ID: 935051950

View in Genome Browser
Species Human (GRCh38)
Location 2:99531590-99531612
Sequence TGTGTTGACCCGCAGTGGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935051943_935051950 18 Left 935051943 2:99531549-99531571 CCTGGACTAGGTTCCTGGTTCAT No data
Right 935051950 2:99531590-99531612 TGTGTTGACCCGCAGTGGGTCGG No data
935051945_935051950 5 Left 935051945 2:99531562-99531584 CCTGGTTCATACCCAGCATAGGA No data
Right 935051950 2:99531590-99531612 TGTGTTGACCCGCAGTGGGTCGG No data
935051940_935051950 26 Left 935051940 2:99531541-99531563 CCCTTGTTCCTGGACTAGGTTCC No data
Right 935051950 2:99531590-99531612 TGTGTTGACCCGCAGTGGGTCGG No data
935051941_935051950 25 Left 935051941 2:99531542-99531564 CCTTGTTCCTGGACTAGGTTCCT No data
Right 935051950 2:99531590-99531612 TGTGTTGACCCGCAGTGGGTCGG No data
935051946_935051950 -6 Left 935051946 2:99531573-99531595 CCCAGCATAGGATGTACTGTGTT No data
Right 935051950 2:99531590-99531612 TGTGTTGACCCGCAGTGGGTCGG No data
935051947_935051950 -7 Left 935051947 2:99531574-99531596 CCAGCATAGGATGTACTGTGTTG No data
Right 935051950 2:99531590-99531612 TGTGTTGACCCGCAGTGGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935051950 Original CRISPR TGTGTTGACCCGCAGTGGGT CGG Intergenic
No off target data available for this crispr