ID: 935050251

View in Genome Browser
Species Human (GRCh38)
Location 2:99519066-99519088
Sequence CCGGCCTTTAATGCTTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935050251_935050258 14 Left 935050251 2:99519066-99519088 CCTTTAAAAGCATTAAAGGCCGG No data
Right 935050258 2:99519103-99519125 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
935050251_935050257 13 Left 935050251 2:99519066-99519088 CCTTTAAAAGCATTAAAGGCCGG No data
Right 935050257 2:99519102-99519124 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
935050251_935050260 17 Left 935050251 2:99519066-99519088 CCTTTAAAAGCATTAAAGGCCGG No data
Right 935050260 2:99519106-99519128 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
935050251_935050264 27 Left 935050251 2:99519066-99519088 CCTTTAAAAGCATTAAAGGCCGG No data
Right 935050264 2:99519116-99519138 GCACTTTGGGAGGCCGAGGCAGG 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
935050251_935050265 30 Left 935050251 2:99519066-99519088 CCTTTAAAAGCATTAAAGGCCGG No data
Right 935050265 2:99519119-99519141 CTTTGGGAGGCCGAGGCAGGCGG 0: 27065
1: 115058
2: 159548
3: 160966
4: 113080
935050251_935050262 23 Left 935050251 2:99519066-99519088 CCTTTAAAAGCATTAAAGGCCGG No data
Right 935050262 2:99519112-99519134 CCCAGCACTTTGGGAGGCCGAGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935050251 Original CRISPR CCGGCCTTTAATGCTTTTAA AGG (reversed) Intergenic
No off target data available for this crispr