ID: 935048080

View in Genome Browser
Species Human (GRCh38)
Location 2:99499494-99499516
Sequence CCTTCCACTCATGACTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935048077_935048080 3 Left 935048077 2:99499468-99499490 CCTGAACTAAGAAAGGAGAAAGA 0: 10
1: 3
2: 6
3: 75
4: 559
Right 935048080 2:99499494-99499516 CCTTCCACTCATGACTTTTGAGG No data
935048075_935048080 22 Left 935048075 2:99499449-99499471 CCACTTCAAGAGAGGATGTCCTG 0: 9
1: 5
2: 8
3: 26
4: 143
Right 935048080 2:99499494-99499516 CCTTCCACTCATGACTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935048080 Original CRISPR CCTTCCACTCATGACTTTTG AGG Intergenic
No off target data available for this crispr