ID: 935071810

View in Genome Browser
Species Human (GRCh38)
Location 2:99700982-99701004
Sequence ATGAGTGTGGAGTGTTCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935071810_935071817 19 Left 935071810 2:99700982-99701004 CCCGGGGAACACTCCACACTCAT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 935071817 2:99701024-99701046 CCCTGACTGACAGCATGTCCAGG 0: 1
1: 0
2: 0
3: 15
4: 155
935071810_935071815 -4 Left 935071810 2:99700982-99701004 CCCGGGGAACACTCCACACTCAT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 935071815 2:99701001-99701023 TCATACTGAAAGGGACAGTGTGG 0: 1
1: 0
2: 2
3: 22
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935071810 Original CRISPR ATGAGTGTGGAGTGTTCCCC GGG (reversed) Intronic
900495615 1:2974707-2974729 GTGAGTGTGAGGCGTTCCCCAGG - Intergenic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
900994903 1:6115701-6115723 ATGGATGTGGACTTTTCCCCAGG + Intronic
902942584 1:19811382-19811404 TCGAGTGTGGAGTGTTGTCCAGG - Intergenic
904473926 1:30752379-30752401 AGGAGGGTGGAGAGGTCCCCAGG - Intronic
911148697 1:94576446-94576468 AGGAGAGTGGAGTGAACCCCAGG - Intergenic
912596386 1:110881077-110881099 ATGAGTGTGGAGTGATGGACAGG + Intronic
914440292 1:147699830-147699852 ATGAGTGTGGTGGGCTCCACGGG - Intergenic
916045853 1:160999504-160999526 ATGGGTGATCAGTGTTCCCCAGG + Intronic
916383341 1:164238108-164238130 ATGTGTGTGGGGTGTTTTCCTGG - Intergenic
917154140 1:171977894-171977916 ATGAGTCTGGAGTTTAGCCCAGG - Intronic
917448086 1:175123682-175123704 ATAAGTGTGAGGTGTTCCCCTGG - Intronic
920423086 1:205849353-205849375 AAGGGAGTGGAGTGTTCCCGGGG - Intronic
1067180496 10:43982276-43982298 ATGGGTGTGGAGTGGTCTCTTGG + Intergenic
1076556399 10:131324325-131324347 GTGAGTGTGGAAGGATCCCCAGG + Intergenic
1076556407 10:131324370-131324392 GTGAGTGTGGAAGGATCCCCAGG + Intergenic
1076556449 10:131324635-131324657 GTGAGTGTGGAAGGATCCCCAGG + Intergenic
1077578446 11:3402013-3402035 ATGAGTGTGTTGTGTTCCAATGG - Intergenic
1082186476 11:49188025-49188047 ATAATTGTGGAGTGTTCTCTTGG - Intronic
1083372663 11:62194137-62194159 ATGAGTGTGGAATGTGCGCTTGG - Intergenic
1083384213 11:62295666-62295688 ATGACTGTGGAGTGTGCACTGGG + Intergenic
1085299463 11:75449862-75449884 GTGAGTGAGGAGGGTCCCCCAGG - Intronic
1088024035 11:105156149-105156171 ATCTGTGTGGAGTTTTACCCTGG + Intergenic
1088674631 11:112180623-112180645 ATGTGTGTGGTGTGTCCCCAAGG + Intronic
1088882602 11:113983346-113983368 CTGAGCGAGGAGTGCTCCCCAGG + Intronic
1089367535 11:117930413-117930435 ATGCGTGTGAAGTGTTTCGCAGG - Intergenic
1090086905 11:123658170-123658192 ATGAGTGTGGAGAGATAGCCAGG - Intergenic
1096196162 12:49650090-49650112 AGGAGCATGGAGTGTTCCCCCGG - Intronic
1102652889 12:114455368-114455390 ATGAGGGTGGAGTGGGGCCCAGG - Intergenic
1104414120 12:128583875-128583897 CTGAATGAGGAGTCTTCCCCAGG + Intronic
1104791789 12:131487342-131487364 CTGAGTGTGGATTGTTGGCCAGG - Intergenic
1105722931 13:23134732-23134754 CTGAGTGGGGAGCATTCCCCTGG + Intergenic
1105899326 13:24742270-24742292 ATGGGGGTGGAGGGTTCCCTGGG + Intergenic
1106111479 13:26781458-26781480 ATGTCTGTGGAGTGCTCTCCTGG - Intergenic
1109961567 13:69638790-69638812 TTGAGTGTGGTGAGATCCCCTGG + Intergenic
1112323720 13:98429573-98429595 AAGAATGTGGAGTGTACCCCAGG + Intronic
1112591521 13:100767559-100767581 ATGAATGTGAAGTCTTGCCCAGG - Intergenic
1117341751 14:54797869-54797891 ATGGGTGAGGAGGCTTCCCCAGG - Intergenic
1119685499 14:76627780-76627802 ATCAGTGCGGGGTGTTCCCCTGG - Intergenic
1120325808 14:83024251-83024273 ATGAGTGTTGAGACTTCCCTGGG - Intergenic
1120329917 14:83079227-83079249 GTGAGTGAGGAGTGCTGCCCTGG - Intergenic
1120701739 14:87705825-87705847 ATGGGAGTGGTGTGTTCCTCAGG - Intergenic
1123701045 15:22915011-22915033 ATGAGTGGGGAGGGGTCACCGGG + Intronic
1128662851 15:69514949-69514971 ATGGGTATGGAGTGTTCTGCTGG - Intergenic
1129786326 15:78312624-78312646 GTGAATGTGGAGTGATTCCCAGG - Intergenic
1131438982 15:92444499-92444521 GTGAGTGTGGAGAGATGCCCTGG + Intronic
1139012966 16:62656004-62656026 ATGAGTGTGGTGTGTTGCACAGG + Intergenic
1139433502 16:66923720-66923742 ATGTGTGTTGTGTGTTCTCCAGG - Exonic
1149848508 17:60021446-60021468 AAGAGAGTAGAGTGTACCCCAGG + Intergenic
1149861661 17:60125078-60125100 AAGAGAGTAGAGTGTACCCCAGG - Intergenic
1150338405 17:64346262-64346284 AGGAGTGTGCAGTGACCCCCGGG + Intronic
1151579138 17:74968388-74968410 CTGAGTTTGGAGAGTTCCACGGG - Intronic
1152023930 17:77796714-77796736 ATGGGTGTGGAGTGTTTGCCAGG - Intergenic
1152034455 17:77863598-77863620 AGGACTGATGAGTGTTCCCCTGG - Intergenic
1152267826 17:79306568-79306590 ATGAGGGTGGGGTCTTCCTCAGG + Intronic
1152401230 17:80067448-80067470 GTGAGTGTGGTGTGCTCCCACGG - Intronic
1152466771 17:80471054-80471076 ATGAGAGTGGAGGGGTCGCCAGG + Intronic
1154079557 18:11242929-11242951 ACCAGTGTGGAGTGCTCCCAGGG + Intergenic
1156593815 18:38522826-38522848 ATGAGTGAAGAGTGTTCACATGG + Intergenic
1157800201 18:50613434-50613456 ATGAGCTTGGATTCTTCCCCAGG + Intronic
1157898522 18:51491210-51491232 TTGAGTCTCTAGTGTTCCCCGGG + Intergenic
1159286684 18:66362821-66362843 GTAAGTGTGGAGTGTTTTCCTGG + Intergenic
1161038040 19:2096329-2096351 ATGCGTGTGGGGCGTTCCCGCGG - Exonic
1163575964 19:18110795-18110817 ATGAGTCTGGAGGGTTTCCAAGG - Intronic
1164904621 19:31956980-31957002 ATTTGTGTAGAGTGTTCCCTGGG - Intergenic
1168693729 19:58393401-58393423 ATGCGTGTGGAGTCCTCCCGGGG - Exonic
926736194 2:16074835-16074857 AGGAGAGTGGAGTGAACCCCGGG + Intergenic
927517968 2:23682941-23682963 ATGCATGTGGCGTGTTCTCCAGG + Intronic
929665056 2:43827473-43827495 ATGAGTGGCGAGGTTTCCCCAGG + Intronic
930740531 2:54827853-54827875 ATGAGTAGGGAGTGTTCAGCAGG - Intronic
935071810 2:99700982-99701004 ATGAGTGTGGAGTGTTCCCCGGG - Intronic
935891981 2:107688631-107688653 ATGTGTATGGAATGTTCCCAGGG - Intergenic
936046225 2:109189947-109189969 CTCTGTGTGGAATGTTCCCCTGG + Intronic
936154217 2:110037624-110037646 ATGGGTGGGGACTCTTCCCCAGG - Intergenic
936190467 2:110333791-110333813 ATGGGTGGGGACTCTTCCCCAGG + Intergenic
937429314 2:121825201-121825223 ATGTGTGTGAAGTGTGGCCCTGG - Intergenic
941419426 2:165264043-165264065 ATAAGTGTTTAGTGTTTCCCAGG + Intronic
948609823 2:239159692-239159714 GTGAGTGTGGAGTGTGGCCGGGG - Intronic
1168840700 20:908261-908283 ATGAGACTGGAGTGCTCACCAGG - Intronic
1171400151 20:24867954-24867976 GTGAGAGGGGAGTCTTCCCCTGG - Intergenic
1174792500 20:53493403-53493425 ATGAGTGTGCAGTTTTCCCATGG - Exonic
1175519556 20:59591363-59591385 ATGAGTGAGGAGCCTTGCCCGGG - Intronic
1178055218 21:28791163-28791185 ATGAGTGTGGGGTGTGACCTGGG - Intergenic
1181603676 22:23967124-23967146 AGGAGTGGGGAGTGGTCCCTGGG - Intronic
1181604837 22:23974183-23974205 AGGAGTGGGGAGTGGTCCCTGGG + Intronic
1184266717 22:43351185-43351207 ATGAATGGGAAGTGTTGCCCTGG + Intergenic
951539789 3:23771408-23771430 ATGAGTGTAGAATATTCCACTGG + Intergenic
951695653 3:25443300-25443322 ATGAGAGTGGAATATTTCCCTGG + Intronic
952006851 3:28850953-28850975 CTGAATGTGGGGTTTTCCCCTGG + Intergenic
955393138 3:58535739-58535761 CTGCCTGTGAAGTGTTCCCCTGG + Intronic
956916952 3:73881604-73881626 ATGAGTGTAGAGTGCTGCCAGGG + Intergenic
968423787 4:507325-507347 ATGACTGTTGCGTTTTCCCCGGG + Intronic
969590309 4:8118271-8118293 ATGAGTGTGGAGTGCTCTTCTGG - Intronic
969657440 4:8506482-8506504 ATGAGCATGGAGTGGTGCCCGGG - Intergenic
970604444 4:17666265-17666287 TTGAGTGTTGAGTGTTCCTTAGG - Intronic
970696759 4:18686854-18686876 CTGGGTGTGCAGTGCTCCCCAGG - Intergenic
977028176 4:91847490-91847512 ATGACTGCGGAGTGTTTCCACGG - Intergenic
978592256 4:110337269-110337291 ATGGGTGTGGGGTCTTCCTCTGG - Intergenic
983485888 4:168331163-168331185 TTGAGTGTGCAGTTTCCCCCTGG - Intergenic
985687844 5:1291426-1291448 GTGAGTGAGGCGTGGTCCCCGGG - Intronic
986010212 5:3707166-3707188 ATGAATGTGTTGTTTTCCCCCGG - Intergenic
991379481 5:66004859-66004881 ATGTGTGAGGACTGTTCCCGGGG + Intronic
992367772 5:76110837-76110859 ATGAGTGTTGGGAGTTCCCCAGG + Intronic
995051757 5:107714946-107714968 ATAAGGGAGGAGTGTTGCCCTGG - Intergenic
995068822 5:107894032-107894054 ATGTGTGTGGATTTTTCCCTAGG + Intronic
996117154 5:119631504-119631526 ATGTGTATTGAGTGTTGCCCAGG - Intronic
997913204 5:137896956-137896978 ATGAGTTTGTAGTGTTCCTGAGG + Intronic
998505632 5:142669843-142669865 CAGAGTGTGGAGTGACCCCCAGG - Intronic
998511014 5:142713919-142713941 ATGAGTGTGGAGTTTAAGCCTGG - Intergenic
999328898 5:150659774-150659796 AAGAGTGAGGTGTGTTCCCAGGG - Intergenic
1000029407 5:157389343-157389365 ATGAGTGTGTGGAGTTCCACCGG + Exonic
1004910059 6:20274224-20274246 AAGAGTGTGGAATGTTCAGCAGG - Intergenic
1006802780 6:36769924-36769946 AAGAGTGTGGAGTCCTCACCTGG - Intronic
1006884887 6:37373007-37373029 ATGAGAGTGGCATGTCCCCCAGG - Intronic
1007260141 6:40557586-40557608 ATGAGAGTGGGGTGTGCCCAGGG + Intronic
1013991479 6:116258733-116258755 ATGCGTGTGGAGTCCTCCCGGGG + Intronic
1016119153 6:140326465-140326487 ATGAGTGCTGATTGTTCCCTGGG + Intergenic
1018455986 6:163952514-163952536 ATGAGAGTGGGTTGTGCCCCAGG - Intergenic
1023295241 7:38708112-38708134 AGAAGAGTGGAGGGTTCCCCAGG + Intergenic
1024747356 7:52423711-52423733 ATGAATGTGGAGTGGACCCCAGG - Intergenic
1031596945 7:123659503-123659525 CTGAGTGTGAAGGGTTTCCCAGG - Intronic
1032866845 7:135934336-135934358 ATGGGTGAGGAGTGTACCCATGG - Intronic
1033981561 7:147171141-147171163 ATGAGCGTGGGCTGTCCCCCAGG + Intronic
1035432677 7:158834054-158834076 AGGAGTGTTGAGTGCTCACCTGG - Intergenic
1036847770 8:12181435-12181457 AGGAGTCTGGTGTCTTCCCCAGG + Intergenic
1036869138 8:12423750-12423772 AGGAGTCTGGTGTCTTCCCCAGG + Intergenic
1037344936 8:17888633-17888655 ATGAATAAGGAGTGTTCCCAAGG - Intronic
1043443966 8:80301227-80301249 GTGAGTGTGGAGTCCTCCCGGGG - Intergenic
1046407740 8:113796655-113796677 GTGTGTGTGGTGTGCTCCCCGGG + Intergenic
1049391667 8:142374870-142374892 ATGTGTGTGGGGTCTTCCCAGGG - Intronic
1049545165 8:143227434-143227456 ATGAGTGTGGGGTCAGCCCCAGG + Intergenic
1052656098 9:31363332-31363354 ATGGGTGTGCAGTGTGCCACGGG + Intergenic
1055426444 9:76201547-76201569 ATGATTGTGGAGTGTGCGACGGG + Intronic
1060508817 9:124217541-124217563 CTGAGTGGGGAGTGTGACCCAGG + Intergenic
1061163467 9:128909426-128909448 CTGAGTGTGGAGTCCTCACCTGG + Intronic
1062303742 9:135890202-135890224 ATGTGTGTGGAGCATTCCACAGG - Intronic
1062613927 9:137387612-137387634 CTGAGTGGGGTGTGTCCCCCAGG - Intronic
1185596822 X:1312271-1312293 ATGATTCTGGAGTGTCCCCGTGG - Intergenic
1186853109 X:13599981-13600003 ATGAGTGTGGAATGAAACCCCGG + Exonic
1188535738 X:31194816-31194838 ATGAGTGTGAAAAGTTCCCCAGG + Intronic
1189004011 X:36976796-36976818 GTGGGTTTGGAGTGTACCCCAGG - Intergenic
1189942377 X:46138019-46138041 ATGTTTGTGCAGTGTTCCACAGG - Intergenic
1194004923 X:88478977-88478999 ATAAGTGTGGAGTCTTTTCCTGG + Intergenic
1195112517 X:101661485-101661507 ATCAGTGGGGATTGTTCCCTGGG - Intergenic
1195252957 X:103065631-103065653 GTCAGTGGAGAGTGTTCCCCAGG - Intergenic
1196900229 X:120375398-120375420 ATGAATGTAGATTGTCCCCCGGG + Exonic