ID: 935066609

View in Genome Browser
Species Human (GRCh38)
Location 2:99653738-99653760
Sequence TCGTAGGGTGCCCTGTCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 51}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935066609 Original CRISPR TCGTAGGGTGCCCTGTCTCT CGG (reversed) Intronic
901193482 1:7426304-7426326 TCCTAGGGTGCCCTGCCTGGTGG + Intronic
906279376 1:44542969-44542991 TCCTGGAGGGCCCTGTCTCTCGG + Intronic
916533852 1:165684473-165684495 TCTTAGGGTACCCTCTTTCTAGG - Intronic
1075881550 10:125856491-125856513 TCACAGGCTGCCCTGTGTCTTGG - Intronic
1077249619 11:1555238-1555260 TCCCAGGGTGCTCTCTCTCTAGG - Exonic
1077740859 11:4843545-4843567 ACGCAGGGTGCCATGTCTCAAGG + Intronic
1083307109 11:61766879-61766901 ATGTAGGGGCCCCTGTCTCTGGG + Intronic
1092299882 12:7237278-7237300 TCTTAGGTTGCCCAGTTTCTAGG + Intergenic
1095443440 12:42260764-42260786 GCCTAGGGTGCCCTGTCCCTAGG + Intronic
1102766359 12:115436959-115436981 AGGTAGAGTGACCTGTCTCTAGG - Intergenic
1104079451 12:125417337-125417359 TCCAAGGGTACCCTGCCTCTCGG - Intronic
1104176858 12:126341390-126341412 TCTTAGGATGCCCTGTCTTCTGG - Intergenic
1107085856 13:36427492-36427514 TCTTTGGGTGCCCCGTTTCTAGG + Intergenic
1108768363 13:53663391-53663413 TTGTAGGGTGCCATGTCCCAAGG - Intergenic
1114571005 14:23668528-23668550 TCCTAGTGGTCCCTGTCTCTTGG - Intergenic
1121251687 14:92504475-92504497 TGGTTGGGTGCCCCTTCTCTGGG - Intergenic
1128497959 15:68209025-68209047 TCCCAGGGTGACCTGTCTCCAGG + Intronic
1143666736 17:8366656-8366678 TGGTAAGGTGGCCAGTCTCTAGG + Intergenic
1155315465 18:24566702-24566724 TTGTAGGGTGGCCTGTTTCCAGG - Intergenic
1160894144 19:1394950-1394972 TCGTGGGATGCCCGGGCTCTGGG + Intronic
1161935925 19:7372209-7372231 TGGTAAGGTGCCCTTCCTCTGGG - Intronic
1165434377 19:35788222-35788244 TCATAGGGTGCCGGGTCCCTGGG + Exonic
1166053548 19:40275193-40275215 TGGGAGGTGGCCCTGTCTCTTGG - Intronic
935066609 2:99653738-99653760 TCGTAGGGTGCCCTGTCTCTCGG - Intronic
940829531 2:158452883-158452905 TTCTAGGTTGTCCTGTCTCTTGG - Intronic
948605247 2:239130790-239130812 TCTTGGGGGGCCCTGTCTCTCGG + Intronic
948681814 2:239640257-239640279 TTGGAGGGTGCCCTGTCTCCAGG + Intergenic
948919285 2:241053817-241053839 TCAGAGGGAGCCTTGTCTCTAGG - Intronic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1178669324 21:34577086-34577108 TCCTACGGTGCCCTGTGTCCTGG + Intronic
1182718861 22:32381520-32381542 TTTTAGGGTGCCTTGACTCTTGG - Intronic
1185109785 22:48894506-48894528 CCGTAGGGTGCCCTTCCTGTGGG + Intergenic
953933474 3:47019464-47019486 TGGTAGGCTGCCTTGTCTTTGGG - Intronic
966418361 3:179713505-179713527 GGGTAGGGTGCCCTCTGTCTGGG + Intronic
980707636 4:136520224-136520246 ACGCAGGGTGCCATGTCTCAAGG + Intergenic
982393253 4:154888934-154888956 TCCTAGGTTGCCATGGCTCTAGG + Intergenic
986440387 5:7776370-7776392 CCGTTTGGTGACCTGTCTCTGGG + Intronic
988087325 5:26488398-26488420 CTGTCTGGTGCCCTGTCTCTGGG + Intergenic
988833701 5:35010953-35010975 TCTTCTGGTGCCCTGGCTCTGGG - Intronic
1001347149 5:170914477-170914499 TGGTAGGTTGTCCTGGCTCTGGG - Intronic
1003586057 6:7390082-7390104 CCGTACAGTGCCCTGGCTCTGGG + Intronic
1018363131 6:163092918-163092940 TCGTTGGGTGACCTGTCGCTTGG + Intronic
1024294462 7:47831452-47831474 TCGTAGGGTGCCCAGGCATTTGG + Intronic
1032384095 7:131509490-131509512 TCGTGGGCTGCACTGTCTCCTGG + Exonic
1032582800 7:133118618-133118640 TAGTTGGGTGCCCTGACTCGGGG - Intergenic
1035458547 7:159024932-159024954 TCATAGTGTGCCCTGACGCTGGG - Intergenic
1037129734 8:15393219-15393241 TCGAGGGCAGCCCTGTCTCTTGG - Intergenic
1037710720 8:21353390-21353412 TCGGAGTGTGCCCTGTCTTTTGG - Intergenic
1048866520 8:138765454-138765476 TAGTAGGGTGGCCTGTCACAAGG - Intronic
1051218077 9:14820374-14820396 TAGTAAGGTGCCCTGTCCATGGG + Intronic
1053557949 9:39157888-39157910 TCTTAGGCTGCAGTGTCTCTTGG + Intronic
1053822067 9:41978174-41978196 TCTTAGGCTGCAGTGTCTCTTGG + Intronic
1054139165 9:61461064-61461086 TCTTAGGCTGCAGTGTCTCTTGG - Intergenic
1054608507 9:67209239-67209261 TCTTAGGCTGCAGTGTCTCTTGG - Intergenic
1055317412 9:75047999-75048021 TTGTAGGGTCCTCTGTCTTTTGG - Intergenic
1055418389 9:76108933-76108955 GGATATGGTGCCCTGTCTCTGGG + Intronic
1185675440 X:1845489-1845511 GCGTTGGGGGGCCTGTCTCTTGG - Intergenic