ID: 935053393

View in Genome Browser
Species Human (GRCh38)
Location 2:99543832-99543854
Sequence GTGCACACGCTGTTTTCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935053392_935053393 14 Left 935053392 2:99543795-99543817 CCACAGGTCTCTGGTGACGCTTG 0: 1
1: 0
2: 0
3: 12
4: 96
Right 935053393 2:99543832-99543854 GTGCACACGCTGTTTTCTCATGG 0: 1
1: 0
2: 2
3: 11
4: 97
935053390_935053393 24 Left 935053390 2:99543785-99543807 CCTGACTGTGCCACAGGTCTCTG 0: 1
1: 0
2: 1
3: 19
4: 268
Right 935053393 2:99543832-99543854 GTGCACACGCTGTTTTCTCATGG 0: 1
1: 0
2: 2
3: 11
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935053393 Original CRISPR GTGCACACGCTGTTTTCTCA TGG Intergenic
900468460 1:2837706-2837728 GTCCACAGGGTGATTTCTCAAGG - Intergenic
906698241 1:47839262-47839284 GTGCCCACTCTGCTTGCTCACGG - Intronic
917071096 1:171151912-171151934 GAACACAGGCTCTTTTCTCAGGG - Exonic
921361414 1:214333853-214333875 CTTCACAAGCTGTTTTCCCAGGG + Intronic
923519815 1:234726669-234726691 AGGAACAGGCTGTTTTCTCAGGG + Intergenic
923601681 1:235409178-235409200 GAGCACATGCTGTTTCCACAAGG + Intronic
1068274073 10:54769616-54769638 GTACACAGTCTGCTTTCTCATGG - Intronic
1068666357 10:59679780-59679802 CTGCAGAGGCTGTGTTCTCATGG - Intronic
1070582901 10:77736745-77736767 GTGCGCATTCTCTTTTCTCAGGG - Intergenic
1071851710 10:89578861-89578883 GTGAACACGGTGGTTTCCCAAGG - Intergenic
1072047652 10:91672786-91672808 CTGCATACGCTGTCCTCTCATGG + Intergenic
1075841922 10:125512090-125512112 TTGCACACACTGTTTTCTCTTGG + Intergenic
1077453482 11:2664501-2664523 GTGGGCACCCTGTTTCCTCAGGG + Intronic
1080905556 11:36541379-36541401 GTGCACAAGATGATTTCACATGG + Intronic
1081293828 11:41360659-41360681 TTGCACATGCTGTTTTCTCTGGG - Intronic
1095182588 12:39163203-39163225 GTTCACACTCTGGTTTTTCAGGG + Intergenic
1097767819 12:63545567-63545589 CTGCACATGCTGTTCTATCATGG - Intergenic
1097784182 12:63740629-63740651 CTGCACATGCTGTTCTATCATGG - Intergenic
1104544611 12:129699917-129699939 GTCCAGACGCAGTTCTCTCAGGG + Exonic
1106389213 13:29319120-29319142 ATGCACAGGCTCTTCTCTCATGG - Intronic
1108946977 13:56039084-56039106 ATGCACAAGCTGTTTTCACTTGG + Intergenic
1110074653 13:71224437-71224459 GTGCACACGCAGTCTCCTCTAGG + Intergenic
1116548242 14:46198700-46198722 GTGAGCATGCTGTTTTCACATGG - Intergenic
1119650901 14:76382138-76382160 GTGCACACACAGGTTTCCCACGG - Intronic
1120505168 14:85346720-85346742 GCGCTCAAGTTGTTTTCTCAGGG - Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1124867040 15:33502522-33502544 GATCACAAGCTGTATTCTCAAGG + Intronic
1132675633 16:1120178-1120200 ATGCAAATGCTGTTATCTCAAGG - Intergenic
1132929310 16:2450861-2450883 GGGCAGAAGCTGTTCTCTCAAGG - Intronic
1135393061 16:22110277-22110299 GTGGACAGGCTATTTTCTTACGG + Intronic
1135601566 16:23788192-23788214 GTCCACACCCTGGTTTTTCAGGG + Intergenic
1136989564 16:35143783-35143805 GTGCACGAGCTGATTTCTCAAGG + Intergenic
1139527647 16:67526694-67526716 GTGCACACCATGTGTGCTCATGG - Intronic
1144049738 17:11488209-11488231 GTGCACACCGAGATTTCTCAGGG - Intronic
1144598232 17:16589344-16589366 CCGCACAGGCTGTTTCCTCACGG + Intergenic
1147833590 17:43314472-43314494 GGGCTCAAGCTGTTTTCCCAGGG + Intergenic
1152061299 17:78077664-78077686 GTGCCCACCCTCTTTCCTCATGG + Intronic
1154300914 18:13191895-13191917 GTGAACTTGCTGCTTTCTCATGG + Intergenic
1154507723 18:15059307-15059329 GTTAACACACTGTTTTCTCATGG - Intergenic
1155191109 18:23431403-23431425 GGACACAGTCTGTTTTCTCAGGG + Intronic
1156202634 18:34852109-34852131 ATGCACACGCCGTTTTCTCATGG - Intronic
1157394740 18:47332128-47332150 GTAGACATGCTGTTTTCACAGGG + Intergenic
1160004554 18:75060220-75060242 TAGCGCACCCTGTTTTCTCATGG - Intronic
1165282455 19:34808976-34808998 CTGCAAACGCTGCTGTCTCAGGG + Intergenic
1167626168 19:50590990-50591012 GTCCACATGCGTTTTTCTCAAGG - Intergenic
1168324065 19:55529440-55529462 CTGCACTTGCTGTTTGCTCAGGG - Intergenic
928427035 2:31187871-31187893 GTGCACACCCTAATGTCTCATGG + Intronic
928849816 2:35731999-35732021 TTGGATACTCTGTTTTCTCATGG - Intergenic
929329435 2:40662809-40662831 GTGCTCATGCTGCTTGCTCAGGG + Intergenic
931205198 2:60139929-60139951 GTCCACACCCTGTTTTCCCTTGG - Intergenic
931487937 2:62712284-62712306 GTGGACATTCTGTTTTCTCAGGG + Intronic
931750395 2:65325000-65325022 GTGCCTGGGCTGTTTTCTCAAGG + Intronic
935053393 2:99543832-99543854 GTGCACACGCTGTTTTCTCATGG + Intergenic
935555290 2:104503159-104503181 GTGCCCACGCTGCTATCACATGG - Intergenic
945256605 2:207808357-207808379 GTCCACACCCTGGTTACTCAGGG + Intergenic
947057533 2:226123455-226123477 GTGAACAGGCTTTTTTCCCAGGG + Intergenic
948014321 2:234675502-234675524 GTCCACACCCTGGTTTTTCAGGG + Intergenic
948345681 2:237295974-237295996 GAGCACAGGCTGTTTTCTTCTGG - Intergenic
948770944 2:240251007-240251029 GTGCCCACCCTTTCTTCTCAGGG - Intergenic
1174104167 20:48150437-48150459 GTGCACACGCTGGATTTTAATGG - Intergenic
1174714431 20:52742376-52742398 GTGAACACACTCTTTTCCCAGGG - Intergenic
1176790359 21:13312472-13312494 GTTAACACACTGTTTTCTCATGG + Intergenic
1177989531 21:28020711-28020733 GTTAACACACTGTTTTCTCATGG + Intergenic
1180711835 22:17844392-17844414 GTGCACAAAGTGTTTTCTGAAGG + Intronic
949408373 3:3738243-3738265 GTGCACACGATGATTTTACATGG + Intronic
950244401 3:11402483-11402505 GTTCACACCCTGGTTTTTCAGGG - Intronic
950863718 3:16172523-16172545 CTGCACACTCAGTTTTCTGAAGG + Intergenic
953685365 3:45074021-45074043 GTGGACAAGCTGTTCTCTCCCGG + Intergenic
954095569 3:48324722-48324744 GTGCACATGCAGTGTTCTCCAGG - Intronic
955525784 3:59818303-59818325 TTGCACACGCTGTGTTCTCGGGG - Intronic
963901082 3:150734061-150734083 ATGCACGCGCTGCTTTCTCCCGG + Intergenic
969517464 4:7655585-7655607 GTGTACACGCCGTTGGCTCATGG + Intronic
969562792 4:7960163-7960185 GAGCACACGCAGTGTTCCCAGGG + Intergenic
972565061 4:40262306-40262328 ATGCCCAAGCTGTTTTCTGATGG + Intergenic
975547680 4:75576480-75576502 GTTCTCACATTGTTTTCTCAAGG - Intergenic
977712879 4:100147608-100147630 GTGCATACAATGTTTTCTGATGG - Intergenic
979293686 4:119005802-119005824 TTGCACATACTGTTTTCTAAAGG - Intronic
979348209 4:119614088-119614110 GACCACACACTGTTTTCTTAAGG + Intronic
979692567 4:123575429-123575451 GTGCACAAGCCTTTTTCTCTAGG - Intergenic
981743956 4:148033870-148033892 TTGCCCAGGCTGCTTTCTCATGG + Intronic
982620665 4:157700487-157700509 GTGCAGATGCTGTGTTGTCAGGG + Intergenic
983336543 4:166400772-166400794 TTGCACACGATGTTTACACAAGG + Intergenic
985964522 5:3329785-3329807 GTGCACAGGCAGCTTTCTCAGGG + Intergenic
986886527 5:12244447-12244469 GTGCCAACGCTTTTCTCTCAAGG + Intergenic
988539765 5:32098364-32098386 GTCCACAGGGTGTTTTCTCAGGG + Exonic
990203945 5:53409257-53409279 TGGCACACTGTGTTTTCTCAGGG + Intergenic
992968117 5:82024718-82024740 GTCATCAGGCTGTTTTCTCAGGG - Intronic
1002429192 5:179193203-179193225 CTGGACAAGCTTTTTTCTCATGG - Intronic
1003598312 6:7494774-7494796 CTGCACACGCCATTTTCTTACGG + Intergenic
1005276449 6:24224363-24224385 GGGCACACTATGTGTTCTCATGG + Intronic
1007175275 6:39892152-39892174 TTGCACAAGCTGATTTCTAAAGG + Intronic
1007377308 6:41465671-41465693 GTGCCCACGCTGAGTTCTGAAGG - Intergenic
1008319950 6:50098837-50098859 CTGCACACTCTGTTATCTCTGGG + Intergenic
1009899240 6:69791878-69791900 GTCCACACCCTGGTTTTTCAGGG - Intronic
1013618907 6:111870791-111870813 ATGCACACTCTGCTTTCTCCTGG - Intronic
1019560551 7:1654364-1654386 GTGTACAGGCTGTTTGCTGAGGG + Intergenic
1020528051 7:9289516-9289538 ATGCATACCCAGTTTTCTCAGGG + Intergenic
1020543115 7:9487509-9487531 GTGCACACACATTTTACTCAAGG + Intergenic
1023238544 7:38116810-38116832 GTGCTCATGCTGTCTGCTCAGGG + Intergenic
1024147532 7:46532601-46532623 GTCCACACCCTGGTTTTTCAAGG + Intergenic
1034026560 7:147710826-147710848 GTGGACATGCTTCTTTCTCAGGG + Intronic
1035101093 7:156397198-156397220 TTGCACACACTGAATTCTCAGGG - Intergenic
1035690391 8:1555987-1556009 GTGCATGCGCTGTTTTATCCAGG + Intronic
1036508835 8:9381830-9381852 GTGCACACGCTGGTTTTTCAGGG + Intergenic
1041759317 8:61346927-61346949 CTGCACAGGCTGTTTTCTCTTGG - Intronic
1053389655 9:37725129-37725151 GGGCACAGGCTGTTTTCTTGTGG + Intronic
1059938124 9:119332113-119332135 GTGCACTCTCTGATTTCTAAGGG + Intronic
1060784139 9:126435791-126435813 GGGCACACCGTCTTTTCTCAGGG + Intronic
1190638218 X:52457251-52457273 TTACACATACTGTTTTCTCAGGG - Intergenic
1190678440 X:52803185-52803207 TTACACATACTGTTTTCTCAGGG + Intergenic
1195070124 X:101270916-101270938 GTGTGCATGCTGCTTTCTCATGG + Intronic