144756 TTTTAAACACAAATGGAGCTGGG + Intronic
1013341244 6:109218355-109218377 TGTGAGAAACAGATGACCCTGGG + Intergenic
1015065883 6:129026800-129026822 TTTTCAAGCCAGATGTCCCTTGG + Intronic
1016988282 6:149910966-149910988 TTTCAACCACAGATGACTTTCGG + Intergenic
1016994954 6:149954892-149954914 TTTCAACCACAGATGACTTTGGG - Intergenic
1017003654 6:150014543-150014565 TTTCAACCACAGATGACTTTGGG + Intergenic
1017007330 6:150037679-150037701 TTTCAACCACAGATGACTTTCGG + Intergenic
1017687122 6:156924630-156924652 TTTGAACCACAGTTGACCATGGG + Intronic
1019342372 7:514597-514619 TTTTAGGCACAGATGTCCCAAGG + Intronic
1021289889 7:18830153-18830175 GTTTAAAAGCAGATGACACTTGG + Intronic
1021509890 7:21424344-21424366 TTTTAAAAATTTATGACCCTGGG - Intergenic
1021532184 7:21659116-21659138 TTTTGCACACAGATGACACTCGG - Intronic
1023248965 7:38237268-38237290 TTCTAAAGACAGATGAACTTAGG + Intergenic
1023940410 7:44765599-44765621 CTTGAACCTCAGATGACCCTGGG + Intronic
1025982575 7:66418808-66418830 TTTAACACACAGAGGATCCTGGG + Intronic
1026652823 7:72230285-72230307 TTTTAAAAACAGATCAGCCTGGG + Intronic
1027429909 7:78100650-78100672 TTTTAAAAAGAGGTGGCCCTTGG - Intronic
1027785738 7:82576884-82576906 TTTTGAAGCCAGATGAACCTGGG + Intergenic
1028839731 7:95415655-95415677 TTTAAAACACAGATTGCGCTGGG + Intronic
1031439387 7:121774436-121774458 TTTTAAAAAGAGATGCCCCTTGG + Intergenic
1032618078 7:133497037-133497059 TGTTAGACAGAGATGACCCCAGG - Intronic
1034473355 7:151268401-151268423 TTACAAACTCAAATGACCCTAGG + Intronic
1035575347 8:701100-701122 TTTTAAACACACATGGCCAAGGG + Intronic
1038381980 8:27104582-27104604 TTATAAACACAGATCCCCCCTGG - Intergenic
1039039479 8:33393884-33393906 TTTTTAAAACAGATTACCTTTGG - Intronic
1041249009 8:55916879-55916901 TTTTAAAAACAGATGGGGCTGGG + Intronic
1041824825 8:62082761-62082783 TTTGAAACAAAGATGATCTTTGG + Intergenic
1042113285 8:65404430-65404452 TTTTCCACACATATGACACTAGG + Intergenic
1043589417 8:81810698-81810720 TTTTAAACTCAGAAGACACTTGG + Intronic
1043925794 8:86035501-86035523 TTCTAAACAGTGATGACACTTGG - Intronic
1045622079 8:103990956-103990978 ATTTAAAGGCAAATGACCCTAGG + Intronic
1045816499 8:106282826-106282848 TTATTAATACAGTTGACCCTTGG - Intronic
1046458133 8:114495456-114495478 TTTTAAACAATGATGACCGCAGG + Intergenic
1048017959 8:130514238-130514260 TATTAATAACAGATGAGCCTGGG + Intergenic
1050185806 9:2972122-2972144 TTTTAAAAACAGCAAACCCTGGG + Intergenic
1050237784 9:3600449-3600471 TTTTAAAAATACATGTCCCTGGG + Intergenic
1050396367 9:5201868-5201890 TTTTATACACAAATGACACCAGG + Intergenic
1050620584 9:7448129-7448151 TTTTATATACAGTTGTCCCTCGG + Intergenic
1051951955 9:22646807-22646829 TTTTAATAACAAATGACCCCAGG - Intergenic
1052225168 9:26077279-26077301 TCTTCAACACTGCTGACCCTTGG + Intergenic
1052706829 9:32003915-32003937 TTTTAAAAACATTTGATCCTTGG + Intergenic
1053266242 9:36715896-36715918 ATTTAAACCCAGATGCTCCTGGG + Intergenic
1055555499 9:77469348-77469370 TTTTTAACACAGTTTATCCTAGG - Intronic
1055685030 9:78763616-78763638 TGTTTGCCACAGATGACCCTAGG - Intergenic
1057825314 9:98368659-98368681 TTCTTATCACAGATGACCATAGG + Intronic
1059384414 9:113953072-113953094 TTTTTAATACAGTAGACCCTGGG - Intronic
1059620028 9:115993788-115993810 ACTTAAACACTGATGACCTTAGG + Intergenic
1185878432 X:3718791-3718813 TTTTAAAAACAGCTGAAACTTGG + Intergenic
1186013238 X:5161614-5161636 TTCTGAACACAGATGAACATAGG - Intergenic
1186412902 X:9359508-9359530 TTTAAAACACAGTTAAACCTTGG - Intergenic
1188254008 X:27936916-27936938 TTTTAGACAAAGATTGCCCTAGG - Intergenic
1188369488 X:29351225-29351247 TTTTAAAATGAGATGACACTTGG + Intronic
1188530676 X:31137312-31137334 TCTTAAAAAGAGATGAGCCTGGG - Intronic
1188842156 X:35029510-35029532 TTTTAAACACAGAAAACTCAGGG - Intergenic
1188895136 X:35658640-35658662 TTTTCAACCCAGATGGACCTGGG + Intergenic
1189046883 X:37602649-37602671 TTTTATACATAGATGAGCCTGGG + Intronic
1189118165 X:38365276-38365298 TGTTAAACACAGATAACACTAGG + Intronic
1189404745 X:40711066-40711088 TTTAATATACAGTTGACCCTTGG - Intronic
1190406078 X:50088944-50088966 TATTAAACACAGTTGACTGTAGG + Intronic
1192403273 X:70858619-70858641 TTTTAAACATAGAGGATGCTTGG - Intronic
1193221388 X:78930434-78930456 TTTTAAAAGCAGATCAACCTAGG + Intergenic
1193493110 X:82174245-82174267 TTTGAACCACAGTTGACCATAGG - Intergenic
1194188365 X:90803411-90803433 TTTTAAAGCCACATGAGCCTAGG - Intergenic
1196677352 X:118433948-118433970 TCTTTAACACGTATGACCCTTGG - Intronic
1197679685 X:129368923-129368945 TTTTAAACCCAGTTAAGCCTTGG - Intergenic
1198075133 X:133186732-133186754 TTTCAAACACAGATAACTGTTGG - Intergenic
1200534950 Y:4385316-4385338 TTTTAAAGCCACATGAGCCTAGG - Intergenic
1201771654 Y:17622108-17622130 GTTTCACCACAGCTGACCCTTGG - Intergenic
1201829901 Y:18283878-18283900 GTTTCACCACAGCTGACCCTTGG + Intergenic