ID: 935053537

View in Genome Browser
Species Human (GRCh38)
Location 2:99544742-99544764
Sequence GTGCAGCAGGACAACGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935053531_935053537 28 Left 935053531 2:99544691-99544713 CCTCACATAGAGAAAACTGAGGC 0: 1
1: 0
2: 1
3: 24
4: 209
Right 935053537 2:99544742-99544764 GTGCAGCAGGACAACGGAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935053537 Original CRISPR GTGCAGCAGGACAACGGAAG AGG Intergenic
901057143 1:6453866-6453888 GTCCAGCAGGACGAAGGGAGGGG + Intronic
904916476 1:33973977-33973999 CTGCAGCAGAAGAAGGGAAGTGG - Intronic
905366243 1:37453212-37453234 GTGCAGCAGAGCAAGGGAATGGG + Intergenic
905853280 1:41290120-41290142 GTGCAGCTGGAGGACAGAAGAGG + Intergenic
910667993 1:89744718-89744740 GTGCAGCAGGACATAAGAAAAGG + Intronic
915952983 1:160202341-160202363 GTGCAGCAGGAACTCAGAAGAGG - Intergenic
918712297 1:187746746-187746768 GTTCAGCAGCAGAAAGGAAGAGG + Intergenic
920422540 1:205844903-205844925 GTTCAGAAGCACAATGGAAGAGG + Intronic
920800852 1:209186123-209186145 CAGCAGCAGGAGAAGGGAAGAGG - Intergenic
921856154 1:219987159-219987181 GTGGAGCAGGAGAAGGGCAGGGG - Exonic
922195210 1:223353725-223353747 GTGCCCCAGGACAGAGGAAGGGG + Intronic
1069724243 10:70567154-70567176 GAGCAGCAGGAGTAAGGAAGTGG - Exonic
1076647728 10:131964910-131964932 GTGGAGATGGAAAACGGAAGAGG - Intergenic
1077438156 11:2554600-2554622 CTGCAACAGGACACCGTAAGGGG + Intronic
1080214804 11:29827969-29827991 GTGCAGCAGCACTATGGAAAAGG + Intergenic
1081662351 11:44895828-44895850 ATGCAGCAGGAGAAGAGAAGCGG + Intronic
1082640106 11:55649201-55649223 ATTCAGCAGGATAACTGAAGAGG + Intergenic
1083428931 11:62603696-62603718 GTGGAGCAGGACATGGGGAGAGG - Intronic
1083477847 11:62925663-62925685 GTGCCCCAGGACAGAGGAAGCGG - Intergenic
1086684380 11:89714006-89714028 GTGATGCAGGGAAACGGAAGAGG + Intronic
1086735937 11:90305694-90305716 GTGCAGGAGGAAAAGAGAAGTGG - Intergenic
1089443079 11:118532046-118532068 GAGCAGCAGGCCAAAGGAAAGGG - Intronic
1090954649 11:131503462-131503484 GTGCACCAGGAAAACGGACTGGG + Intronic
1094838359 12:34332719-34332741 GTGTAGCAGGATAACAGAAACGG + Intergenic
1095173555 12:39062831-39062853 GGGCTGCAGGACAACAGAGGAGG + Intergenic
1095485306 12:42678493-42678515 GTGCAGCAAGCCAGGGGAAGGGG - Intergenic
1095707043 12:45248373-45248395 GTGCATAAGGACAACAGATGAGG + Intronic
1096984875 12:55749733-55749755 GTGCAGCAGGCCAATCCAAGAGG + Exonic
1097328245 12:58303736-58303758 GAGCAGCAGGATAAAGAAAGAGG - Intergenic
1097945985 12:65367803-65367825 GTGCACCAGGATTACGGCAGTGG + Intronic
1098095049 12:66945999-66946021 GTGTAGCAGGAAGAAGGAAGGGG - Intergenic
1101248790 12:102911068-102911090 GTGCAGCAGGTCCACGGAAATGG + Intronic
1102721601 12:115021366-115021388 GGGCATCAGGATAAGGGAAGGGG - Intergenic
1102755258 12:115334635-115334657 GTGCAACAGAAGAAGGGAAGGGG + Intergenic
1106012416 13:25837643-25837665 GGGCTGCAGGACCACGCAAGGGG - Intronic
1107833769 13:44397350-44397372 AGGCGGGAGGACAACGGAAGCGG + Exonic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112776478 13:102849366-102849388 GTGCAGCAGGACAAAAGGAATGG - Intronic
1115754283 14:36517687-36517709 CTGCAGCAGGACAGCGGCGGCGG - Exonic
1117657244 14:57968522-57968544 GTGTAGCAGCACAATGGAAAGGG - Intronic
1118929672 14:70229992-70230014 GGCCAGCAGGTCAAAGGAAGAGG - Intergenic
1119616998 14:76105268-76105290 CTGCAGCAGGACAGAGGGAGAGG + Intergenic
1121121383 14:91377851-91377873 GTGCAGCAGGAAGGAGGAAGGGG + Intronic
1121492240 14:94368962-94368984 GTGAAGCTGGACAACGGGAAGGG + Intergenic
1122006132 14:98705384-98705406 GTGCAGCTGGTCAATGGAAAAGG + Intergenic
1123628075 15:22241221-22241243 CTGAGGCAGGACAAAGGAAGTGG + Intergenic
1124769470 15:32519076-32519098 CTGCAGCAGGAGAACGAGAGAGG + Intergenic
1126684159 15:51232791-51232813 GTGCAAGAGGACAAGGGATGGGG - Intronic
1128446856 15:67770367-67770389 GTCCTGCAGGACGAGGGAAGAGG - Intronic
1128819694 15:70640633-70640655 CTGCAGCAGCACAATGGGAGTGG - Intergenic
1130780531 15:87033729-87033751 GTGCAGCAGGACAAGGAAACGGG + Intergenic
1130889412 15:88120542-88120564 GCGTGGCAGGACAGCGGAAGTGG - Intronic
1130954796 15:88620077-88620099 GGGAAGCAGGACAAGGGATGAGG - Intergenic
1134692055 16:16197584-16197606 GTGGAGCAGGAGAGAGGAAGAGG + Intronic
1136576012 16:31125798-31125820 GTACAGCCTGACAATGGAAGGGG - Intronic
1137489411 16:48919107-48919129 GTTCAGCAGGAAAACAGAGGAGG - Intergenic
1138283041 16:55786563-55786585 GTGCAGCAGGACAAAGTCATAGG - Intergenic
1141645706 16:85366315-85366337 CTGCAGCAGGGCCAGGGAAGGGG - Intergenic
1141975872 16:87516113-87516135 CTGAGGCAGGACAAAGGAAGGGG - Intergenic
1142292557 16:89199684-89199706 GGGCAGCAGGAAAAGGGAAGGGG + Intronic
1143472646 17:7185543-7185565 GTGCGCCAGGGCAAGGGAAGAGG + Intergenic
1147740824 17:42670167-42670189 GGCCAGCAGGGCAGCGGAAGGGG + Exonic
1147760517 17:42795005-42795027 GTGCTGGAGGAGAATGGAAGTGG - Exonic
1148997264 17:51721830-51721852 TTGCAGCAGGACTAGGGCAGGGG - Intronic
1151710122 17:75799716-75799738 GTGCAGTAGGAACATGGAAGCGG + Intronic
1152375050 17:79914603-79914625 CTGCAGCAGGGTAACGGAAGGGG + Intergenic
1155326793 18:24672650-24672672 GTGGAGGAGGGCAACGGGAGGGG - Intergenic
1156972760 18:43176895-43176917 GGGCAGCAGGACTAGGGAATGGG + Intergenic
1159949650 18:74473637-74473659 CTGCAGCAGGACAAGGGTAGAGG - Intergenic
1160037663 18:75316638-75316660 GTGCAGCTGGAAAACCAAAGAGG - Intergenic
1161373805 19:3928592-3928614 GTGCAGTAGGATAAAGGAGGGGG - Intergenic
1164926098 19:32131251-32131273 GTGCAGGAGCACAGTGGAAGTGG - Intergenic
1165309335 19:35021172-35021194 GTGCAGCAGCCGAATGGAAGAGG + Intronic
1166742320 19:45121982-45122004 GTGCAGCAGCACATCCGCAGAGG + Intronic
926411205 2:12604646-12604668 GGGCAGCAGGACACCTGAGGTGG - Intergenic
928488379 2:31755234-31755256 CTGCAGCAGGCCTACAGAAGAGG + Intergenic
929552976 2:42906038-42906060 GGTCACCAGGACAAGGGAAGGGG + Intergenic
930552368 2:52852121-52852143 GTGCAGCAGCCCTACAGAAGAGG - Intergenic
935053537 2:99544742-99544764 GTGCAGCAGGACAACGGAAGAGG + Intergenic
936556122 2:113499904-113499926 GTGCAGCAGGTAGAGGGAAGGGG - Exonic
937734146 2:125269601-125269623 GAGGAGCAGGACAAAAGAAGGGG - Intergenic
937870294 2:126781500-126781522 GTGAAGCAGGACCAGGCAAGGGG - Intergenic
938639688 2:133266203-133266225 CTGCACCAGGACACCTGAAGGGG - Intronic
941090541 2:161169621-161169643 GTGAAGCAGGAAATAGGAAGGGG + Intronic
941798946 2:169633708-169633730 TTTCAGCAGAACAACGGTAGTGG - Intronic
945256083 2:207804375-207804397 GTGCAGAAGGAGACAGGAAGGGG + Intergenic
946079876 2:217108608-217108630 GAGAAGCAGGACAAGGCAAGTGG - Intergenic
1169364729 20:4982745-4982767 GGGCATCAGGACAACGTAATGGG + Intronic
1172448295 20:35004390-35004412 GGGCACCAGGACAAAGGAAGTGG + Intronic
1176165083 20:63668576-63668598 GTGCAGCAGAGCAAGGGAAGAGG + Intronic
1177376740 21:20280084-20280106 ATCCAGCAGGAGAACAGAAGAGG + Intergenic
1178622435 21:34188248-34188270 CTGCAGCAGGACTTTGGAAGGGG + Intergenic
1182899980 22:33889866-33889888 GTGAACCAGGAAAACGGAAATGG + Intronic
1182951758 22:34382521-34382543 CAGCAGCAGGACAAAGGAAGGGG + Intergenic
1183440213 22:37818705-37818727 GCGCAGCAGGGCAACGCCAGCGG - Intergenic
953163571 3:40444346-40444368 TTGCAGCAGGATAAAGGAAAAGG - Intergenic
960871020 3:122250011-122250033 GTGCAGCAGAATAGAGGAAGCGG + Intronic
961327462 3:126117875-126117897 GCCCAGCAGGGCCACGGAAGTGG + Intronic
968189635 3:196658547-196658569 GTGCAGCACGGCAACAGAAGAGG - Intronic
968920148 4:3518316-3518338 GCGCTGCAGGACCGCGGAAGGGG - Intronic
970952641 4:21775214-21775236 CTGCAGCAGCCCTACGGAAGAGG - Intronic
975961799 4:79917711-79917733 TAGCAACAGGACAAAGGAAGTGG + Intronic
977039905 4:92002571-92002593 ATGCAGCAGTCCCACGGAAGAGG + Intergenic
979666164 4:123313168-123313190 AGGCAGTAGGAAAACGGAAGGGG - Intronic
982020546 4:151199442-151199464 GTTCAGCAGAACAAAGGATGGGG + Intronic
985488818 5:167025-167047 GGGCAGCAGAACACAGGAAGGGG + Intronic
985551499 5:535596-535618 GGGCAGCGGGACCTCGGAAGGGG - Intergenic
985649060 5:1098942-1098964 GTGCAGAATGACAAGGGAGGAGG - Intronic
993001287 5:82383546-82383568 GTGCAGCAGGAATTCAGAAGAGG - Intronic
1001114096 5:168924318-168924340 GAGAAGCAGGACATGGGAAGAGG - Intronic
1001870363 5:175148961-175148983 GTGCAGCAGGGAAAGGGGAGGGG + Intergenic
1006369790 6:33636837-33636859 GTGCAGATGGAGAAGGGAAGAGG + Intronic
1008468152 6:51854181-51854203 CTGCAGCAGCCCAACAGAAGAGG - Intronic
1008741659 6:54615659-54615681 CTGCAGCAGGCCTACAGAAGAGG + Intergenic
1011529312 6:88302671-88302693 GTGCAACAGGTCAAAGGGAGAGG + Intergenic
1013379821 6:109557244-109557266 CTGCAGCAGCCCTACGGAAGAGG - Intronic
1015358291 6:132305746-132305768 GTGCAGCAGCCCTACAGAAGAGG + Intronic
1015468680 6:133577336-133577358 GTGCAGTAAGACCATGGAAGTGG - Intergenic
1015554991 6:134451848-134451870 GTCCAGAAGGACAATGGAACAGG - Intergenic
1018621505 6:165733346-165733368 GGGCAGCAGGAAATAGGAAGGGG - Intronic
1020633685 7:10671653-10671675 CTGCAGCAGCCCAACAGAAGAGG - Intergenic
1021027471 7:15686815-15686837 GTCCAGCAGGAGATAGGAAGTGG - Intergenic
1021590533 7:22256141-22256163 GAGCAGCAGGAGAATGGCAGGGG - Intronic
1022242026 7:28521713-28521735 GTGCAGAAGTACCATGGAAGTGG - Intronic
1024772703 7:52743429-52743451 GTGCAGAAGGTCAAGGGAAGGGG - Intergenic
1024950811 7:54858487-54858509 GTGCATGAAGACAAAGGAAGGGG - Intergenic
1025216609 7:57061250-57061272 GAGCTGCTGCACAACGGAAGAGG - Intergenic
1026592685 7:71710724-71710746 GAGCAGCAGGGGAATGGAAGTGG - Intronic
1027466470 7:78521533-78521555 GTGCTGAAGGAAAACGGAAGAGG - Exonic
1033103093 7:138493762-138493784 TTGCAGCAGGACTATGGAATGGG + Intronic
1033359606 7:140629291-140629313 TTGGAGGAGGACAACGAAAGGGG + Intronic
1034131711 7:148724656-148724678 GTGAAGCAGGACGACAGCAGGGG - Intronic
1034511499 7:151539074-151539096 GTGCAGCAGGAAAACCCCAGAGG - Intergenic
1034783574 7:153904433-153904455 GTGGACCAGGACAACGGGAGAGG + Intronic
1049004411 8:139845672-139845694 GTGCCCCAGGGCAACGGCAGAGG + Intronic
1049896905 9:117459-117481 GTGCAGCAGGTAGAGGGAAGGGG + Exonic
1050332492 9:4559657-4559679 GGGTAGCAGGAAAAAGGAAGAGG - Intronic
1050512272 9:6408522-6408544 GTGGAGCAGGTCACCTGAAGAGG + Intergenic
1052078537 9:24174947-24174969 GTACAGCAGAAAAACGGAATGGG - Intergenic
1052975937 9:34410198-34410220 GGGCAGGGGGACAAGGGAAGAGG - Intronic
1053740008 9:41127711-41127733 GTGCAGCAGGTAGAGGGAAGGGG + Exonic
1054487308 9:65737796-65737818 GTGCAGCAGGTAGAGGGAAGGGG - Exonic
1054688342 9:68303602-68303624 GTGCAGCAGGTAGAGGGAAGGGG - Exonic
1056563200 9:87750886-87750908 GTCCTGCAGGACAATGCAAGAGG - Intergenic
1060370633 9:123067183-123067205 CTGCAGCAGGACAATGGTATGGG - Intronic
1060482457 9:124024940-124024962 GTGCAGCAGTACAGTGGGAGAGG + Intronic
1061419564 9:130466044-130466066 GTGGTGCAGGGCAATGGAAGGGG - Intronic
1061661164 9:132131281-132131303 GTTCAGCAGGAGAAGGGATGGGG + Intergenic
1189705016 X:43750995-43751017 GTGCAGCTGGACAGAAGAAGGGG + Intergenic
1193605812 X:83566938-83566960 CTGCAGCAGCACCACAGAAGGGG - Intergenic
1193768442 X:85560677-85560699 CTGCAGCAGGCCTACAGAAGTGG - Intergenic
1196906762 X:120444577-120444599 GTGCTGCAGGAGAATGGAGGAGG - Intronic
1199859120 X:151783914-151783936 GTGTGGAAGGACAACAGAAGAGG - Intergenic
1201069187 Y:10128788-10128810 ATGCATCAGGAAAACGGGAGGGG + Intergenic