ID: 935053890

View in Genome Browser
Species Human (GRCh38)
Location 2:99548735-99548757
Sequence GGTTTGGTTGGTTTTGAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3764
Summary {0: 1, 1: 2, 2: 53, 3: 1265, 4: 2443}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935053890_935053894 14 Left 935053890 2:99548735-99548757 CCGGTCTCAAAACCAACCAAACC 0: 1
1: 2
2: 53
3: 1265
4: 2443
Right 935053894 2:99548772-99548794 TAACAACAAAACTAAGTAAAAGG 0: 1
1: 0
2: 10
3: 92
4: 953

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935053890 Original CRISPR GGTTTGGTTGGTTTTGAGAC CGG (reversed) Intronic
Too many off-targets to display for this crispr