ID: 935059848

View in Genome Browser
Species Human (GRCh38)
Location 2:99597773-99597795
Sequence CCTTGGGCAGAAACCCCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935059848_935059854 -5 Left 935059848 2:99597773-99597795 CCATCCGGGGTTTCTGCCCAAGG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 935059854 2:99597791-99597813 CAAGGTTCTGGTTTGTTTGCTGG 0: 1
1: 0
2: 0
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935059848 Original CRISPR CCTTGGGCAGAAACCCCGGA TGG (reversed) Intronic
900308174 1:2021040-2021062 CCTTGGGCAGGAAAGCTGGAAGG + Intronic
900996582 1:6126363-6126385 CCCTGTGCAGAACCCCCGGGAGG - Intronic
900996618 1:6126476-6126498 CCCTGTGCAGAACCCCCGGGAGG - Intronic
902630501 1:17701754-17701776 CCTTTGGCAGTAACCCAGCATGG - Intergenic
904724807 1:32539396-32539418 CGTTGGACAGAAACGCCCGAGGG - Intronic
910262533 1:85306124-85306146 CCTTGGGGGGAAAGCCAGGAAGG - Intergenic
912969622 1:114268635-114268657 TCTTGGGTAGAATCCCAGGAGGG + Intergenic
914240413 1:145849343-145849365 CCTTGGCCAGAGCCCCCAGAGGG + Exonic
915229492 1:154435026-154435048 CCGTGGCCAGAAACCCCCGCTGG + Exonic
920038430 1:203080670-203080692 GCTTGGGCAGAAAAGCCTGAGGG - Intergenic
920189585 1:204184615-204184637 CCTTGGGATGAAACCATGGAAGG - Intergenic
920582994 1:207130439-207130461 TCTTGGGTAGATACCCAGGAGGG - Intronic
921181740 1:212636877-212636899 GCTTGGAGAGAAACACCGGATGG - Intergenic
921218361 1:212955613-212955635 CTTGGGGCAGAAAACCAGGATGG + Intronic
1070897248 10:79995404-79995426 CCTTGGCCAGCAACCCCCAATGG - Intergenic
1075642193 10:124072795-124072817 ACGTGGGCAGAACCCCAGGAGGG + Intronic
1076166843 10:128289064-128289086 CTTTGGGCAGAAGCCCCAGGAGG - Intergenic
1077550407 11:3197621-3197643 CCTTGGGCAGGAGCCCAGGCTGG + Intergenic
1080768450 11:35318248-35318270 CTTTGGGCAGACTCCCAGGATGG - Intronic
1080795271 11:35557475-35557497 CCTGGGGAAGAAACCCAAGAGGG + Intergenic
1086801625 11:91183694-91183716 CCCTGGGCAGAAATCCCAGAGGG - Intergenic
1094488433 12:30943170-30943192 CCCTGGGCAGAGACCCCAGTCGG - Intronic
1094798241 12:34000918-34000940 CCTTGGGCAGAGACTCTGGCAGG - Intergenic
1095800763 12:46268575-46268597 CCGAGGGTAAAAACCCCGGAAGG - Intronic
1098215286 12:68209554-68209576 CCTAGGGCATAAAACCCGTAGGG - Intronic
1098816024 12:75163281-75163303 CCTTGGCCAAAAACTCCAGAGGG + Intronic
1107699876 13:43036758-43036780 CTTTGGGCACAAGCCCAGGAGGG - Intronic
1116932249 14:50702280-50702302 CCTGGGACAGAAATCCCAGAGGG - Intergenic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1118662325 14:68028352-68028374 TCTTGGGCAGAAACCATGGCAGG + Intronic
1119153727 14:72389257-72389279 GGTTGGGCAGACACCCCTGAGGG - Intronic
1121988210 14:98528811-98528833 CCTTGAGCAGTAACCCTTGAGGG - Intergenic
1122599729 14:102915285-102915307 CCTTGGGCAGAGTCCCCGCAAGG - Intergenic
1122977954 14:105178672-105178694 CCCTGGGCAGAGCCCCCGGTGGG - Intronic
1123014864 14:105368812-105368834 CCATGTGCAGAAACTCCGGGAGG + Intronic
1123578518 15:21695784-21695806 CCTTGCCCAGAAAGCCCTGAAGG + Intergenic
1123615145 15:22138266-22138288 CCTTGCCCAGAAAGCCCTGAAGG + Intergenic
1124361478 15:29039608-29039630 CCTCGGGCCTAAACCCCGGTTGG - Intronic
1124696033 15:31865028-31865050 CCTTGGGCACAACCCCAGGGGGG - Intronic
1127668232 15:61169859-61169881 CCTTGGGCAGCATCCCAGGGTGG + Intronic
1129240132 15:74245993-74246015 CCCCAGGCAGAAACCCCAGAGGG + Intronic
1129246687 15:74283256-74283278 CCTTGGGAAGAGGCCCCGGAGGG - Intronic
1129848434 15:78778630-78778652 ACTTGGGCAGAAACAATGGAGGG + Intronic
1130897783 15:88184105-88184127 CCTGGGGGAGAAAGCACGGATGG + Intronic
1131023034 15:89115832-89115854 CCTTGAACAGAAACCCGGAAAGG - Intronic
1202987388 15_KI270727v1_random:430029-430051 CCTTGCCCAGAAAGCCCTGAAGG + Intergenic
1132458480 16:37407-37429 CCTGGGGCAGAATCCTGGGATGG - Intergenic
1132958822 16:2611043-2611065 CCTTGGGCAGGTACCGCTGATGG + Intergenic
1136956107 16:34788028-34788050 CCCTGACCAGAAACCCAGGAAGG + Intergenic
1138371825 16:56533162-56533184 CCTTGGGCAGAAGCCTGGGCTGG - Intergenic
1138938990 16:61766490-61766512 CCTTGGGTAGATACCCAGCATGG + Intronic
1139098082 16:63730199-63730221 CCTTTGGCTGTATCCCCGGAAGG - Intergenic
1140221986 16:73050251-73050273 GCCTGGGCAGAAGGCCCGGACGG + Intronic
1143618713 17:8069041-8069063 CATTGGGCAGAAACTGGGGAAGG - Intergenic
1145970926 17:28956084-28956106 CTTTGGGCAGATAACCCTGAGGG - Intronic
1147142489 17:38467153-38467175 CCTGAGGCAGAAGCCCCCGACGG + Exonic
1152463076 17:80451402-80451424 CCTTGGGCAGGAAGCCCAGGAGG + Intergenic
1155356859 18:24961438-24961460 CCTTAGGGAGAATCCCTGGAAGG - Intergenic
1161770620 19:6228864-6228886 CCTGGGGCAGAGACCCCCCACGG + Intronic
1163417979 19:17198184-17198206 CCTGCAGCAGAAACCACGGACGG + Exonic
1168089811 19:54075100-54075122 GCTTGGGCAGTGACCCTGGAAGG + Exonic
1202671691 1_KI270709v1_random:60174-60196 CCCTGGCCAGAAACCCAGAAAGG + Intergenic
925149206 2:1602971-1602993 CCTTGGGAAGAATCCAGGGATGG - Intergenic
932327286 2:70871603-70871625 CCTTGCGCAGGCACCCCGGGTGG - Intergenic
933942936 2:87260288-87260310 CATTGGGCTGGAACCCCGGAAGG + Intergenic
935059848 2:99597773-99597795 CCTTGGGCAGAAACCCCGGATGG - Intronic
935645141 2:105328852-105328874 CCTTGGGTAGAAGCCACGGCAGG + Intronic
936337277 2:111601274-111601296 CATTGGGCTGGAACCCCGGAAGG - Intergenic
938065695 2:128280907-128280929 CCTTTGGCAGGACACCCGGATGG + Intronic
939124707 2:138164235-138164257 TCTTGGGCAAATACCCAGGAGGG - Intergenic
942529886 2:176898258-176898280 CTTTGGGTAGAAACCCAGTAGGG + Intergenic
947628674 2:231637533-231637555 CCAAGGGCAGAAACGCCAGAGGG + Intergenic
948196820 2:236102989-236103011 GGGTGGGCAGAAACCCCGGAGGG - Intronic
1170254154 20:14320786-14320808 CCTTGGTCAGAATCACCTGAGGG - Intronic
1170781421 20:19429006-19429028 TCCTGGGCAGAAACACTGGAGGG - Intronic
1172523497 20:35583883-35583905 CCTTGGGCAGAGAGCCAGGTGGG + Intergenic
1172651864 20:36508811-36508833 CCTTGGACAGAATCACTGGATGG + Intronic
1174176873 20:48650858-48650880 CCTGTGGCAGAGACCCCGGAGGG + Intronic
1175414990 20:58795213-58795235 CCTTGGGCTCAAATCCCAGAGGG + Intergenic
1179721864 21:43320857-43320879 GCGTGGGCAGAAACCCAGGGTGG - Intergenic
1181164037 22:20974010-20974032 CCTTGGGAAGCAACCCCTGCTGG + Intronic
1183019829 22:35018283-35018305 GCAAGGGCAGAAACCCAGGAGGG + Intergenic
950611949 3:14132610-14132632 CCATGGGCAGAGACCACGTAAGG - Intronic
960976619 3:123181501-123181523 TGATGGGCAGAAACCACGGAGGG - Intronic
968519984 4:1030830-1030852 CCTTGGGCAGGAGCCCAGGTGGG + Intergenic
970317057 4:14839400-14839422 CCTTGGTCAGGAACCACAGAAGG - Intergenic
971308625 4:25505365-25505387 CCATGGGCAGCAGCCGCGGAAGG - Intergenic
971947785 4:33304057-33304079 CCTTGAGCAGAAACCTCTGTGGG + Intergenic
975936405 4:79586116-79586138 CCTTGGGAAGAAACCCAGCAGGG - Intergenic
976555205 4:86443043-86443065 CCCTGAGCAGAAACCTCTGAGGG + Intronic
985929984 5:3049584-3049606 ACTTGGGCAAATACCCCAGAGGG - Intergenic
986421736 5:7591713-7591735 CTCTGGGCAAAAACCCAGGAAGG + Intronic
987837377 5:23178976-23178998 CCTGGGACAGAACCCCCGGGAGG - Intergenic
988783101 5:34541432-34541454 CCTTGGGCAGGGACACCGGGTGG + Intergenic
991588031 5:68219464-68219486 CCTGGGGCAGAACCCCAGGCTGG - Intronic
992887195 5:81170359-81170381 CCTTGGGCAAAACCCGCTGATGG + Intronic
994572854 5:101536067-101536089 TTTTGGGCAGAATCCCCAGAAGG - Intergenic
1002160728 5:177312555-177312577 GCTTGGGGACAGACCCCGGAGGG - Intronic
1007746841 6:44048219-44048241 CCTGGGGCAGGAACCCAGGGGGG + Intergenic
1007972229 6:46063761-46063783 CATTGGGCAGAGTCCTCGGAAGG + Intronic
1011370654 6:86633669-86633691 GCTGGGACAGAAATCCCGGAGGG - Intergenic
1011762217 6:90579504-90579526 GCTTGGGCAAAAAACCTGGATGG - Intronic
1013115726 6:107102466-107102488 CAGTGGGCAGAAACCCCAGAGGG + Intronic
1018679704 6:166253584-166253606 CCCCGGGCGGAGACCCCGGAGGG - Intergenic
1019434889 7:1017520-1017542 CCTTGGGGAGCATCCCTGGATGG + Intronic
1020969306 7:14914264-14914286 CCTTTGGCAGAGACCTCAGATGG - Intronic
1023206032 7:37750584-37750606 CCTTGGGCAGATGCCCAGCATGG - Intronic
1029114176 7:98228960-98228982 CCTTGGGCAGGGAACCCAGACGG + Intronic
1034174798 7:149091412-149091434 CCTTGGGCAGAGACCCCATGCGG + Intergenic
1037737545 8:21579643-21579665 CCTGGGGCACAGAGCCCGGAGGG - Intergenic
1040883465 8:52234052-52234074 CCTTGGACAGAAAACCAAGAAGG - Intronic
1043195488 8:77287371-77287393 CCTTGGCCATAAACACCAGAAGG + Intergenic
1046506015 8:115139091-115139113 CCTTGGACAGAATTCCCAGAAGG - Intergenic
1048242244 8:132754120-132754142 CCTTGGGCAGACACACCTAAAGG - Intronic
1048434907 8:134407176-134407198 CCTTGGGCAGATCCCACTGAAGG - Intergenic
1050247779 9:3708977-3708999 CATTGGGCAGAATGCCCAGAAGG + Intergenic
1050906491 9:11012337-11012359 CCTTAGTCAGGAACCACGGACGG - Intergenic
1052836859 9:33256893-33256915 CCTTGGGCAGAAAACCCTGCGGG + Exonic
1055343975 9:75314407-75314429 CCTTGGGCAGAGATCCAGCAGGG + Intergenic
1057152563 9:92808420-92808442 CATTTGGCAGTCACCCCGGATGG - Intergenic
1186870727 X:13768961-13768983 ACTAGGGCAGAAACCCCCCAGGG + Intronic
1199790819 X:151153442-151153464 TTTTGGGCAGAAGCCCAGGAGGG - Intergenic