ID: 935061113

View in Genome Browser
Species Human (GRCh38)
Location 2:99608615-99608637
Sequence GACCCTCAGCTCCCCAGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935061113 Original CRISPR GACCCTCAGCTCCCCAGCCG AGG Intronic
900612948 1:3552103-3552125 AACCCTCAGGACCCCAGCGGTGG + Intronic
900705328 1:4076735-4076757 GAGCTGCAGCTCCCCAGCTGTGG + Intergenic
900919909 1:5663465-5663487 GACCCTCTGCTGCCCTGCCCTGG + Intergenic
900930887 1:5736719-5736741 GCACCTCAGCACCCCAGCCCGGG - Intergenic
902529414 1:17080968-17080990 GAGCCCCAGCACCCCAGCCTTGG - Intronic
902606766 1:17573420-17573442 GACCCTCAGCCCCACATCAGGGG - Intronic
902864547 1:19269521-19269543 GACCCACAGATGCCCAGCCCAGG - Intergenic
902866770 1:19284956-19284978 GACCCACAGATGCCCAGCCCAGG - Intronic
903455452 1:23484064-23484086 GGACCTCAGCTCCCCGGCTGGGG - Exonic
903647935 1:24905917-24905939 GACTCTCAGCTCTCGAGCCCAGG - Intronic
903682798 1:25108351-25108373 GACACTCAGATCCCCAGGCATGG - Intergenic
906117408 1:43366007-43366029 GTCCCTCACCTCCCCAGCTCTGG + Intronic
907027214 1:51132203-51132225 GACCATCAGCTCTCCAGCAAAGG + Intronic
912628878 1:111229362-111229384 GACCTTGAGGTCCCCAGCCCTGG - Intronic
914504338 1:148275619-148275641 GACCCTGAGCTCTGCAGCCTTGG + Intergenic
914845827 1:151282945-151282967 GACTCTCAGCTCTCTAGCTGGGG - Intronic
914928615 1:151909777-151909799 GCCCCTCAGCCCCTCAGCCCCGG + Exonic
915073609 1:153292188-153292210 GAGCCCCAGCTCCCCACCCATGG + Intergenic
915735342 1:158081028-158081050 GCCCCCCAGCTCCCCAGGCCAGG + Intronic
920251421 1:204624758-204624780 GACCCTCAGCTCCCGGGGGGGGG - Intronic
920285473 1:204875680-204875702 GCCCCTCAGGTCCCCTGCTGTGG + Intronic
920293385 1:204940015-204940037 GGCCCTCAGCTCCCCAGGCTGGG - Intronic
920395790 1:205644930-205644952 CAACCTCAGCTCCCCACCCCAGG - Intergenic
920529591 1:206692340-206692362 GACCCTCAGCCCCTCAGACCAGG + Intronic
920836358 1:209514405-209514427 GTCCCTCAACTCCCAAGCCTTGG + Intergenic
922758478 1:228109600-228109622 CTCCCTCAGCTCCCCACCCCGGG - Intergenic
922944416 1:229499481-229499503 GAGCCACTGCACCCCAGCCGTGG - Intronic
923093917 1:230760093-230760115 GACCCGCAGACCCTCAGCCGAGG + Intronic
924454842 1:244211071-244211093 GAGCCGCAGCGCCCCAGGCGTGG - Intergenic
924586313 1:245364123-245364145 CACCCTCAGACCCCCAGCCTGGG + Intronic
924713476 1:246550838-246550860 GAACCACTGCTCCCCAGCCTGGG + Intronic
1063449928 10:6144683-6144705 GGCCCGCAGCCCCCCAGACGCGG - Intergenic
1063473238 10:6306063-6306085 GAGCCTCTGCTCTCCAGCCTGGG - Intergenic
1065783462 10:29191676-29191698 GAGCCACAGCTTCCCAGCCCTGG + Intergenic
1065989167 10:30991204-30991226 TCCCCTCAGCTCCCAAGCTGGGG + Intronic
1067090928 10:43265578-43265600 GAACCTCAGGACCCCAGCCCAGG - Intronic
1067346283 10:45441260-45441282 GACCCGCAGCTCCCCCACCCAGG - Intronic
1069943542 10:71971111-71971133 GACCCTCCGCTGCCAAGCCCTGG - Intronic
1070748531 10:78949994-78950016 GACCCTCAGCTCCTCATGTGGGG - Intergenic
1070814079 10:79312386-79312408 GACCCGCAGCCCACCAGCTGAGG - Intronic
1070887915 10:79921106-79921128 GTCCTTCAGCTCCCCAGGCCCGG - Intergenic
1073543475 10:104330517-104330539 GACCCTCAGCTGCCTTGCCGTGG + Intronic
1076748657 10:132528391-132528413 GACCCCCAGGTTCCCAGCCTAGG - Intergenic
1076802021 10:132835247-132835269 GACCCTCTGCTCCCCACCCCTGG - Intronic
1076903090 10:133349593-133349615 ACCCCTGAGCCCCCCAGCCGTGG + Intronic
1077065452 11:639210-639232 GAGCCACAGCACTCCAGCCGCGG + Intronic
1077371243 11:2182565-2182587 GCCCCACAGGTCCCCAGCAGCGG + Intergenic
1078544108 11:12234412-12234434 GACCCCCAGCTCCACAGCCTGGG - Intronic
1079246171 11:18753774-18753796 GCCCACCAGCTCCCCAGCCATGG - Intronic
1080734571 11:35000339-35000361 GACCCTCAGCGTGCCAGCTGAGG - Intronic
1081979026 11:47254727-47254749 CACACTCTGCTCCCCAGCCCCGG + Intronic
1083448603 11:62727413-62727435 GGCCCTTGGTTCCCCAGCCGCGG + Intergenic
1083478204 11:62927231-62927253 GACCCTCCGCGCCCCTGCCGCGG + Intergenic
1083748524 11:64748071-64748093 GACCCTCAGCGCCCCCACCACGG + Intronic
1084177598 11:67431529-67431551 GACCCCCAGCACCCCTGCCTGGG - Intronic
1084192782 11:67506329-67506351 GGCCCTCTCCGCCCCAGCCGTGG - Intergenic
1084493376 11:69490080-69490102 GTCCCTCAACACCCCAGCCAAGG + Intergenic
1084797688 11:71519204-71519226 GACCCTCAGCTCTGTCGCCGGGG + Intronic
1085040562 11:73324109-73324131 CCCCCTCAGCTTCCCAGCCCAGG + Intronic
1086703152 11:89922624-89922646 GACCCTCAGCTGCCGACCAGTGG - Intergenic
1087880990 11:103416148-103416170 CTCCCTCAGCCCCCCAGCCTGGG - Intronic
1089363416 11:117906031-117906053 GACCCTCAGCTGCCCAGTATCGG - Intronic
1089602882 11:119625993-119626015 GACCCTGACATCCCCAGTCGGGG - Intronic
1089949715 11:122514343-122514365 GTCCCTCAGCTCCCTAACTGTGG - Intergenic
1090293890 11:125569554-125569576 TACCCACAGCTCCGCCGCCGCGG - Exonic
1090610988 11:128470343-128470365 TACCCTCAACTCCCTACCCGGGG - Intronic
1090635940 11:128690549-128690571 GACCCGCCGCTCCCCTCCCGGGG + Intronic
1096251065 12:50032961-50032983 GGCCCTCACCTCCCCAGGGGCGG + Intronic
1096878670 12:54649598-54649620 TATCCTCAGCTCCCCAGCTTGGG - Intergenic
1102291034 12:111699875-111699897 GTGCCACAGCTCCCCAGCCTGGG + Intronic
1103492959 12:121337509-121337531 GCCCCTCATCTCGCCAGCCTTGG + Intronic
1103587016 12:121963526-121963548 GACTCCCTGCTCCCCAGCAGCGG - Intronic
1103743959 12:123109645-123109667 GAGCCTGAGCTTCCCAGCCAAGG + Intronic
1103905945 12:124327199-124327221 TACCCTCTGCCCCCCAGCCCCGG - Intronic
1103946311 12:124528643-124528665 CACCCTCATCTCTCCAGCAGAGG + Intronic
1106135051 13:26967629-26967651 GACCCTGAGCTCCGCAGCTGGGG + Intergenic
1108402252 13:50058220-50058242 GAGCCACAGCACCCCAGCCTGGG - Intergenic
1108698763 13:52925996-52926018 GACCCTGAGCCGCCAAGCCGAGG - Intergenic
1112537627 13:100275374-100275396 GCCCTGCTGCTCCCCAGCCGTGG + Intronic
1112828684 13:103422258-103422280 GACCCTCAGTCCACCAGCCCTGG + Intergenic
1117315213 14:54566333-54566355 GACCCGCGGGTCCCCCGCCGAGG - Intergenic
1121012922 14:90532700-90532722 GACCACCAGCTCCCCAGCCCAGG + Exonic
1121489785 14:94349535-94349557 TACCCTCAACTCCTCAGCCCAGG - Intergenic
1122013880 14:98776986-98777008 GCCCCTGAGCTGCCCAGCCTAGG - Intergenic
1124439263 15:29674991-29675013 GAACCTCCCCTCCCCCGCCGGGG + Intergenic
1125609100 15:40958845-40958867 GGCCCTGAGGACCCCAGCCGCGG + Intergenic
1128331025 15:66755802-66755824 GAGCCTCAGGTCCTCAGCCCTGG - Intronic
1128766163 15:70252449-70252471 GCCCCAGAGCTCCCCTGCCGTGG - Intergenic
1129104428 15:73296346-73296368 GACCACCAGCTCCCCCGCCGTGG + Intronic
1129456198 15:75677246-75677268 GTCACACAGTTCCCCAGCCGGGG - Exonic
1129481127 15:75827294-75827316 GGCTCTCAGCTCCCCAGACCAGG + Intergenic
1130023557 15:80251611-80251633 GAGCCTCACCTCCCCATTCGGGG - Intergenic
1130639264 15:85655581-85655603 GACCCTCAGCTCCCATCCCATGG - Exonic
1132203542 15:99971176-99971198 GACCCTCAGGTCCCCACCCAGGG + Intergenic
1132403405 15:101527729-101527751 GCCACTGAGCTCCCCAGCTGCGG + Intergenic
1132511952 16:347417-347439 GTCCCTCAGCTCTGCAGCTGAGG - Intronic
1132603738 16:785077-785099 GACCCACAGCTCCCAAGCTGGGG + Exonic
1133139211 16:3731994-3732016 GACGCCCAGCTCCCAGGCCGTGG + Intronic
1133426250 16:5692669-5692691 GGCACTGAGCTCCCCAGCCAGGG - Intergenic
1133567171 16:7006820-7006842 AACCCTCAGCTCCCAAGCAGTGG + Intronic
1136414014 16:30092601-30092623 GACCCTCAGAGCCCCTGCAGAGG - Exonic
1137446364 16:48534891-48534913 AACCCCCACCTCCCCAGCCCAGG - Intergenic
1142600676 17:1052223-1052245 GGCCCTGAGCACCCCAGCCTGGG + Intronic
1142804276 17:2363312-2363334 CACCCTCTGCTCTCCAGCCACGG - Intronic
1143521194 17:7445274-7445296 GACCCTCCGCCTCCGAGCCGCGG - Exonic
1143995741 17:11004966-11004988 GACCCTCAGTGGCCCAGCCTAGG - Intergenic
1144695960 17:17303898-17303920 GACGGTCAGCGCCCCAGCCTCGG + Intronic
1145793718 17:27643769-27643791 GACCCCCAGGTCCCCAGCTCTGG - Intronic
1145808529 17:27751323-27751345 GACCCCCAGGTCCCCAGCTCTGG - Intergenic
1146261624 17:31425857-31425879 GGCCCCCAGCTCCCCTGCCTGGG + Intronic
1147342523 17:39762233-39762255 CACCCTCACCTCCCCAGCCCTGG + Intergenic
1147934307 17:44002695-44002717 GTCACTCAGCTCACAAGCCGTGG - Intronic
1148193269 17:45695038-45695060 GCCCTTCAACTCTCCAGCCGGGG - Intergenic
1149056199 17:52369316-52369338 GAGACTCAGCTCCCCATCAGAGG + Intergenic
1149685379 17:58531858-58531880 GACCCGCGGCACCGCAGCCGCGG - Intronic
1150289235 17:63972100-63972122 CTCCCTGAGCTCCCCAGCCCTGG - Intronic
1151917593 17:77129877-77129899 GACCCGCAGCTGCACAGCCAGGG + Intronic
1152207774 17:78984222-78984244 CACCCTCTGCTCACCAGGCGTGG - Intergenic
1152801824 17:82334224-82334246 GTCCCCCAGCTCCCCCGCAGAGG + Intergenic
1152898744 17:82928220-82928242 GAGGCTCTGCTCCCCAGCCTGGG + Intronic
1153031092 18:713031-713053 GTGGCTCAGCTCCCAAGCCGAGG + Intergenic
1153342959 18:3994170-3994192 CACCCTCGGCACCCCAGCCAGGG - Intronic
1153354311 18:4118638-4118660 GCTCCCCAGCTCCCCAGCCTGGG - Intronic
1155526560 18:26721675-26721697 GCTCCTCAGCTCCCCTTCCGTGG - Intergenic
1157190297 18:45575939-45575961 TGGCCTCTGCTCCCCAGCCGGGG - Intronic
1157243685 18:46035002-46035024 CACCCTCAGATCCCCAGATGTGG - Intronic
1158109393 18:53923654-53923676 AAACCTCAGATCCCCAGCAGAGG + Intergenic
1159194637 18:65096794-65096816 GACCCACTGCTCTCCAGCCTGGG + Intergenic
1160666912 19:335229-335251 GGCCCTCAGGCCCCCAGCCTTGG - Intronic
1161141911 19:2653287-2653309 GACCCTCAGCTCCCAAACCTGGG + Intronic
1161523088 19:4736714-4736736 GGCCCTCAGCTCCCCTCCAGCGG + Intergenic
1161533412 19:4804002-4804024 GACCGTCCCCTCCTCAGCCGGGG + Intergenic
1162413030 19:10517748-10517770 GAGCCTCTTCTCCCCAGCGGAGG + Intronic
1162791371 19:13064723-13064745 GACCCTCAGCTCCCCTCCCCAGG - Intronic
1163557899 19:18002651-18002673 GACCCTTCCCTCCCCAGCGGTGG + Intronic
1164452447 19:28378466-28378488 GACCCTGAGCTCCCAGGCCAGGG + Intergenic
1166745709 19:45140964-45140986 GGCCCTCACCTCCTCAGCCTTGG + Intronic
1167134617 19:47609335-47609357 CACACTCAGCCCCCCAGCCGGGG + Intronic
925291423 2:2751016-2751038 AAACCTCAGCTCCCCCGCGGGGG - Intergenic
925712765 2:6757850-6757872 TGCCCTCAGGTCCCCACCCGCGG + Intergenic
926856455 2:17261591-17261613 CACCCTCAGGTCAGCAGCCGGGG + Intergenic
926905233 2:17799405-17799427 CACCCTCAGCTGCCCAGCACTGG - Intronic
927488523 2:23505360-23505382 GTCCATCAGGGCCCCAGCCGGGG - Intronic
930318686 2:49827785-49827807 GACCCTCCACCCCCCAGCCAAGG - Intergenic
930636552 2:53812197-53812219 GAGCCTCCGCGCCCCAGCCAGGG + Intronic
931591050 2:63883645-63883667 GACCCCCACCTCCCCACCCTAGG - Intronic
932496410 2:72147868-72147890 GGCCCTCCCCTCCCCCGCCGCGG - Exonic
934117601 2:88811757-88811779 GACCCTCAGCCCCGCTGCCCAGG + Intergenic
934128208 2:88919953-88919975 GTCCCTCTGATGCCCAGCCGAGG + Intergenic
935061113 2:99608615-99608637 GACCCTCAGCTCCCCAGCCGAGG + Intronic
937205790 2:120236424-120236446 GAGTCTCAGCTCTCCAGCCCAGG + Intergenic
937288219 2:120766373-120766395 GACCCTAGGCTCCCCACCTGTGG + Intronic
938307505 2:130265534-130265556 CACCCTCATCTGCCCAGCCTTGG - Intergenic
938447827 2:131391308-131391330 CACCCTCATCTGCCCAGCCTTGG + Intergenic
938575240 2:132597279-132597301 GAACATCAGCTTCCCAGCCTGGG + Intronic
940004183 2:148996576-148996598 GCACCCCAGCTCCCCAGCTGGGG + Intronic
944425170 2:199573913-199573935 GCCCCTCTGCACTCCAGCCGGGG - Intergenic
946145345 2:217726242-217726264 GGCCCTCTACTCCCCAGCCCTGG + Intronic
948347444 2:237310844-237310866 GGTCCTCAGCTCCCCACCTGAGG + Intergenic
948813419 2:240497817-240497839 GACCCCCAGCTCCACAGCCTTGG - Intronic
948901626 2:240959314-240959336 GGCCTTCAGCTCCTCAGTCGTGG - Intronic
1169515583 20:6312578-6312600 GACCCTCTGCTCCCATGCCCAGG + Intergenic
1170429959 20:16266814-16266836 GACCCTCAGATGCCCAGCTGCGG - Intergenic
1171384938 20:24763700-24763722 GACCACCAGCACCCCAGGCGCGG - Intergenic
1171448400 20:25220387-25220409 GACCCCCAGAACCCCAGCAGGGG - Intronic
1171448426 20:25220505-25220527 GACCCTCAGGACCCCAGCGGGGG - Intronic
1171880076 20:30611843-30611865 GAACCTCAGCTCCTGTGCCGAGG - Intergenic
1172313466 20:33935392-33935414 GACCCCCTGCTCCCCAGCCCTGG + Intergenic
1175194596 20:57234183-57234205 GACCCTCTTCTCCCCAGTTGAGG + Intronic
1176013275 20:62912172-62912194 GACTTTCAGCTCCCCAACCAGGG + Intronic
1176378806 21:6101566-6101588 GACCCCCACCTCCCCAGCATGGG + Intergenic
1179722603 21:43324152-43324174 CACCCTCAGCTCCCCATCCCAGG + Intergenic
1179744668 21:43436671-43436693 GACCCCCACCTCCCCAGCATGGG - Intergenic
1182760437 22:32718190-32718212 GGCCGTAAGCTCCCCAGCCTGGG - Intronic
1184154751 22:42660085-42660107 CCCCCTCAGCCCCCCATCCGTGG + Intergenic
1184402511 22:44282166-44282188 GGCCTTCGGCTCCCCAGCGGAGG - Intronic
1185179310 22:49350089-49350111 GCCCCTCAGATCCCCAGAAGAGG + Intergenic
1185302237 22:50087948-50087970 GCCCCTCAGCTCCCCAGCTCGGG - Intergenic
1185317864 22:50186460-50186482 GACCCTCCCCGCCCCAGCCCTGG - Intronic
949920064 3:8993478-8993500 GCCCCTCACCTCCCCACCCAGGG + Intronic
950423242 3:12910890-12910912 GGCCCCCTGCTCCCCAGCCCAGG + Intronic
952943182 3:38458630-38458652 TACCCTGAGCTCCCAAGCAGAGG - Intronic
953165031 3:40457418-40457440 GCGCCTCAGCTTCCCAGCGGAGG - Exonic
954638066 3:52082244-52082266 GGCCCTCAGCTCCCCTGCGCTGG - Intronic
954714666 3:52521100-52521122 CACCCAGAGCTCCCCAGCCCTGG - Intronic
955352625 3:58205184-58205206 GAACCTCAGCTTTCCAGCCCTGG + Intronic
959861649 3:111222815-111222837 GACCCACAGCTCTTCAGCCTTGG - Intronic
961378465 3:126482280-126482302 GATCCTCACCTGCCCAGCCATGG - Exonic
962842913 3:139251909-139251931 GACCCTCAGAGCCCCAGAAGAGG - Intronic
964805679 3:160607361-160607383 GAGCCACAGCACCCCAGCCTGGG + Intergenic
964960797 3:162422804-162422826 GCGCCTCTGCTCCCCAGCCTGGG - Intergenic
967936459 3:194731855-194731877 GACCCTCATCTCCAGAGCCTGGG + Intergenic
968727691 4:2255892-2255914 CACCCCCAGCTCCCCGGCAGCGG - Intronic
975118475 4:70704872-70704894 GACCCTCTGCTCCCCCGCCCAGG + Intronic
981527388 4:145720245-145720267 GACTCACAGCTCCCCAGCCAAGG + Intronic
982985781 4:162203805-162203827 GGGCCTCAGCTGCCCCGCCGCGG + Intergenic
984928528 4:184826578-184826600 GGCCCTCAGCTCCCCTGCACCGG - Exonic
985538527 5:477271-477293 GACTCTCAGCTCCCGAGGCTGGG + Intronic
985640788 5:1062667-1062689 GCCCCCCAGCCCCCCAGCCCTGG - Intronic
985669924 5:1201939-1201961 GACCCTCGGCTCCCCAAGCACGG + Intronic
985785135 5:1889395-1889417 GACCCTGAGCTCCTCATCTGTGG - Intergenic
985936546 5:3101896-3101918 AACACTCAGGTCCCCAGCAGTGG - Intergenic
986346875 5:6844018-6844040 GGCCCTCATCTTCCCAGCCCCGG + Intergenic
991449549 5:66737533-66737555 GACTCTCAGCTGCCCAGGCGCGG - Intronic
992964176 5:81983598-81983620 GCCCCTCACCTCCCCGGACGGGG + Intronic
996557712 5:124796306-124796328 CACCCTCACCTTCCCATCCGTGG + Intergenic
998072343 5:139207805-139207827 GGCCCTCAGATCCCCTGCCCTGG - Intronic
1000453651 5:161421295-161421317 GAGCCTCAGCAACCCAGCAGGGG + Intronic
1001045067 5:168365251-168365273 GAACCTCTCCTCCCCAGCCCAGG - Intronic
1001478007 5:172064685-172064707 GCCCCTGCGCTCCCCAGCTGAGG + Intronic
1004495563 6:16159759-16159781 GACCCTCAGCTAGTCAGCCTGGG - Intergenic
1006037149 6:31222869-31222891 GAGCCTCAGCCCCCCTGCCCTGG + Intergenic
1006388235 6:33744139-33744161 GACACGCAGCTCCTCAGCCATGG + Intronic
1006440064 6:34048409-34048431 GAGCCCCAGCTCCTCAGCCGAGG - Intronic
1006586522 6:35118298-35118320 AACCCTCATTTCCCCAGCCCAGG - Exonic
1007032227 6:38639375-38639397 GGCCCTCATCTCCCCTGCCCTGG - Intronic
1007416300 6:41693485-41693507 GACCCTCTCCTCCCCAGCATGGG - Intronic
1007494180 6:42248136-42248158 GACCCTAGGCTCCCCACCTGTGG - Intronic
1008160252 6:48068292-48068314 GATCCTCCTCTCCCCAACCGGGG - Exonic
1011491919 6:87901203-87901225 CACCATCAGGTCCCCAGCCAGGG - Intergenic
1011527051 6:88276611-88276633 GACCTTCAACACCCCAGCCATGG - Intergenic
1012989539 6:105911230-105911252 GACCCTGAGCTCCTGAGCAGAGG + Intergenic
1013336135 6:109164496-109164518 CACCCTTAGCTCCTCAGCCCTGG + Intergenic
1013656710 6:112254179-112254201 GACCCACAGCGCCCGAGCCCTGG - Exonic
1016051167 6:139532057-139532079 GAACCTCAGCCCCTCAGACGTGG + Intergenic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018632764 6:165834965-165834987 GCCCCTGAGCTCCCAAGCCCTGG - Intronic
1021959041 7:25854111-25854133 CACCCTCAAATCCCCCGCCGAGG + Intergenic
1023231519 7:38035480-38035502 GTCCCCCAGCTCCCCAGCTCTGG - Intergenic
1026773658 7:73217816-73217838 CACCCTGAGGTCCCCAGCCCTGG - Intergenic
1026837089 7:73646698-73646720 GAAGCTCAGCTCCTCAGCCTAGG - Intergenic
1027014517 7:74771210-74771232 CACCCTGAGGTCCCCAGCCCTGG - Intergenic
1027073516 7:75174747-75174769 CACCCTGAGGTCCCCAGCCCTGG + Intergenic
1034451569 7:151139789-151139811 GTCCCAAAGCTCCCCAGCCTTGG - Intronic
1034601552 7:152262148-152262170 GAACCCCAGGTCCCCAGCTGGGG - Intronic
1036033666 8:4996427-4996449 GACCCTCTGCTCCACAGGCCCGG - Intergenic
1036645724 8:10610749-10610771 GAGGCTCAGCTGCTCAGCCGGGG - Exonic
1041740700 8:61153606-61153628 GTCTCTCAGCTCCCCGACCGTGG - Intronic
1042704374 8:71650853-71650875 GCTCCCCAGCTCCCCAGCAGAGG - Intergenic
1048825177 8:138417281-138417303 CAGCCTCAGCTGCCCAGCCCAGG + Intronic
1048882821 8:138884228-138884250 AACCCTGAGCTCCTCAGCAGGGG + Intronic
1049555893 8:143281831-143281853 GACCCTCAGCTCCACCTCTGCGG - Intergenic
1049688821 8:143949968-143949990 CACCCGAAGGTCCCCAGCCGAGG + Intronic
1049838633 8:144755705-144755727 GACCCTCCGCTCAGCTGCCGTGG - Intronic
1049973853 9:843068-843090 AACCCTCTGCTCCCAAGGCGCGG - Intronic
1056163517 9:83921201-83921223 CACCCTCCGCTACCCACCCGCGG + Intronic
1056757387 9:89390356-89390378 GCCCCGCAGCCCCGCAGCCGTGG - Intronic
1056830307 9:89911823-89911845 CACCCTCAGCTCCCCTGCCATGG - Intergenic
1056992434 9:91424000-91424022 CGCCCTCAGCTCCCCCTCCGCGG + Intergenic
1058418957 9:104817029-104817051 GGCCCTCAGCTCCTCATCCCTGG + Intronic
1060294778 9:122336018-122336040 GTCTCTCAGCTCCCCACCGGTGG + Intergenic
1060807847 9:126588662-126588684 TGCCCTCAGCTCCCCAGCCTGGG - Intergenic
1061203889 9:129152170-129152192 CACCCTCCGCTTCCCAGCCCAGG - Intergenic
1062000785 9:134214713-134214735 GCCCCTCCCCTCCCCAGCTGAGG + Intergenic
1062204958 9:135331223-135331245 AAGCTTCAGCTCCCCAGCCCGGG - Intergenic
1062213234 9:135375811-135375833 GAGCCTCAGTTTCCCAGCCTGGG - Intergenic
1062732898 9:138119495-138119517 GATCCACAGCTCCACAGCCCAGG - Intronic
1190301746 X:49061024-49061046 GTCACTCAGCTGCCCAGCTGGGG + Intronic
1190427782 X:50348839-50348861 GACCCTCAGCTCCAGAGCTGTGG - Intronic
1192306519 X:69966002-69966024 GAGCCTCTGCTCTCCAGCCTGGG + Intronic
1199695944 X:150342591-150342613 GTCCCTCAGCTCCAGAGCTGGGG + Intergenic
1199736984 X:150693838-150693860 AAACCTCAGCGCCCCATCCGGGG + Intronic
1200118751 X:153780777-153780799 GAGCCTCCGCACCCCAGCTGAGG - Intronic
1200149664 X:153944919-153944941 GGCCCTCAGCCGCCCTGCCGGGG - Intergenic
1200299073 X:154954184-154954206 CACCCTCAACTCCCAAGCCCTGG - Intronic