ID: 935074636

View in Genome Browser
Species Human (GRCh38)
Location 2:99729076-99729098
Sequence CAGTTTCACCAAATTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935074636 Original CRISPR CAGTTTCACCAAATTAAAGC AGG (reversed) Intronic
901881509 1:12196758-12196780 CAGTGTCACTGAATTGAAGCTGG - Intronic
907652022 1:56304212-56304234 CTGTTTCCCCAAATTAGAGAGGG + Intergenic
908291674 1:62673408-62673430 CAGTTTCATCAACTAAAAGCTGG + Intronic
909332640 1:74432627-74432649 CTGTTCCACCAAGGTAAAGCAGG - Intronic
917447718 1:175120726-175120748 CAGCATAACCAAAGTAAAGCTGG - Intronic
917748297 1:178031946-178031968 CAGTTTTACCTCAGTAAAGCTGG + Intergenic
918632550 1:186735460-186735482 CAGTTTTTGCAAATTAAAGGTGG - Intergenic
924504142 1:244665227-244665249 CAGTTTCATCAACTTAAAAAGGG - Intronic
924742895 1:246807322-246807344 CAGGTCCACCAAATTAATACTGG + Intergenic
1064266518 10:13829862-13829884 GTGTTTCACCAAAATAAATCGGG + Intronic
1069922640 10:71826043-71826065 CATTTTCATCTTATTAAAGCTGG - Intronic
1071161298 10:82748753-82748775 CAGTTTCCACACATTAAAGTGGG - Intronic
1073803356 10:107068323-107068345 CTGCTTCACCAAATACAAGCAGG - Intronic
1075435669 10:122439151-122439173 AGCTTTCACCAAATTAAAGAGGG - Exonic
1079561945 11:21832494-21832516 TATTTTCACCAAATGAAAGATGG + Intergenic
1079650209 11:22919030-22919052 CAGTTACACCTCAATAAAGCTGG + Intergenic
1079773111 11:24488826-24488848 AAGTTCCACCAAACTTAAGCAGG - Intergenic
1080280568 11:30552217-30552239 CTGTTTGACCAGATTAACGCAGG - Intronic
1081059889 11:38461404-38461426 TTGTTTCTCCAAATTAAAGAAGG - Intergenic
1082190311 11:49235009-49235031 CAGTTATACCTCATTAAAGCTGG - Intergenic
1082702994 11:56456702-56456724 CACCTTCCCCAAATTAAATCAGG - Intergenic
1086675811 11:89605903-89605925 CAGTTATACCTCATTAAAGCTGG + Intergenic
1088093625 11:106073710-106073732 CAGTTTTAGGAAATTAAAGGCGG + Intronic
1088627998 11:111746350-111746372 CATTCTCAGCAAATTAACGCGGG + Intronic
1090919094 11:131192542-131192564 CATTTTCAACAGAGTAAAGCAGG - Intergenic
1091855362 12:3735197-3735219 CAGTTACACCTCAATAAAGCTGG + Intronic
1093385584 12:18549258-18549280 CAATTTCTCCCAAGTAAAGCAGG + Intronic
1095797456 12:46235926-46235948 ATGTTTCACCAAATTTAAGGTGG + Intronic
1097122615 12:56747212-56747234 AACTTTCACCAACTTAAAGCAGG + Intronic
1099162392 12:79259128-79259150 CAGTTTCACCAATTTGAACCTGG + Intronic
1099463826 12:82957785-82957807 CAGTTTCACAAGATTGAACCTGG + Intronic
1099916792 12:88904720-88904742 CAGTTTCACCATATGAAATGTGG - Intergenic
1101393729 12:104325334-104325356 CAGGTTGAACAAATTGAAGCAGG + Exonic
1107282558 13:38753827-38753849 CAGTGTTACCCAATTAAATCAGG + Intronic
1107829889 13:44365108-44365130 CAGTTCCACCAAGATGAAGCTGG + Intergenic
1110019457 13:70451884-70451906 AAATTTGACCAAATGAAAGCTGG - Intergenic
1111295332 13:86269619-86269641 AAGTTTCAGCCAATTAAAGGTGG + Intergenic
1111675413 13:91381044-91381066 CAGTTCCCCCAAATTCTAGCTGG - Intergenic
1112335800 13:98514706-98514728 CAGTTTAACCAAAGCAAATCAGG - Intronic
1115654646 14:35431660-35431682 AAGCTTCTCCAAATTAACGCAGG - Intergenic
1116766517 14:49077911-49077933 TAGTTTAACCAAATCAGAGCAGG + Intergenic
1116779870 14:49225152-49225174 CACTTTCACCTGATTAAATCAGG + Intergenic
1117546119 14:56795875-56795897 CAGTTTCCCCAGGTAAAAGCTGG - Intergenic
1119849292 14:77855414-77855436 CAATTTCACCACATAGAAGCTGG - Intronic
1121655348 14:95591442-95591464 CAGTTTCAGCAAACTAACACAGG + Intergenic
1124846577 15:33297177-33297199 CAGTTTCAACTAATTAGATCAGG + Intergenic
1125094157 15:35831594-35831616 CAGTTTCACCTAGTTAGGGCTGG - Intergenic
1126903023 15:53333880-53333902 CAGCTTCATAAAATTTAAGCTGG - Intergenic
1127333305 15:57959461-57959483 AAGTTTCCCCAAATTCCAGCTGG - Intronic
1131477428 15:92752131-92752153 CAGTTTCCCCAAAGTAAGGAAGG - Intronic
1132706305 16:1244890-1244912 CAGTTTCCCCACATCAAAGAGGG + Intergenic
1134259162 16:12637041-12637063 CACCTTCACCTAATTAAAGTGGG + Intergenic
1148933548 17:51146568-51146590 CAGTTTAAACAAATTAATTCAGG + Intergenic
1149829584 17:59860348-59860370 CAGTTTCACGTCATTAGAGCAGG - Exonic
1150258058 17:63765261-63765283 CAGTTACACCTCAATAAAGCTGG + Intronic
1150675295 17:67240778-67240800 CAGTTTCTCCAAGTAAGAGCAGG - Intronic
1150708802 17:67512187-67512209 CAGTTTCTTCAAATGAAAACCGG + Intronic
1155992330 18:32291756-32291778 CATTCTCAGCAAATTAACGCAGG - Intronic
1158064530 18:53390041-53390063 CATTTTTGCCAAATTAAAGCAGG - Intronic
1159116290 18:64116584-64116606 CAATTACACCAAAATAAAGCCGG - Intergenic
1159256348 18:65952399-65952421 CATCTTCAGCAAACTAAAGCAGG + Intergenic
1160293831 18:77619740-77619762 CTGTTTCACCAAATAACATCTGG + Intergenic
1161885699 19:6993634-6993656 AAGTTTCACAAAATGTAAGCAGG + Intergenic
1162442655 19:10702370-10702392 CAGTTGAACCAACTCAAAGCGGG + Intronic
926281706 2:11453911-11453933 CACATTGACCAAATCAAAGCTGG + Intronic
926955858 2:18299089-18299111 CAGTTTAACCAAATTGAAAAAGG + Intronic
927761595 2:25760987-25761009 TAGTTTCACAATATTAAAGAGGG + Intronic
928785273 2:34876874-34876896 CAGTTTCTCCATTTTATAGCGGG - Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
931793604 2:65688656-65688678 CAGGTTTAGCAAATTAATGCAGG - Intergenic
933854805 2:86402843-86402865 CATTATCATCAAATGAAAGCAGG - Intergenic
935074636 2:99729076-99729098 CAGTTTCACCAAATTAAAGCAGG - Intronic
935089765 2:99883862-99883884 CAATTTTACCAAATTAAAAATGG + Intronic
935343000 2:102074585-102074607 CAGAAGCACCAAATTCAAGCTGG + Intronic
937048668 2:118869837-118869859 CAGTCTCACTAAATTGAAGCTGG - Intergenic
938798711 2:134740246-134740268 CTGATCCACCAAATTAAAGGTGG - Intergenic
941181295 2:162262509-162262531 CAGTGTAACCCAATTGAAGCTGG - Intergenic
941928291 2:170917046-170917068 CATTTTCTCCACACTAAAGCAGG + Intergenic
942403861 2:175631970-175631992 TAATGTCACTAAATTAAAGCAGG + Intergenic
942437423 2:175995581-175995603 CAGTTTCTACAAATAAAAGATGG - Exonic
942623727 2:177876706-177876728 CAGTTTCACACAATTAAATAAGG + Intronic
943069645 2:183125109-183125131 CACTTTCCCCAAATAAAGGCGGG - Intronic
943820188 2:192312720-192312742 GAGTTTATCCAAATTATAGCAGG - Intergenic
944112743 2:196151552-196151574 CATTTTGAGCAAATTAAAGTTGG - Intronic
945612528 2:212022408-212022430 TATCCTCACCAAATTAAAGCAGG + Intronic
945886705 2:215383478-215383500 CAATTTCTACAAATAAAAGCAGG + Exonic
946533804 2:220605399-220605421 CAGTGTGCCCAAAATAAAGCAGG - Intergenic
947354652 2:229279651-229279673 CATCCTCAGCAAATTAAAGCAGG + Intergenic
1170196661 20:13695824-13695846 TAGTATCACCATATTAAAGTTGG + Intergenic
1170808672 20:19656276-19656298 CAGTGTCCCCAGATTAAAACAGG + Intronic
1173762783 20:45578744-45578766 CATTTTCAAAAAATTAAAACAGG - Intronic
1176189081 20:63799017-63799039 CAGTTTCACCAAAATAATTGTGG - Intronic
1176690076 21:9895723-9895745 TAGGTTTTCCAAATTAAAGCTGG - Intergenic
1179361962 21:40718194-40718216 CAGTTTCACTAACGTAAAGAGGG + Intronic
1181555661 22:23670434-23670456 CAGTTTCCCCACATGTAAGCAGG - Intergenic
1183843883 22:40524078-40524100 CACTTTCAAAAAATTAAAACAGG + Intronic
949654862 3:6206337-6206359 CAGTTCCAGTAAATTACAGCAGG - Intergenic
952386501 3:32845269-32845291 CATTTTCACCCAATTAACCCTGG - Intronic
952561116 3:34594663-34594685 CAGTTTTATCAAATTAAAAAGGG - Intergenic
955899862 3:63740927-63740949 CAGTTTCATTAAATTAAAATTGG - Intergenic
956080616 3:65551890-65551912 GAGGTTCACCAAAGCAAAGCTGG + Intronic
957255950 3:77838188-77838210 CAGTTTCTCCTCATTAAGGCGGG - Intergenic
957417670 3:79927949-79927971 TATTCTCACCAAACTAAAGCAGG - Intergenic
957717400 3:83946515-83946537 CAGTTTGAGCAAATTAATACAGG - Intergenic
958818955 3:98951009-98951031 CATTTTCAGCAAATTAACACAGG + Intergenic
959801558 3:110501224-110501246 CATTTTCAGCAAATTAACACAGG + Intergenic
960013568 3:112860091-112860113 CAGTTTCAATAAATTAAATATGG - Intergenic
961754364 3:129119284-129119306 CAGAGGCTCCAAATTAAAGCTGG - Intronic
963601318 3:147381106-147381128 CTGTTCCACCATAGTAAAGCTGG - Intergenic
963943738 3:151122093-151122115 CATATTAACCAAATTAAAGATGG - Intronic
964624006 3:158741500-158741522 CAGTCTCACTAGATTCAAGCTGG - Intronic
964705895 3:159618133-159618155 CAGTTTCCCCATATTTAAGGTGG - Intronic
965091932 3:164175607-164175629 CATTTTCAGCAAATTAACACAGG + Intergenic
965951732 3:174317067-174317089 CAGTTTCTCCAAATTTAATAAGG - Intergenic
968874609 4:3259180-3259202 CATTTTCAACAAGTTTAAGCTGG - Intronic
973169846 4:47127916-47127938 TAATTTAACTAAATTAAAGCAGG + Intronic
975502776 4:75105170-75105192 CATTTGCATGAAATTAAAGCAGG - Intergenic
976750329 4:88446261-88446283 GACTTTCACCAAGTTAAAACGGG + Intergenic
976867256 4:89744662-89744684 CAGACTCACCAAATTTAACCTGG + Intronic
977754736 4:100654688-100654710 CAGTTACACCACACTAAAGTTGG - Intronic
978151580 4:105442172-105442194 CTTTTGCTCCAAATTAAAGCTGG - Intronic
978383828 4:108160170-108160192 AACTTTCACTACATTAAAGCTGG + Intronic
980353489 4:131713654-131713676 TAGGTTTTCCAAATTAAAGCTGG - Intergenic
981099711 4:140816641-140816663 CAGATTCACCAACTGAAAACTGG + Intergenic
981265773 4:142781598-142781620 CAGTTTCACTAAATCACAGATGG - Intronic
982674377 4:158359096-158359118 CATTCTCAGCAAATTAATGCAGG + Intronic
982831079 4:160061432-160061454 CATTCTCAGCAAATTAATGCAGG - Intergenic
984092696 4:175394086-175394108 CTGTTTCACCAAATTTAAAATGG - Intergenic
985148861 4:186924535-186924557 AAGTTTCACCAAAATGAAACAGG - Intergenic
986753160 5:10808907-10808929 CAGTCTCTCCAAATCACAGCAGG + Intergenic
986922491 5:12704520-12704542 CAGTGTCACCAAAGTTAAACAGG + Intergenic
986958517 5:13186205-13186227 CATTTTCTCCAAATTAAGCCAGG - Intergenic
988067248 5:26237119-26237141 CAGTTTCACCAATAGACAGCTGG - Intergenic
991515049 5:67425964-67425986 CAGTTATACCATAATAAAGCTGG - Intergenic
992418352 5:76575177-76575199 CATTTTCACCAAATAAAATCTGG - Intronic
994569160 5:101491555-101491577 CAGCTTCACAAAATTAAAAGGGG - Intergenic
995649559 5:114354695-114354717 TAGTTTCAACTAATTAAAACAGG + Intergenic
995824385 5:116277654-116277676 CTGTTTCAACAAATTAAAAAGGG - Intronic
996872887 5:128211713-128211735 CAGTTACACCTAAATAAAGCTGG + Intergenic
1003472165 6:6447146-6447168 CCGTATCAACAAATTAGAGCTGG - Intergenic
1003626022 6:7741996-7742018 CAGTTTCTCAAAAATAAAACTGG + Intronic
1004655094 6:17652088-17652110 CAAATTCACCAAATAAAAGTTGG + Intronic
1005140330 6:22624391-22624413 CACATTCAACTAATTAAAGCTGG - Intergenic
1007421359 6:41721754-41721776 CAGTTTCACCACATTTAAAATGG - Intronic
1007987775 6:46224474-46224496 CAGTTTGACCAAAACAAAGAAGG - Intronic
1008369684 6:50718218-50718240 CATTTTCACCATATTGAGGCAGG - Intronic
1009295807 6:61945269-61945291 AAGTTTCACGAAAATAAAACAGG + Intronic
1016946716 6:149541564-149541586 CAGTTTCAAGAAATTCAAGCAGG + Exonic
1017580827 6:155863452-155863474 CAGTCTCCCCAGATTAAACCAGG + Intergenic
1018626899 6:165788723-165788745 CAGTTTTTCCAAATTAAAGCAGG + Intronic
1018759290 6:166876873-166876895 CAATCTCACCAAATTGACGCAGG + Intronic
1019832960 7:3351607-3351629 CACTTTAAGCAAAATAAAGCTGG + Intronic
1020293447 7:6740272-6740294 CAGTTCCACACAATTAAATCCGG - Intergenic
1022766756 7:33421152-33421174 AATCCTCACCAAATTAAAGCAGG - Intronic
1024076939 7:45825949-45825971 AAGGTTCACCAAATTCAGGCCGG - Intergenic
1024406639 7:48989822-48989844 CAGGTTCTCCAGATTAAAGATGG - Intergenic
1024496044 7:50047021-50047043 CATTTTCAGCAAATTAACACAGG + Intronic
1025127482 7:56355468-56355490 AAGGTTCACCAAATTCAGGCCGG + Intergenic
1027363156 7:77430088-77430110 CAGTTTCATTAAATAAAAGCTGG - Intergenic
1027923501 7:84428954-84428976 CATTTTCACCAAATTTTAGGAGG + Intronic
1028037078 7:85998572-85998594 CAGTCTCACCAAACTAAATAAGG - Intergenic
1030740828 7:113107733-113107755 CAGTTTCATTAAATTTATGCAGG + Intergenic
1035549389 8:508924-508946 CAGTTTCTCCCATTTGAAGCAGG - Intronic
1036966093 8:13300158-13300180 CATCTTCAGCAAACTAAAGCAGG + Intronic
1037251629 8:16902101-16902123 AAGTTTAAGCAAATAAAAGCAGG + Intergenic
1038860185 8:31379338-31379360 CAGTCTCATCCAATTAAATCTGG + Intergenic
1039247284 8:35622814-35622836 CAGTTTGACCAAATTATTGTAGG - Intronic
1039740699 8:40380078-40380100 CTGTCTCCCCATATTAAAGCTGG - Intergenic
1040467782 8:47711146-47711168 CAATTTTACCATATTTAAGCTGG + Intronic
1043580221 8:81703738-81703760 AAGTTTTATCAAATTAAACCTGG + Intronic
1043878128 8:85509528-85509550 AAGTTTCAGCCAATCAAAGCTGG - Intergenic
1044343296 8:91071831-91071853 AAGCTTCACCAAATCAAAGTTGG + Intronic
1046577368 8:116047551-116047573 CAAATTCATGAAATTAAAGCTGG - Intergenic
1048618704 8:136107915-136107937 CATTTTTATCAAATGAAAGCAGG + Intergenic
1050875172 9:10625004-10625026 AAGTTTCACAAAATTAAATTTGG + Intergenic
1050915039 9:11121359-11121381 CAGTTTCAGCAAACTAACACAGG + Intergenic
1052981451 9:34452846-34452868 CAGGAGCACCAAATGAAAGCAGG - Intronic
1053626804 9:39880268-39880290 TAGGTTTTCCAAATTAAAGCTGG - Intergenic
1053779184 9:41585752-41585774 TAGGTTTTCCAAATTAAAGCTGG + Intergenic
1054167144 9:61795993-61796015 TAGGTTTTCCAAATTAAAGCTGG + Intergenic
1054217083 9:62370435-62370457 TAGGTTTTCCAAATTAAAGCTGG + Intergenic
1054670403 9:67784905-67784927 TAGGTTTTCCAAATTAAAGCTGG - Intergenic
1059889718 9:118787738-118787760 CACTTTCAACAAAATTAAGCAGG - Intergenic
1060779957 9:126404305-126404327 CAGTTTCCTCAACTTAAACCTGG - Intronic
1060965074 9:127707635-127707657 CAGTTTCCCCAAATATAAGTGGG + Intronic
1061048419 9:128180049-128180071 CAGATTCACCTAAATAAACCGGG + Intronic
1062028767 9:134352585-134352607 CAGTCCCACCAAAGGAAAGCGGG - Intronic
1185715766 X:2341020-2341042 CAGGTTCAGCAAATCAAGGCAGG + Intronic
1186605801 X:11089588-11089610 CAGTCTCAGCAAATTAACACAGG - Intergenic
1186973003 X:14870110-14870132 CAGTTACACCTCAATAAAGCTGG - Intronic
1188925686 X:36040148-36040170 CAGCATAACCAAAATAAAGCTGG + Intronic
1193652707 X:84157810-84157832 TAGTTTCACCAAACCTAAGCAGG + Intronic
1196881511 X:120202575-120202597 AAGTTTCACCACATTATAACAGG + Intergenic
1197652751 X:129083738-129083760 CGGGTACAGCAAATTAAAGCTGG + Intergenic
1198020516 X:132652806-132652828 CAGTGTGATCAAATTAAAACAGG + Intronic
1199232591 X:145455245-145455267 TAGTTTGACCAAATGAAATCAGG - Intergenic
1200268055 X:154656847-154656869 CATTTTCAGCAAATTAACACAGG + Intergenic