ID: 935084427

View in Genome Browser
Species Human (GRCh38)
Location 2:99830814-99830836
Sequence ATGCACAACAATAAACAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 739
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 697}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935084427 Original CRISPR ATGCACAACAATAAACAGCA TGG (reversed) Intronic
900868422 1:5285045-5285067 ATGGTCAACAATCACCAGCATGG - Intergenic
902102046 1:13998543-13998565 ATGGAAAGCAAAAAACAGCAGGG + Intergenic
903598661 1:24516979-24517001 TTTTACAACAATAAACAACAAGG - Intronic
903664963 1:25000722-25000744 TTGCTCAACATTACACAGCAAGG - Intergenic
904163904 1:28540766-28540788 TTGCACAATAATAAAAAGTAGGG + Intergenic
904969346 1:34406759-34406781 AAGCAGAACAATAAACAGGAAGG - Intergenic
905261694 1:36723473-36723495 CTGCACAGCAAACAACAGCAGGG + Intergenic
905635713 1:39550521-39550543 AATCACAAAAATAAAAAGCAGGG + Intergenic
905963071 1:42061545-42061567 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
906342734 1:44994964-44994986 ATGTACAAAAATAAAATGCAAGG - Intergenic
906569916 1:46828972-46828994 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
906736692 1:48136685-48136707 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
906738132 1:48152308-48152330 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
907062081 1:51437982-51438004 ATTCACAAGAATAAAAACCAAGG + Intronic
907231899 1:53006949-53006971 ATGGAAAACAAAAAAAAGCAGGG + Intronic
909281748 1:73764349-73764371 ATGCACAACAACAAAGAGAATGG + Intergenic
909515380 1:76501402-76501424 TTGCACAAAAACAAACACCAGGG + Intronic
909661371 1:78086757-78086779 ATGGAAAACAAAAAAAAGCAGGG - Intronic
909695398 1:78463225-78463247 ATGGAAAACAAGAAAAAGCAGGG - Intronic
909772933 1:79447438-79447460 AAGAACAACATTAAACATCATGG - Intergenic
909846231 1:80398167-80398189 ATGGACAACAAAAAAAGGCAGGG - Intergenic
909886461 1:80947705-80947727 ATGGACAACAAAAAAAGGCAGGG + Intergenic
911021341 1:93391076-93391098 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
911021355 1:93391198-93391220 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
911036845 1:93559484-93559506 ATGCACAACACCAATCATCAGGG - Intergenic
911075699 1:93872213-93872235 AAGAACGACAAAAAACAGCAGGG - Exonic
911243006 1:95485398-95485420 ATGGAAAGCAAAAAACAGCAGGG + Intergenic
911895394 1:103427175-103427197 AACCACAACAATAAATAGGATGG + Intergenic
911954830 1:104220892-104220914 ATGCAAAACAAAAAAAGGCAGGG - Intergenic
912092886 1:106103490-106103512 AACAACAACAATATACAGCAAGG - Intergenic
912754254 1:112311189-112311211 ATTCACAATAATAATCAGAAGGG + Intergenic
912879451 1:113394393-113394415 TTGCAGAAAAATAAACAACAGGG - Intronic
913033333 1:114934726-114934748 ATGGAAAACAAAAAAAAGCAGGG + Intronic
913368915 1:118074650-118074672 AAGCACAGCATTAACCAGCAGGG - Intronic
913553359 1:119938605-119938627 GTGCACAACAATAAACAATGTGG - Intronic
913654394 1:120947232-120947254 ATGGAAAACAGTAAACAACAAGG - Intergenic
913708237 1:121450112-121450134 ATGCTCGACAATAAACAGTGAGG - Intergenic
914644592 1:149641392-149641414 ATGGAAAACAGTAAACAACAAGG - Intergenic
914683245 1:149955857-149955879 ATGGAAAACAAAAAAAAGCAGGG - Intronic
915675976 1:157531387-157531409 AGCCACCACAAGAAACAGCATGG + Intronic
915991362 1:160520394-160520416 ATGGACCACACTAAGCAGCAAGG - Intronic
916647716 1:166802869-166802891 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
916828353 1:168465117-168465139 ATGAAAAACAAAAAAGAGCAGGG + Intergenic
916835250 1:168538022-168538044 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
916836094 1:168546838-168546860 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
917126416 1:171692659-171692681 ATGGAAAACAAAAAACGGCAGGG - Intergenic
917207688 1:172595106-172595128 ATGGAAAACAAAAAAAAGCAGGG - Intronic
917391599 1:174543417-174543439 ATGGAAAACAAAAAAAAGCAGGG - Intronic
918324694 1:183398229-183398251 ATGGAAAACAAAAAAAAGCAGGG + Intronic
918515839 1:185361645-185361667 ATGAAAAACAAAAAAGAGCAGGG + Intergenic
918894342 1:190320451-190320473 ATGCACAACAATAAGCAATGTGG - Intronic
921236951 1:213142194-213142216 ATGGAAAACAAAAAAGAGCAGGG - Intronic
921626426 1:217382011-217382033 ATGCAAAGCAAAAAACAGCAGGG + Intergenic
921915800 1:220609377-220609399 ATGGAAAACAAAAAAAAGCAGGG - Intronic
921981234 1:221261307-221261329 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
922552115 1:226503077-226503099 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
923958413 1:239049233-239049255 ATGCACAACAGCAAACCTCAGGG - Intergenic
924130162 1:240899106-240899128 ATGGAAAACAAAAAAAAGCAAGG - Intronic
924296272 1:242589267-242589289 ATGGAAAAAAATAAAAAGCAGGG + Intergenic
924682999 1:246257469-246257491 ATGAATAACAAAAAAGAGCAGGG - Intronic
924731590 1:246716504-246716526 ATGGAAAACAAAAAAAAGCACGG + Intergenic
1063114429 10:3063966-3063988 ATGCACAGGCAGAAACAGCAGGG + Intergenic
1063910413 10:10823578-10823600 ATGCACAAAAAAAAATAGAATGG + Intergenic
1063940653 10:11125196-11125218 GTGCAGATCATTAAACAGCAGGG + Intronic
1064518420 10:16175393-16175415 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1064873327 10:19964316-19964338 AAGCACAACAATAAGAAGGAAGG + Intronic
1065119143 10:22512052-22512074 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1065414322 10:25467941-25467963 ATGTACATCAACAGACAGCAAGG - Intronic
1066139161 10:32486320-32486342 ATGCAAAACAAAAAAAGGCAGGG - Intronic
1066502889 10:36011938-36011960 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1066639418 10:37540255-37540277 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1066784952 10:38993433-38993455 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1067414796 10:46095120-46095142 TTGAGCACCAATAAACAGCATGG + Intergenic
1067434846 10:46269701-46269723 TTGAGCACCAATAAACAGCATGG + Intergenic
1068459936 10:57315141-57315163 AAACACAAGAATAAAAAGCATGG - Intergenic
1068820701 10:61375142-61375164 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
1069260145 10:66384265-66384287 ATGGAAAACAAAAAAAAGCAGGG + Intronic
1069330805 10:67290467-67290489 ATGCAAAACCATAAAAATCATGG + Intronic
1071100774 10:82035020-82035042 ATTCAGAACCATGAACAGCACGG - Intronic
1071663376 10:87529032-87529054 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1071892696 10:90029003-90029025 ATGGAAAACAAAAAAGAGCAGGG + Intergenic
1073744346 10:106448436-106448458 ATGCACAACAATAAACAATATGG - Intergenic
1073769472 10:106719778-106719800 ATGCTCAACAAAGAACAGTATGG + Intronic
1074648886 10:115496139-115496161 ATGAAAAACAGAAAACAGCAAGG - Intronic
1074668266 10:115756981-115757003 ATGCAAAACAAAAAAAAGCAGGG - Intronic
1074684236 10:115944563-115944585 ATGAAAAGCAATAAAAAGCAGGG + Intronic
1075500321 10:122967177-122967199 ATGCAAAACAGGAAAAAGCAGGG + Intronic
1075805139 10:125182776-125182798 ATGCAAAGCAAAAAAAAGCAGGG - Intergenic
1075858255 10:125649815-125649837 ATGGAAAACAAAAAAAAGCAGGG + Intronic
1077655441 11:4014873-4014895 ATGGAAAGCAATAAAAAGCAGGG - Intronic
1078667915 11:13341319-13341341 TTTCACCACAATAAAGAGCAAGG - Intronic
1078684279 11:13513369-13513391 ATGTACGAAAATTAACAGCATGG - Intergenic
1079037336 11:17032325-17032347 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1079232520 11:18661071-18661093 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1079463309 11:20704327-20704349 ATGGAAAACAAAAAAAAGCAAGG - Intronic
1079516396 11:21274221-21274243 ATGGAAAACAAAAAAAAGCAGGG + Intronic
1079683156 11:23323280-23323302 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1079909420 11:26291231-26291253 ATGGAAAACAAAAAAAAGCAAGG - Intergenic
1080489551 11:32748270-32748292 ATGCACAAAAATAAAAAGCAAGG - Intronic
1080491095 11:32764932-32764954 ATGGAAAACAAAAAAAAGCAGGG + Intronic
1080888152 11:36385552-36385574 TTGCACAACAATAAATATTAGGG - Intronic
1080917608 11:36675711-36675733 ATGGAAAACAAAAAAGAGCAGGG + Intergenic
1081143606 11:39534620-39534642 ATGCAAAGCAAAAAAAAGCAGGG - Intergenic
1081946122 11:46996100-46996122 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1082084089 11:48034836-48034858 AAGCACAACAATTACCAGTATGG - Intronic
1082967965 11:58987738-58987760 ATGGAAAACAACAAAAAGCAGGG - Intronic
1085658212 11:78336763-78336785 ATGAACAGGAATAAATAGCATGG + Intronic
1086530023 11:87774023-87774045 ATGCACAACAATAAACAACGTGG - Intergenic
1086599344 11:88613504-88613526 ATGGAAAACAAAAAACTGCAGGG - Intronic
1086659456 11:89396637-89396659 ATGGAAAACAAAAAAAAGCAGGG + Intronic
1086757357 11:90581287-90581309 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1087435206 11:98107838-98107860 ATGCAGATCAATAAAGAACAAGG + Intergenic
1087606739 11:100386076-100386098 ATGGAAAACAGAAAACAGCAGGG + Intergenic
1087794486 11:102440862-102440884 ATGGAAAACAAAAAAAAGCAGGG + Intronic
1088197929 11:107296009-107296031 ATGCAAAACAAAAAAAAGCAGGG + Intergenic
1088937998 11:114423684-114423706 ATACACAAAAATAAAAAGCAAGG - Intronic
1090118334 11:123998602-123998624 ATGAAGAACAGTAAAGAGCATGG - Intergenic
1090322502 11:125859655-125859677 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1091591387 12:1844988-1845010 ATGCAAAACCATAATTAGCAAGG - Intronic
1092328597 12:7561251-7561273 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1093162404 12:15763934-15763956 ATTCACAACAATATTCGGCATGG + Intronic
1093261012 12:16938099-16938121 ATGGAAACCAAAAAACAGCAGGG - Intergenic
1093275377 12:17118664-17118686 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1093496671 12:19765386-19765408 ATGGAAAACAAAAAAGAGCAGGG + Intergenic
1093595808 12:20957680-20957702 ATGAAGAACAGAAAACAGCAGGG + Intergenic
1093808699 12:23466564-23466586 ATGGAAAGCAAAAAACAGCAGGG + Intergenic
1093998083 12:25664265-25664287 ATGGAAAACAAAAAACATCAAGG - Intergenic
1094398919 12:30039891-30039913 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1094875865 12:34641833-34641855 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1095186832 12:39210050-39210072 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1095235284 12:39787694-39787716 ATGCAAATGAATAAATAGCAAGG + Intronic
1096346548 12:50852361-50852383 ATGGAAAACAAAAAAGAGCAGGG + Intronic
1096950320 12:55461621-55461643 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1096959391 12:55562654-55562676 ATGCAAAACAAAAAAAGGCAGGG + Intergenic
1097483644 12:60164708-60164730 ATGCACAATGATAAACAGTGGGG + Intergenic
1097914478 12:65005986-65006008 ACCCACAACAATAAAAATCAAGG + Intergenic
1097917263 12:65034276-65034298 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1098379796 12:69855150-69855172 ATCCACAAGGATCAACAGCATGG - Intronic
1098638295 12:72811388-72811410 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1098699656 12:73608002-73608024 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1098989137 12:77045741-77045763 TTGCACAAAAAGAACCAGCATGG + Intronic
1099025685 12:77461577-77461599 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1099410054 12:82314314-82314336 ATGGAAAACAAAAAAAAGCAAGG - Intronic
1099428068 12:82549006-82549028 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1099559185 12:84150669-84150691 TTGCACAATAATAAAAAGGAAGG - Intergenic
1099720760 12:86358646-86358668 ATGGAAAACAAAAAAAAGCAGGG + Intronic
1099811763 12:87592121-87592143 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1099965745 12:89442921-89442943 ATGAAAAACAAAAAAAAGCAGGG + Intronic
1100463647 12:94825102-94825124 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1100624635 12:96318117-96318139 ATGGAAAACAAAAAAAAGCAGGG + Intronic
1100866195 12:98859539-98859561 ATGAATAACAACAAACAGAAAGG + Intronic
1100901013 12:99240232-99240254 ATGGAAAACAAAAAAAAGCACGG + Intronic
1101135733 12:101741088-101741110 AAGCAAAACAGTAAACAGGAGGG - Intronic
1101251588 12:102941477-102941499 ATGGAAAACAAAAAAGAGCAGGG + Intronic
1101344620 12:103875061-103875083 ATCCACTACAATAGCCAGCATGG + Intergenic
1101636723 12:106549729-106549751 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1102440144 12:112957160-112957182 ATGGAAAACAAAAAAAAGCAAGG - Intronic
1102474542 12:113180089-113180111 TTCATCAACAATAAACAGCAAGG + Intronic
1102777646 12:115534590-115534612 ATTTACAAAAATAGACAGCAAGG + Intergenic
1102933146 12:116877627-116877649 ATGCACAATAATAATCATGATGG + Intronic
1105201593 13:18184496-18184518 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1105603127 13:21904930-21904952 ATGCACAACAATAAACAATGAGG - Intergenic
1105880064 13:24597416-24597438 ATCCACATCAACAAAAAGCATGG + Intergenic
1106646105 13:31636243-31636265 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1106682604 13:32023732-32023754 ATACACAAAAATAAATAGTAGGG - Intergenic
1106959927 13:34986836-34986858 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1107073667 13:36298283-36298305 ATGCAAAACAATAATCTGGAGGG - Intergenic
1107335997 13:39355705-39355727 ATGGAAAACAAAAAAGAGCAGGG + Intronic
1107676041 13:42798116-42798138 ATTTATCACAATAAACAGCACGG - Intergenic
1108029837 13:46218419-46218441 AAGCAAAACAAAAAAAAGCAGGG - Intronic
1108120815 13:47184035-47184057 AAGCACAACAATGAATAACATGG - Intergenic
1108248006 13:48536512-48536534 ATGCACAATTCTATACAGCATGG - Intergenic
1108265120 13:48698840-48698862 ATGGAAAACAAAAAAAAGCAGGG + Intronic
1108308341 13:49161422-49161444 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1108589498 13:51900377-51900399 ATGCTCAACACTAATCATCAAGG + Intergenic
1108892285 13:55276387-55276409 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1108906041 13:55475072-55475094 ATTCTCAACAAAAAACATCATGG + Intergenic
1108994832 13:56715590-56715612 ATACAAAAGAATAAACAGCAGGG - Intergenic
1108996914 13:56746555-56746577 ATGAACATCAACAAACATCAAGG - Intergenic
1109318011 13:60774868-60774890 ATGAAAAACAAAAAAGAGCAGGG - Intergenic
1109747881 13:66649988-66650010 ATACAAAAAAATAAAAAGCAAGG + Intronic
1110510547 13:76344912-76344934 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1111469548 13:88660628-88660650 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1111728263 13:92040527-92040549 ATGCACAAAAATAAACCGGGTGG + Intronic
1111763061 13:92490321-92490343 ATGCACAACACTAAACATTAGGG - Intronic
1113304241 13:109059504-109059526 AAGCACATCAATTTACAGCATGG - Intronic
1114581065 14:23760528-23760550 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1114603808 14:23979115-23979137 ATGCAAAGCAAAAAAAAGCAGGG + Intronic
1114608819 14:24021889-24021911 ATGCAAAGCAAAAAAAAGCAGGG + Intergenic
1114787177 14:25614261-25614283 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
1115107416 14:29777462-29777484 ATGGAAAACAAAAAAAAGCAGGG + Intronic
1115294444 14:31810440-31810462 ATGGAAAACAAAAAACAACAGGG - Intronic
1115477290 14:33827787-33827809 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1115869523 14:37784443-37784465 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1115884262 14:37954139-37954161 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1116384261 14:44311217-44311239 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1116431910 14:44855732-44855754 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1116704825 14:48283533-48283555 ATGAAAAACAAAAAAAAGCAGGG - Intergenic
1116729976 14:48609012-48609034 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1116914338 14:50508170-50508192 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1117199410 14:53373021-53373043 ATGCAAAATAACAAGCAGCAAGG - Intergenic
1117260794 14:54031501-54031523 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1117446879 14:55812163-55812185 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1117716858 14:58590125-58590147 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1118535567 14:66759553-66759575 ATGGAAAACAAAAAAGAGCAGGG - Intronic
1118569392 14:67177888-67177910 ATGGAAAGCAAAAAACAGCAGGG - Intronic
1119366406 14:74095529-74095551 ATGCAGAAAAATAAAAATCAGGG - Intronic
1120401020 14:84031684-84031706 ATGGAAAACAATAAACATAAGGG + Intergenic
1120439522 14:84519460-84519482 ATACACATCCATAAACATCAAGG - Intergenic
1120748122 14:88170743-88170765 ATGAAAAACAAAAAACAGTAGGG + Intergenic
1120922898 14:89771356-89771378 ATGAAAAACAAAAAAGAGCAAGG + Intergenic
1120969496 14:90195544-90195566 ATGCAAAACAATAATTAGCCAGG + Intergenic
1122579807 14:102764484-102764506 ATACTCAAAAAGAAACAGCAAGG + Intergenic
1122833331 14:104415845-104415867 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1123949604 15:25257924-25257946 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1124885885 15:33685264-33685286 ATGGAAAGCAATAAAAAGCAGGG + Intronic
1125804935 15:42485760-42485782 ATGCACAACAATAAACAATGTGG + Intronic
1125858517 15:42974905-42974927 ATCCACAATAATAACCTGCATGG + Intronic
1126476552 15:49070877-49070899 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1126542281 15:49837047-49837069 ATGGAAAACAATAAAAGGCAGGG - Intergenic
1127003271 15:54535190-54535212 ATGGAAAACAAAAAAGAGCAGGG + Intronic
1127047744 15:55044695-55044717 AGACACAAAAATACACAGCAAGG - Intergenic
1127970980 15:63961169-63961191 ATGGAAAACAAAAAAAAGCAAGG - Intronic
1129574241 15:76723747-76723769 ATGGAAAACAATAAAAGGCAGGG - Intronic
1130933852 15:88451936-88451958 ATGCATTACAAAACACAGCAGGG + Intergenic
1132287728 15:100677389-100677411 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1133522892 16:6576087-6576109 GTGCACAACAATAAACAATGCGG - Intronic
1134188700 16:12104801-12104823 ATGCACAACAATAAAGACAAGGG - Intronic
1134611240 16:15610189-15610211 TTGAACAAAAATAAACAGGAGGG + Intronic
1137335490 16:47544916-47544938 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1137372497 16:47921092-47921114 ATTCATAACAAGAAACAACAAGG - Intergenic
1137485810 16:48889965-48889987 ATGCTGAACAAAAAACAGCAGGG + Intergenic
1137525328 16:49230390-49230412 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1137656559 16:50164289-50164311 AAGAACAACAACAAACAGGATGG - Intronic
1137829381 16:51529124-51529146 TAGCCCAACAATAAACAGCTTGG - Intergenic
1137837494 16:51607034-51607056 ATGCAAAACCATAAAAAGCTGGG + Intergenic
1138211500 16:55166900-55166922 ATGGACAAAAAGAAATAGCAAGG + Intergenic
1138751126 16:59422420-59422442 ATGTACAAAAATCAGCAGCATGG - Intergenic
1138901978 16:61283273-61283295 ATCCAAAACAATAAAAAGAAAGG - Intergenic
1139173518 16:64660131-64660153 ATGCACATCACTAATCATCAGGG - Intergenic
1139245190 16:65434925-65434947 ATGCACTATAATTAACACCATGG - Intergenic
1140529138 16:75648716-75648738 AAGAACAATAATAAACAACAAGG - Intronic
1141210578 16:81975850-81975872 ATGGAAAACAACAAACAGTAGGG + Intergenic
1141340054 16:83194888-83194910 ATGCACATCAATGAACAAAAAGG - Intronic
1144377100 17:14655038-14655060 ATCCACAACAGAAAATAGCAAGG - Intergenic
1150883781 17:69061738-69061760 ATGCTCAAAAATAGACAGAATGG - Intergenic
1152063213 17:78094819-78094841 ATACACAGCATTAAACAGAAAGG - Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153512819 18:5873978-5874000 ATGCATAACAAAATACCGCAGGG - Intergenic
1153619218 18:6961462-6961484 ATGCACATCCATAAACAACCAGG + Intronic
1155466682 18:26143524-26143546 ATGCACAACAGTAAACAACGAGG + Intronic
1155948169 18:31878795-31878817 ATGGAAAACAAAAAAGAGCAGGG + Intronic
1156189647 18:34703483-34703505 ATGGTGAACAATAAACAGGAAGG - Intronic
1156909792 18:42397916-42397938 ATGCAGAACAATAAAAGGGAAGG + Intergenic
1157123205 18:44931762-44931784 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1157659079 18:49422715-49422737 ACGGAAAACAAAAAACAGCAGGG + Intronic
1158117013 18:54006449-54006471 ATGCACATCCATAAGCATCATGG + Intergenic
1159143681 18:64426581-64426603 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1159349574 18:67254291-67254313 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1159811083 18:73018708-73018730 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1160905261 19:1449037-1449059 AGGCCCAACAGGAAACAGCACGG + Intronic
1161187531 19:2931579-2931601 ACTCACAACCATAAACAGAAGGG + Intergenic
1162251600 19:9448853-9448875 ATGCAAAACAAAAAAGAGCACGG + Intergenic
1162712874 19:12609180-12609202 ATGCAGAACAGTGAACACCATGG - Exonic
1163098346 19:15077666-15077688 ATGCACATCACTAATCATCAGGG + Intergenic
1163108861 19:15145187-15145209 ATACACAACAATGAAAAGGAAGG + Intergenic
1163266091 19:16223436-16223458 GTGTACAACAGTAAACCGCAAGG - Intronic
1163294041 19:16400771-16400793 ATGAACAAAAATAACCAGAAAGG + Intronic
1163817283 19:19474535-19474557 AGGCACACCAATACACACCAGGG - Intronic
1163887727 19:19982839-19982861 GAGAAAAACAATAAACAGCAGGG + Intergenic
1164110328 19:22150687-22150709 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1164497423 19:28779689-28779711 ATGGAGAACAAAAAACACCAGGG + Intergenic
1164688449 19:30188480-30188502 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1165121696 19:33563266-33563288 ATGCAATACAATAAAACGCAAGG - Intergenic
1166290158 19:41857996-41858018 ATGTACAAAAATTAACACCAGGG + Intergenic
1167221294 19:48200326-48200348 ATGCACCACACTGAAAAGCAAGG - Intronic
1167834209 19:52053276-52053298 ATGGAAAACAAAAAAAAGCAGGG + Intronic
1168437518 19:56332479-56332501 ATGGAAAACAAAAAAGAGCAGGG - Intronic
925245074 2:2375255-2375277 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
925252113 2:2448403-2448425 ATGCACATGGATACACAGCAAGG + Intergenic
926501644 2:13661539-13661561 ATGGAAAACAATAAAGAGCAAGG - Intergenic
926595634 2:14787144-14787166 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
926605399 2:14893321-14893343 AAGCAAAACAATAAGCAGAAAGG - Intergenic
926782851 2:16491219-16491241 ATACAGAAAAATAAACACCAGGG - Intergenic
927334553 2:21907143-21907165 ATGCAAAACAAAAAAAGGCAGGG - Intergenic
928384146 2:30850196-30850218 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
928801433 2:35098680-35098702 ATGGAAAACAATAAAAAGCAGGG - Intergenic
928806355 2:35161514-35161536 ATCAACAACAATACACGGCATGG + Intergenic
928881865 2:36105937-36105959 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
929622825 2:43374044-43374066 ATGTGCAACAATAAATAGTAAGG - Intronic
929958134 2:46475872-46475894 ATGGAAAACAAAAAAAAGCAGGG - Intronic
930136525 2:47907451-47907473 ATGCACAACAAAAGAGAGAAGGG - Intergenic
930488870 2:52043240-52043262 ATGGAAAACAAAAAACGGCAGGG - Intergenic
930641066 2:53854878-53854900 ATGCACACCCAGAAACAGAAAGG + Intronic
930863096 2:56094860-56094882 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
930941927 2:57024101-57024123 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
931112491 2:59126672-59126694 ATGGAAAACAAAAAAAAGCACGG - Intergenic
931469016 2:62519344-62519366 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
931558703 2:63533028-63533050 ATGGAAAACAAAAAAAAGCAGGG + Intronic
931698951 2:64893326-64893348 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
932215723 2:69964725-69964747 AAGCAGGACAATAAACAGGAAGG + Intergenic
933004573 2:76974879-76974901 ATGCACAACAGTAATCATCTTGG + Intronic
933005646 2:76990469-76990491 ATGGAAAACAAGAAAGAGCAGGG + Intronic
933123312 2:78570906-78570928 ATGCATTTGAATAAACAGCAAGG - Intergenic
933366503 2:81360782-81360804 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
934021441 2:87957767-87957789 ATGCACAACAATAAACACAAGGG - Intergenic
934869529 2:97849962-97849984 ATTCACAACAATAAAAAGTGTGG - Intronic
935084427 2:99830814-99830836 ATGCACAACAATAAACAGCATGG - Intronic
935822841 2:106911493-106911515 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
937020497 2:118646818-118646840 ATGCTCAACAATAACAAGAAAGG - Intergenic
937633112 2:124125231-124125253 ATGGAGAACAAAAAAAAGCAAGG + Intronic
937754388 2:125518197-125518219 ATGGAAAACAAAAAAAAGCAAGG + Intergenic
937807526 2:126163106-126163128 ATGGAAAGCAATAAAAAGCAGGG + Intergenic
938148724 2:128862812-128862834 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
938626995 2:133121308-133121330 ATGCACAAGACTAAACTGAAGGG + Intronic
939192732 2:138935155-138935177 ATTACCAACAATGAACAGCAAGG + Intergenic
939344289 2:140943103-140943125 ATGGAAAACGAAAAACAGCAGGG + Intronic
939937522 2:148311471-148311493 ATGGAAAGCAATAAAAAGCAGGG - Intronic
939942299 2:148364660-148364682 ATGGAAAGCAATAAAAAGCAGGG + Intronic
939947164 2:148423869-148423891 ATGGAAAGCAATAAAAAGCAGGG + Intronic
940417253 2:153437649-153437671 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
940609226 2:155968063-155968085 ATGGAAAACAATAAAAGGCAGGG + Intergenic
940705566 2:157101096-157101118 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
940731784 2:157401422-157401444 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
941003241 2:160222549-160222571 ATACACAGAAATCAACAGCAAGG - Intronic
941190708 2:162378416-162378438 TTCAACAACAATAAACGGCATGG + Intronic
941971236 2:171353782-171353804 ATGGAAAACAAAAAAAAGCAGGG - Intronic
942694746 2:178628902-178628924 ATGCAGAACACTAAATAGGATGG + Intronic
943188736 2:184648609-184648631 ATGAAAAACAAAAAAGAGCAAGG + Intronic
943628506 2:190224453-190224475 ATGGAAAACAAAAAAAAGCAGGG + Intronic
943681775 2:190776071-190776093 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
943970986 2:194405810-194405832 ATGGAAAGCAATAAAAAGCAGGG + Intergenic
943987474 2:194641095-194641117 ATGAAAAACAAAAAAAAGCAGGG + Intergenic
944569949 2:201034429-201034451 ATGGAAAACAAAAAAAAGCAGGG - Intronic
944630050 2:201614878-201614900 ATGGAAAACAAGAAAAAGCAGGG + Intronic
945116556 2:206413881-206413903 ATGGAGAACAAAAAAAAGCAGGG - Intergenic
945677944 2:212878008-212878030 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
945715087 2:213348206-213348228 AAGCAAAACAAAAAAAAGCAGGG - Intronic
945801741 2:214441190-214441212 ATGCACAATAAGAAAGAGAAGGG + Intronic
946454884 2:219817329-219817351 ATGGAAAACAAAAAACGGCAGGG - Intergenic
947265624 2:228276888-228276910 AAGCACAATAAGAAACAACAAGG + Intergenic
947649330 2:231771552-231771574 AGCCACAAGAAGAAACAGCATGG - Intronic
948419453 2:237847280-237847302 ATGGAAAACAAAAAAAAGCAAGG - Intergenic
1169047253 20:2543477-2543499 ATAGTCCACAATAAACAGCATGG + Intronic
1169062149 20:2668614-2668636 TTGCACCACAATAAACTTCATGG - Intergenic
1169174373 20:3496984-3497006 ATGGAAAACAATAAAAGGCAGGG - Intronic
1169671133 20:8104072-8104094 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
1169707909 20:8527386-8527408 ATGAAAATAAATAAACAGCATGG + Intronic
1169947872 20:11008811-11008833 ATGCACTACAATATTCAGGATGG - Intergenic
1171281231 20:23900675-23900697 ATGGAAAACAAAAAACGGCAGGG - Intergenic
1171454837 20:25262784-25262806 ATGGAAAACAAAAAAAAGCAGGG + Intronic
1172767279 20:37357509-37357531 ATTCAAAACAATGAACAGCTGGG - Intronic
1173387351 20:42601009-42601031 ATGCAGAATCATAAACAGAAAGG - Intronic
1176859213 21:13996410-13996432 ATTCAGAACAATTAAAAGCAGGG - Intergenic
1177032443 21:15998454-15998476 ATGCATAACAGAAAACAGCAGGG - Intergenic
1177618926 21:23561433-23561455 ATGCAAAACTATAAACATCTTGG - Intergenic
1177703164 21:24664577-24664599 ATGCACACTAATAAACTTCATGG - Intergenic
1178598852 21:33978828-33978850 ATCCAAAACAATTAAAAGCAGGG - Intergenic
1178770265 21:35497587-35497609 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1181432567 22:22891248-22891270 ATCCACAAAAATAAACTCCAGGG - Intronic
1184134414 22:42538400-42538422 ACCCACAACAAAAAACAGCTGGG + Intergenic
949424093 3:3897484-3897506 ATGGAAAACAAAAAAAAGCAGGG + Intronic
949872842 3:8604015-8604037 ATGCACAACAATAAACAATTTGG - Intergenic
950527843 3:13535087-13535109 ATTCACAACTACATACAGCAAGG - Intergenic
950596989 3:13993525-13993547 ATGGAAAACAAAAAAAAGCAGGG - Intronic
951042917 3:18007925-18007947 CTCCACAACAATAAAGTGCAAGG - Intronic
951155836 3:19352055-19352077 ATGGAAAACAAAAAAAAGCAGGG + Intronic
951442701 3:22741560-22741582 ATGGACAACAAAAAAAGGCAGGG - Intergenic
951570458 3:24057315-24057337 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
951641146 3:24836951-24836973 ATGTCCATCAATAAACAGGAAGG + Intergenic
951698209 3:25467928-25467950 TTGGAAAACAATAAACAGAATGG + Intronic
951789690 3:26466330-26466352 ATGGAAAGCAAAAAACAGCAGGG + Intergenic
952045425 3:29313257-29313279 ATGCACAACAAGAAAGAGGTAGG + Intronic
952073929 3:29672605-29672627 ATGGAAAACAAAAAAAAGCAGGG + Intronic
952358200 3:32604211-32604233 ATGCACCACAATAAACAATGTGG - Intergenic
952612536 3:35228116-35228138 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
952632029 3:35481189-35481211 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
952709278 3:36413497-36413519 ATGGAAAACAAAAAAAAGCAGGG - Intronic
952727843 3:36607041-36607063 ATGCACAAGAGTAGACAGAATGG + Intergenic
953081074 3:39618815-39618837 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
953112451 3:39955846-39955868 ATGGAAAACAAAAAAAAGCAGGG + Intronic
954524148 3:51254690-51254712 ATGGAAAACAAAAAAAAGCAGGG - Intronic
954756347 3:52842420-52842442 CTGCCCAACACTAAAGAGCAAGG - Intronic
954927482 3:54249077-54249099 AAGGAGAAGAATAAACAGCATGG + Intronic
955172398 3:56580232-56580254 ATGGAAAACAAAAAAAAGCAGGG - Intronic
957886914 3:86299337-86299359 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
958204569 3:90373136-90373158 ATGGAAAACAATAAAAGGCAGGG + Intergenic
958508654 3:95016014-95016036 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
958593847 3:96196399-96196421 ATGTACAACTATTAACAGCAAGG + Intergenic
959052610 3:101539031-101539053 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
959330541 3:104999078-104999100 ATGGAAAACAAAAAAGAGCAGGG + Intergenic
959506878 3:107166052-107166074 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
959947922 3:112147117-112147139 ATGGAAAACAAAAAAGAGCAGGG - Intronic
960184319 3:114619836-114619858 ATACAGCACAATAAAGAGCAGGG - Intronic
960549542 3:118959389-118959411 AGGGAGAAGAATAAACAGCAAGG + Intronic
960758947 3:121050903-121050925 ATGGAAAACAAAAAAAAGCAGGG + Intronic
960793102 3:121454551-121454573 ATGGAAAACAAAAAAAAGCAGGG + Intronic
960851652 3:122060908-122060930 ATTTACATCAATAAACAGAATGG + Intronic
961355188 3:126333740-126333762 ATGGAAAACAAAAAACGGCAGGG + Intergenic
961422448 3:126817086-126817108 TTGCAAAACAATCCACAGCAGGG - Intronic
962287455 3:134099560-134099582 ATGGAAAACAAAAAAAAGCAGGG - Intronic
962549173 3:136471486-136471508 AGCCACAATAATAAAGAGCATGG + Intronic
962994077 3:140607562-140607584 ATGGAAAACAAAAAACAGCAGGG + Intergenic
963528008 3:146438597-146438619 ATGGAAAACAAAAAAAAGCAGGG - Intronic
963620269 3:147597654-147597676 ATGAAAAACAAAAAAAAGCAGGG - Intergenic
963695614 3:148563155-148563177 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
963714201 3:148784453-148784475 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
963799880 3:149665117-149665139 AGGCTCAACAATATACAGTATGG + Intronic
964054825 3:152440922-152440944 ATGTTCACCAATAAGCAGCATGG - Intronic
964259877 3:154823789-154823811 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
964296293 3:155237834-155237856 ATGGAAAACAGTAAAAAGCAGGG - Intergenic
965230532 3:166045993-166046015 ATGCAAAACTATAAAAATCATGG - Intergenic
965818724 3:172663784-172663806 ATGGAAAACAAAAAAAAGCAGGG - Intronic
967435758 3:189444239-189444261 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
967736967 3:192963451-192963473 ATGGACAACAAAAAAAGGCAGGG - Intergenic
968200534 3:196750626-196750648 AGACACAACAAAAAACAGCAAGG - Intronic
968218401 3:196914464-196914486 ATGCAAAAAAATAAAAAGCCAGG + Intronic
969164578 4:5296585-5296607 ATGGAAAGCAAAAAACAGCAGGG - Intronic
969268626 4:6082966-6082988 TTGCAGAACAATACACAGCAGGG + Intronic
969381269 4:6799986-6800008 ATGCAAAACAAAAGCCAGCAAGG - Intronic
969521409 4:7679890-7679912 ATGCTCAGCAATAAATAACACGG - Intronic
971051405 4:22866713-22866735 ATGCAAAAATATAAAAAGCAGGG - Intergenic
971441926 4:26696177-26696199 ATGGACAACAAAAAAAGGCAGGG + Intronic
972199038 4:36691024-36691046 ATGGAGAACAAAAAAGAGCAAGG - Intergenic
972231453 4:37077063-37077085 AGGTACAACAATAAGCACCATGG + Intergenic
972965123 4:44500237-44500259 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
972996187 4:44881756-44881778 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
973026299 4:45276342-45276364 ATGTACAAAAAAAAACACCAAGG + Intergenic
973347740 4:49074652-49074674 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
973689181 4:53407817-53407839 ATGCAAAACAAAAAAAGGCAGGG - Intronic
974245413 4:59309228-59309250 CTGCACCACAGGAAACAGCATGG + Intergenic
974350273 4:60735576-60735598 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
974410580 4:61536705-61536727 ATGGAAAACAAAAAAGAGCAGGG - Intronic
974504030 4:62744891-62744913 ATGTAAAGCAATAAAAAGCAGGG + Intergenic
974638941 4:64604599-64604621 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
975073344 4:70171675-70171697 ATGCACAACAACAGACAGTGTGG - Intronic
975236857 4:72008845-72008867 ATGGACAGCATTAATCAGCAAGG - Intergenic
975277432 4:72518660-72518682 ATGGAAAACAAAAAAAAGCAGGG - Intronic
975304974 4:72839357-72839379 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
976208409 4:82643266-82643288 ATCCAAAAGAATAAAAAGCAGGG + Intronic
976956001 4:90901109-90901131 ATGAAAAACAAGAAAGAGCAGGG - Intronic
976975663 4:91163754-91163776 ATGCAAAGCAAAAAAAAGCAGGG - Intronic
977729565 4:100334392-100334414 ATGGAAAACAGAAAACAGCAAGG + Intergenic
977846210 4:101770946-101770968 ATGAAAAACAACAAAGAGCAGGG - Intronic
978115622 4:105016895-105016917 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
978196922 4:105982884-105982906 ATGGAAAACAAAAAAAAGCAGGG - Intronic
978257896 4:106714431-106714453 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
978997450 4:115174032-115174054 ATGCAAAACAAAAAAAGGCAGGG + Intergenic
979201078 4:117978878-117978900 ATGGAAAACAAAAAAGAGCAGGG + Intergenic
979223538 4:118258604-118258626 ATGTACAACAATAAACTGATAGG + Exonic
979487707 4:121287105-121287127 ATGGAAAGCAATAAAAAGCAGGG + Intergenic
979865832 4:125752020-125752042 TTGTATAACAATAAAAAGCAAGG + Intergenic
980091158 4:128444272-128444294 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
980270999 4:130583449-130583471 ATGCACACCAAGAGACAGAATGG - Intergenic
980411724 4:132428785-132428807 ATGGAAAACAAGAAAGAGCAGGG - Intergenic
980503763 4:133689009-133689031 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
980593798 4:134926837-134926859 ATGGAAAGCAATAAAAAGCAGGG - Intergenic
980673344 4:136040345-136040367 AAGCAAAACAATATATAGCAAGG - Intergenic
981208164 4:142068650-142068672 ATGGAAAACAAAAAAAAGCAGGG + Intronic
981345799 4:143674710-143674732 ATGGAAAACAAAAAAAAGCAGGG + Intronic
981501819 4:145459813-145459835 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
981514700 4:145595143-145595165 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
981879753 4:149595278-149595300 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
981905555 4:149917709-149917731 ATGGAAAACAAAAAACGGCAGGG + Intergenic
982646377 4:158028656-158028678 ATGCAAAACAGAAAAAAGCAGGG + Intergenic
982870774 4:160576215-160576237 ATGCAAAACAAAAAAAGGCAGGG + Intergenic
983021226 4:162677473-162677495 ATGAACACCAAAAAAGAGCAGGG + Intergenic
983479783 4:168258766-168258788 AAGCACTAGAAAAAACAGCAGGG + Intronic
983681770 4:170361668-170361690 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
983831780 4:172337089-172337111 ATGGAAAACAAAAAAGAGCAGGG - Intronic
984334610 4:178374279-178374301 ATGCACAGCCATATACATCAAGG - Intergenic
984503580 4:180589546-180589568 ATTCAGAACAATAAGAAGCAAGG + Intergenic
986202843 5:5594132-5594154 ATGCACAACACTAATCATCAGGG + Intergenic
987007288 5:13723636-13723658 AGGCACACAAATAAAAAGCATGG + Intronic
987012745 5:13783607-13783629 ATGCAAAACCATATACACCATGG + Intronic
987083333 5:14446040-14446062 AAGAACACCAATTAACAGCACGG - Intronic
987179374 5:15350689-15350711 ATGCACAAGAATAATTTGCATGG - Intergenic
987760674 5:22159180-22159202 ATGCACACCACTCAACAGCAAGG + Intronic
988234460 5:28523121-28523143 ATGCATGACAATAAACAATATGG + Intergenic
988370570 5:30363057-30363079 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
989269815 5:39519717-39519739 ATGCATAATAAAACACAGCAAGG - Intergenic
989495369 5:42105633-42105655 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
989562226 5:42865108-42865130 ATGGAAAACAAAAAAAAGCAGGG + Intronic
989627308 5:43442664-43442686 ATGCAAAACAAAAAAAGGCAGGG - Intergenic
989684016 5:44063707-44063729 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
990148488 5:52788887-52788909 ATGCAGAACAAGAAAAGGCAGGG + Intronic
990845381 5:60132047-60132069 ATGCACAACAATAAAGAGAATGG - Intronic
991280552 5:64908706-64908728 ATGGAAAACAAAAAAAAGCAGGG - Intronic
991323950 5:65408317-65408339 ATGGAAAACAAAAAAAAGCAGGG + Intronic
991420667 5:66438092-66438114 ATGCACAACAATAAACGATGAGG - Intergenic
991571767 5:68061985-68062007 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
991895449 5:71392627-71392649 ATGCACACCACTCAACAGCAAGG + Intergenic
992037171 5:72791350-72791372 AACAACAACAACAAACAGCATGG - Intergenic
992198384 5:74361745-74361767 ATGCAGAGCAATAAATAGCAAGG + Intergenic
992684854 5:79189329-79189351 AAGAACAACAAAAAAAAGCATGG - Intronic
992973353 5:82085150-82085172 ATGGAAAACAAAAAAAAGCAGGG + Intronic
993267582 5:85745957-85745979 ATTCACAACCATAAGCAGAATGG + Intergenic
993394563 5:87368156-87368178 ATGAAAAACAGAAAACAGCATGG - Intronic
993405522 5:87507588-87507610 ATGGACAACAGAAAAAAGCAAGG + Intergenic
993442687 5:87976261-87976283 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
993624740 5:90210517-90210539 ATGGACAACAAAAAAAGGCAGGG + Intergenic
993685014 5:90927457-90927479 ATGGACAACAAAAAAAGGCAGGG - Intronic
994139123 5:96322505-96322527 CTGCATAAGAATGAACAGCAAGG - Intergenic
994230356 5:97304793-97304815 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
994528313 5:100933910-100933932 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
996231273 5:121066411-121066433 ATGCAAAACAAAAAAAGGCAGGG + Intergenic
996324383 5:122256187-122256209 ATGGAAAACAAAAAATAGCAGGG - Intergenic
996548137 5:124702778-124702800 ATGCAGAACAATAAAAAGCGTGG - Intronic
996890467 5:128412584-128412606 AACAACAACAAAAAACAGCATGG + Intronic
999199891 5:149808405-149808427 AGGCACAAAAATAGACTGCAGGG - Intronic
999355121 5:150920795-150920817 ATGCAAAAATAGAAACAGCAAGG + Intergenic
999470039 5:151846660-151846682 ATGAAAAACAAAAAACAGCTGGG + Intronic
999958953 5:156733807-156733829 ATGGAAAACATTAAAAAGCAGGG - Intronic
1000375904 5:160581970-160581992 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1000830993 5:166101226-166101248 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1001072184 5:168596373-168596395 ATGGAAAACAAAAAATAGCAGGG - Intergenic
1202774963 5_GL000208v1_random:61269-61291 ATGGAAAACAAAAAACGGCAGGG - Intergenic
1003190890 6:3873429-3873451 ATGGGCAACAATGAACAGAAAGG + Intergenic
1003457659 6:6298571-6298593 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1005168988 6:22959474-22959496 ATGCACAGCGAGAAACAGAATGG + Intergenic
1005749145 6:28867029-28867051 ATGCATGACAATAAACGACATGG - Intergenic
1005904498 6:30249541-30249563 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1008123027 6:47639449-47639471 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1008493023 6:52105724-52105746 ATTCAAAAGAATAAACAGCATGG - Intergenic
1008529810 6:52446383-52446405 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1009043536 6:58210891-58210913 ATGCACAACATAAAAAATCAGGG + Intergenic
1009219376 6:60965153-60965175 ATGCACAACATAAAAAATCAGGG + Intergenic
1009384644 6:63074087-63074109 ATGGAAAACAAAAAAAAGCAAGG - Intergenic
1009476215 6:64095577-64095599 ATGGAAAACAAAAAACGGCAGGG - Intronic
1010102264 6:72123795-72123817 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1010282021 6:74033498-74033520 ATGGAAAAAAAAAAACAGCAGGG - Intergenic
1010725001 6:79323475-79323497 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1011094631 6:83646336-83646358 ATGCAAAACTATAAACATCCTGG - Intronic
1011398968 6:86938914-86938936 ATGCATAACCTTAAACAGCCAGG + Intronic
1011434986 6:87327090-87327112 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1011584655 6:88911303-88911325 ATGAAAAACAAAAAAGAGCAGGG + Intronic
1011599523 6:89047069-89047091 GAGCACAATAATAAATAGCAGGG - Intergenic
1011797919 6:90977970-90977992 CTGCAAAACAAGGAACAGCAAGG + Intergenic
1012287610 6:97411813-97411835 CTCCATAACAAAAAACAGCAAGG - Intergenic
1012567007 6:100670017-100670039 ATAAACAAAAATAAACATCAAGG + Intronic
1012934990 6:105358270-105358292 AATCATAACAATAAACATCAAGG + Intronic
1013166453 6:107597620-107597642 ATGCATAAAAATAAATAACATGG + Intronic
1013518036 6:110906599-110906621 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1013866279 6:114700576-114700598 ATGCATACCAAGAAACAGGAAGG - Intergenic
1014110880 6:117617521-117617543 AAGCACAGCACCAAACAGCAAGG + Intergenic
1014274857 6:119376278-119376300 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1014306791 6:119752977-119752999 AGGGAAAACAAAAAACAGCAGGG - Intergenic
1014423153 6:121269430-121269452 ATGGAAAACAAAAAAAAGCAGGG + Intronic
1014430006 6:121358185-121358207 ATGCAGAAAATCAAACAGCAAGG - Intergenic
1014965965 6:127751357-127751379 ATACACAAAAATAAAGAGAAAGG + Intronic
1015004491 6:128262699-128262721 ATGCATCACATTAAACAGAAAGG - Intronic
1015350050 6:132207919-132207941 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
1015418996 6:132984905-132984927 ATGGAAAACAAAAAAAAGCAAGG - Intergenic
1015430125 6:133121479-133121501 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1015893024 6:137987989-137988011 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1016689195 6:146916330-146916352 TTCCTCAACAATAAACAGAAAGG + Intergenic
1017755528 6:157526073-157526095 AACCAAAACAAGAAACAGCAGGG + Intronic
1018177687 6:161191810-161191832 ATGGACAAAACTAAACTGCAAGG + Intronic
1018638872 6:165888733-165888755 ATGCAGAACATTGAAAAGCATGG + Intronic
1019123924 6:169826472-169826494 ATGCTCAACACTAATCATCAGGG + Intergenic
1020349207 7:7199863-7199885 ATGGAAAACAAAAAAAAGCAAGG - Intronic
1020391164 7:7660123-7660145 ATGGAAAGCAAAAAACAGCAGGG - Intronic
1020773930 7:12430156-12430178 ATGGACAGCAAAAAAAAGCAGGG - Intergenic
1020978084 7:15032798-15032820 ATGCCCCACCATGAACAGCAGGG - Intergenic
1021029429 7:15712192-15712214 ATGGACAAGAAAAGACAGCAGGG + Intergenic
1021136609 7:16972114-16972136 ATACATGACAATAAACAACAAGG + Intergenic
1021189658 7:17605130-17605152 ATGGAAAACAAAAAAGAGCAGGG + Intergenic
1021201946 7:17736995-17737017 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1021202715 7:17743380-17743402 ATGGAAAACAAAAAAGAGCAAGG + Intergenic
1021824524 7:24535432-24535454 ATGGAAAACAACAAAGAGCAGGG - Intergenic
1022064163 7:26833540-26833562 ATGGAAAGCAATAAAAAGCAGGG + Intronic
1022745158 7:33164653-33164675 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1022895252 7:34744032-34744054 ATACATAATAATAATCAGCAAGG - Intronic
1023211522 7:37810514-37810536 ATGGAAAACAAAAAAGAGCAGGG + Intronic
1024427029 7:49238241-49238263 ATGGAAAACAGAAAACAGCAGGG - Intergenic
1024611916 7:51073371-51073393 ACGCACAGCAATAAACTGCGGGG + Intronic
1024699570 7:51892087-51892109 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1024704642 7:51943569-51943591 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1024707970 7:51981935-51981957 ATTCACAAAAATAAACAACAAGG - Intergenic
1024782703 7:52870342-52870364 ATGCACATCACTAATCATCAGGG + Intergenic
1025034007 7:55581015-55581037 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1025547624 7:62197233-62197255 ATGGAAAACAATAAAAGGCAGGG - Intergenic
1026243025 7:68593770-68593792 AAGGAAAAAAATAAACAGCAAGG - Intergenic
1027161657 7:75807058-75807080 ATGCTAAACAATACACAGCAGGG - Intergenic
1027276704 7:76565015-76565037 ATGGACAACAAAAAAAGGCAGGG - Intergenic
1028007138 7:85588317-85588339 ATGCACAGCACTAAACACCCTGG - Intergenic
1028022971 7:85801157-85801179 ATTCAGAACAAAAAACATCATGG + Intergenic
1028062745 7:86342389-86342411 ATGGACAACAAAAAAAGGCAGGG + Intergenic
1028114717 7:86984011-86984033 AACCACAACAACAAAAAGCAGGG + Intronic
1028329113 7:89566309-89566331 ATGGAAAACAACAAAGAGCAGGG + Intergenic
1028365482 7:90024736-90024758 ATGGAAACCAAAAAACAGCAGGG + Intergenic
1028532595 7:91854140-91854162 ATGGAAAACAAAAAAGAGCAGGG + Intronic
1028628278 7:92903030-92903052 ATGAACTACAAGAATCAGCATGG + Intergenic
1028629826 7:92923038-92923060 ATGGCAAACAAAAAACAGCAGGG - Intergenic
1028652619 7:93168255-93168277 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1029006312 7:97213862-97213884 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1029059308 7:97780193-97780215 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1029310341 7:99657906-99657928 ATGGACAACAAAAAAAGGCAGGG - Intronic
1029313387 7:99688340-99688362 ATGGACAACAAAAAAAGGCAGGG + Intronic
1029922369 7:104278843-104278865 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1029939779 7:104467917-104467939 AGGCAAAACAATGAACAGTAAGG - Intronic
1030141470 7:106308540-106308562 ATGCAAAAAAAGATACAGCAGGG - Intergenic
1030475953 7:110033956-110033978 ATGGAAAACAATAAAAGGCAGGG - Intergenic
1030526272 7:110658950-110658972 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1030529190 7:110691708-110691730 ATGCACATCACTAATCATCAGGG + Intronic
1030531440 7:110716081-110716103 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1030934458 7:115568082-115568104 AAGCACAATAATATAAAGCATGG + Intergenic
1031089927 7:117341968-117341990 ATGCACAGCTAAAAACAACAGGG + Intergenic
1031284368 7:119845283-119845305 ATACACAAAAATAAAGAGAAAGG + Intergenic
1032560245 7:132883392-132883414 ATGCTCCACATTACACAGCAGGG + Intronic
1033888677 7:145980308-145980330 ATCCACAACAGTATACAGTATGG + Intergenic
1033902475 7:146159559-146159581 ATGGAAAACAAAAAAAAGCAGGG + Intronic
1036160563 8:6383974-6383996 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1037230320 8:16650900-16650922 ATGTACAACAGAAAAAAGCAAGG - Intergenic
1037421930 8:18711448-18711470 ATGGAAAACAGAAAACAGCAGGG + Intronic
1038031786 8:23649015-23649037 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1039636043 8:39166777-39166799 ATGCTCAACACTAATGAGCAGGG - Intronic
1039764602 8:40614748-40614770 ATGGAAAACATAAAACAGCACGG - Intronic
1039797635 8:40928732-40928754 AACAACAACAATAAACATCATGG - Intergenic
1039849898 8:41355763-41355785 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1040084338 8:43324268-43324290 ATGAAAAACAAAAAAAAGCAGGG - Intergenic
1040446738 8:47503459-47503481 ATGGAAAACAAAAAACGGCAGGG - Intronic
1040494271 8:47952120-47952142 ATCCAAAAGAATCAACAGCAGGG + Intronic
1040525949 8:48225487-48225509 GTGCATAACAATAAACCCCAGGG + Intergenic
1040712665 8:50208383-50208405 ATGGAAAACAAAAAAAAGCAAGG - Intronic
1040773823 8:51014653-51014675 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
1042465514 8:69125942-69125964 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1042682062 8:71397111-71397133 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1042687113 8:71454089-71454111 ATGGAAAACAAAAAAAAGCAGGG + Intronic
1042969077 8:74389002-74389024 ATGGAAAGCAAAAAACAGCAGGG - Intronic
1043200696 8:77365864-77365886 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1043279633 8:78447159-78447181 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1043535807 8:81203238-81203260 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1043699499 8:83267797-83267819 ATGCAAAACAAAAAAAGGCAGGG + Intergenic
1043708569 8:83383391-83383413 ATGGAAATCAATAAAGAGCAGGG + Intergenic
1043967620 8:86496463-86496485 ATGGAAAACAAAAAAGAGCAGGG + Intronic
1044007714 8:86958651-86958673 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1044267973 8:90205473-90205495 ATGGAAAGCAATAAAAAGCAGGG + Intergenic
1044292537 8:90489832-90489854 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1044440616 8:92219889-92219911 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1044955793 8:97478297-97478319 ATGGAAAACAAAAAAGAGCAGGG + Intergenic
1045732827 8:105262339-105262361 ATGGACAACAAAAAAAAGCAAGG - Intronic
1046525038 8:115372640-115372662 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1047135817 8:122077065-122077087 ATGAACAAAAATAAATAACACGG + Intergenic
1048367574 8:133751965-133751987 ATGCAAAATAATTAAAAGCAAGG - Intergenic
1049875597 8:145017647-145017669 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1050068113 9:1782296-1782318 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1050393371 9:5169689-5169711 ATGGAAAACAGAAAACAGCAAGG + Intronic
1050446268 9:5726376-5726398 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1050492625 9:6204845-6204867 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1050501044 9:6297663-6297685 ATGCAAAACAAAAAAAGGCAGGG + Intergenic
1050640843 9:7666008-7666030 ATCCACAACAAGCAACTGCATGG - Intergenic
1051689425 9:19694679-19694701 ATGCACAAAGATAAACTTCATGG + Intronic
1051949104 9:22609306-22609328 ATGCATAAAAACATACAGCATGG + Intergenic
1052098271 9:24410756-24410778 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1052240956 9:26272899-26272921 ATGCAGAGCAATAAACAACACGG - Intergenic
1052562941 9:30109049-30109071 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1052714693 9:32100794-32100816 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1053556033 9:39138013-39138035 AACAACAACAAAAAACAGCATGG - Intronic
1053583134 9:39427601-39427623 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1053847322 9:42252460-42252482 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1054104715 9:60986344-60986366 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1055063670 9:72096783-72096805 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1055695095 9:78874812-78874834 ATGGAAAACAAAAAACGGCAGGG + Intergenic
1056816867 9:89808224-89808246 GTGAAAAACAATAAACAGCAGGG - Intergenic
1059083618 9:111276023-111276045 AAACAAAACAAAAAACAGCATGG - Intergenic
1059344458 9:113618828-113618850 ATTCAAAATAATTAACAGCAAGG - Intergenic
1060035366 9:120250980-120251002 ATGCACCAAACTAAACAGTAGGG + Intergenic
1203691029 Un_GL000214v1:43319-43341 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1203645266 Un_KI270751v1:60872-60894 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1185917272 X:4049297-4049319 ATGCACTCAATTAAACAGCATGG + Intergenic
1186369851 X:8935973-8935995 ATGGAAAGCAAAAAACAGCAGGG - Intergenic
1186951031 X:14625170-14625192 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1187635384 X:21222441-21222463 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1187769488 X:22679132-22679154 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1187844886 X:23524917-23524939 CTGGACAACAATACACACCATGG + Intergenic
1188091600 X:25971019-25971041 ATTCAAAACAATAAAGAGGAGGG + Intergenic
1188271788 X:28150211-28150233 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1188805828 X:34588836-34588858 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
1189665214 X:43347923-43347945 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
1190471840 X:50788846-50788868 ATGCTAACCAAAAAACAGCAAGG + Intronic
1190660139 X:52646361-52646383 ATGCACAAAAATAAAAAACACGG - Intronic
1190743586 X:53306784-53306806 AAGCAAAAAAACAAACAGCAGGG + Intronic
1190820847 X:53970664-53970686 ATGAAAAACAGAAAACAGCAGGG + Intronic
1190991250 X:55552917-55552939 ATGGAAAACAAAAAACGGCAGGG - Intergenic
1191022836 X:55880641-55880663 ATGCAAAACAGAAAAAAGCAGGG + Intergenic
1191038716 X:56056432-56056454 ATGCACTACACTATACACCATGG + Intergenic
1191049972 X:56181286-56181308 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1191127917 X:56977592-56977614 ATGCATAAAAATACACAGAAAGG + Intronic
1191565217 X:62519279-62519301 ATGGAAAACAAAAAACGGCAGGG + Intergenic
1191597503 X:62961650-62961672 TTGCACAACAATCTACAGAATGG - Intergenic
1191616119 X:63171252-63171274 ATGAAAAACAAGAAAGAGCAGGG + Intergenic
1191620178 X:63207671-63207693 ATGAAAAACAAGAAAGAGCAGGG - Intergenic
1191804741 X:65122703-65122725 ATGGACAACAAAAAAAGGCAGGG + Intergenic
1192124462 X:68489025-68489047 AGGAACAACAGAAAACAGCAGGG + Intergenic
1192371628 X:70518935-70518957 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
1192668986 X:73119091-73119113 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1192675094 X:73187149-73187171 ATGCAAAACAAAAAAAGGCAGGG + Intergenic
1192825415 X:74691158-74691180 ATGGAGAACAAAAAAAAGCAGGG - Intergenic
1192920331 X:75699242-75699264 ATGGAAAACAAAAAAGAGCAAGG + Intergenic
1192948916 X:75995943-75995965 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1193025614 X:76842798-76842820 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1193030118 X:76888483-76888505 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1193146345 X:78080187-78080209 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1193400333 X:81034990-81035012 ATGAAAAGCAATAAAAAGCAGGG + Intergenic
1193423215 X:81308958-81308980 ATGCTCAACAAGACACAGCCAGG - Intergenic
1193495119 X:82201668-82201690 ATGGAAAACAAAAAACGGCAGGG - Intergenic
1193508384 X:82370805-82370827 ATGCACAAGCAAACACAGCAAGG + Intergenic
1193777456 X:85660870-85660892 AAGGAAAACAATAAACATCAGGG + Intergenic
1193979722 X:88167463-88167485 ATGGAAAACAACAAAGAGCAGGG - Intergenic
1194094280 X:89618366-89618388 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1194367986 X:93033180-93033202 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1194761544 X:97801737-97801759 ATGGAAAACAACAAAAAGCAGGG - Intergenic
1195760077 X:108236431-108236453 GTGCACACCAAGATACAGCAAGG + Intronic
1195778924 X:108439496-108439518 ATGAGTAACAATAAAAAGCACGG + Intronic
1196511571 X:116518431-116518453 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1196853835 X:119964088-119964110 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1197187716 X:123606856-123606878 ATCCAAAATAATAAAAAGCAAGG + Intronic
1197486173 X:127054635-127054657 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1197619822 X:128735049-128735071 ATGGAAAACAAAAAAAAGCAGGG + Intergenic
1197689396 X:129481188-129481210 ATACACAACAAACAACAACAAGG + Intronic
1198168953 X:134085712-134085734 ATGGAAAACAAAAAAGAGCAGGG + Intergenic
1198293479 X:135261619-135261641 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1198365889 X:135939584-135939606 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1198660153 X:138959844-138959866 ATGGAAAACAAAAAAAAGCAGGG - Intronic
1199123083 X:144081351-144081373 AGGCACAACAATAAACACAAGGG + Intergenic
1199407814 X:147483690-147483712 ATGGAAAACAAAAAATAGCAGGG - Intergenic
1199477556 X:148262604-148262626 ATGCACAACCACAAGGAGCAAGG - Intergenic
1200416820 Y:2920720-2920742 ATGGACAGCAAAAAAAAGCAGGG - Intronic
1200446915 Y:3274546-3274568 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1200668419 Y:6057036-6057058 ATAAAAAAAAATAAACAGCAAGG + Intergenic
1200676186 Y:6149440-6149462 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1201013233 Y:9571630-9571652 ATGGAAAACAAAAAAAAGCAGGG - Intergenic
1201186286 Y:11406472-11406494 ATGGAAAACAAAAAATAGCATGG + Intergenic
1201437096 Y:13971190-13971212 ATGGAAAACAAAAAAGAGCAGGG - Intergenic
1201588548 Y:15588811-15588833 ATGTAAAACAAAAAACAGCAGGG - Intergenic
1201619873 Y:15944798-15944820 ATGGAAAACAATAAAAGGCAGGG - Intergenic
1201852449 Y:18500923-18500945 CTGCACAACAATAAAGCTCATGG - Intergenic
1201952798 Y:19584284-19584306 ATGGAAAACAAAAAAAAGCAGGG - Intergenic