ID: 935066891

View in Genome Browser
Species Human (GRCh38)
Location 2:99656895-99656917
Sequence TCTATAGGGGTCAGGCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935066883_935066891 21 Left 935066883 2:99656851-99656873 CCTAGGAAGCATTTTGTTCGGTC 0: 1
1: 0
2: 1
3: 6
4: 70
Right 935066891 2:99656895-99656917 TCTATAGGGGTCAGGCAGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 86
935066886_935066891 -10 Left 935066886 2:99656882-99656904 CCTCATCCCATTCTCTATAGGGG 0: 1
1: 0
2: 0
3: 13
4: 125
Right 935066891 2:99656895-99656917 TCTATAGGGGTCAGGCAGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935066891 Original CRISPR TCTATAGGGGTCAGGCAGTC AGG Intronic