ID: 935084648

View in Genome Browser
Species Human (GRCh38)
Location 2:99833121-99833143
Sequence GCTTCTCTTGTCCCACCATC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935084648 Original CRISPR GCTTCTCTTGTCCCACCATC CGG Intronic
901721214 1:11199476-11199498 GCTTCTCTCCTCCCACCAGCTGG + Intronic
902150315 1:14437688-14437710 GCTTCTCATGTCCGACCCACGGG - Intergenic
903551816 1:24162382-24162404 ACTTCTCTTCTGCCTCCATCTGG + Intronic
904384740 1:30133850-30133872 CCTTCTCTGGTCCCACCAGGTGG - Intergenic
908744156 1:67359614-67359636 GATTCTCCTGTCCCAGCCTCTGG - Intronic
909418261 1:75432284-75432306 GCTTCTTTTATCCCACTATGAGG + Intronic
910569504 1:88684243-88684265 GCTCCTCCTGTCGCACCATTTGG - Exonic
916049315 1:161024096-161024118 GATTCTCTTGTCTCAGCCTCCGG - Intronic
916236603 1:162595181-162595203 GCTTCTGTTTTCCCTCCTTCAGG + Intronic
916458235 1:164993077-164993099 GCTCCTCTTCTCCCAACAGCTGG + Intergenic
917292131 1:173481332-173481354 CATTCTCTTCTCCCACCCTCGGG + Exonic
917344958 1:174020901-174020923 GATTCTCCTGCCTCACCATCCGG - Intronic
918199024 1:182249506-182249528 GCTCCTCCTCTCACACCATCTGG - Intergenic
918369319 1:183842921-183842943 GCTTCTCTTGTCGGGCCATATGG + Intronic
919329310 1:196149042-196149064 CCTTCTCTTGCCTCACCATCTGG + Intergenic
919874786 1:201856375-201856397 GCTTTTGATGACCCACCATCAGG - Intronic
920872101 1:209803472-209803494 GCTTCTCCTTTCCCATCATCAGG - Intronic
922568423 1:226617198-226617220 TCTCCTCTTGTCCCTCCTTCTGG - Intergenic
924504631 1:244670060-244670082 GATTCTCCTGTCCCAGCCTCCGG + Intronic
1065201398 10:23316505-23316527 GCTTTTTTAGTCCCACCATTTGG + Intronic
1065225727 10:23541998-23542020 TTTTCTTTTTTCCCACCATCTGG + Intergenic
1065535734 10:26713184-26713206 GATTCTCTTGCCCCAGCCTCCGG - Intronic
1067109843 10:43392431-43392453 GATTCTCCTGTCCCAGCGTCTGG - Intronic
1067823129 10:49548553-49548575 GTTTCTCTTTCTCCACCATCCGG - Intergenic
1069721225 10:70550631-70550653 GCTTCCCCTCCCCCACCATCTGG + Intronic
1069915660 10:71785169-71785191 GCTTTTCTGCTGCCACCATCTGG + Intronic
1070588308 10:77782502-77782524 GCGTTTCTTGTTCCACCAACTGG + Intergenic
1072906092 10:99455445-99455467 GCTTCTGTTGTGCCACCGTAGGG + Intergenic
1074557967 10:114509388-114509410 GCTCCCCTTGTCCCACCAGTCGG + Intronic
1075084007 10:119401992-119402014 GCTCCTGTGGCCCCACCATCTGG + Intronic
1077759017 11:5070125-5070147 GCCTGTCTTGTGCCAGCATCAGG + Intergenic
1078339365 11:10488110-10488132 GCCTCTCTTCTCCCACCAAGGGG + Intronic
1080553596 11:33395918-33395940 ACTTCGCATGTACCACCATCAGG - Intergenic
1088720075 11:112584607-112584629 GATTCTCTTGTCACACCCTTGGG - Intergenic
1089344448 11:117781869-117781891 GTTCCTCTTATCCCAGCATCAGG + Intronic
1090205962 11:124884564-124884586 GCTGCTCTTCCCCCACCATTTGG - Exonic
1092490331 12:8939250-8939272 GCTTCCCTTCTCCTATCATCTGG + Intronic
1096273045 12:50181953-50181975 GCGTCTCTTGGCCAACCAGCAGG - Exonic
1096533095 12:52254165-52254187 TCTCCCCTTGTCCCACCATAGGG + Intronic
1097116578 12:56701774-56701796 GATTCTCTTGTCTCAGCCTCCGG - Intergenic
1100122346 12:91383471-91383493 GCTGCCCCTGTGCCACCATCAGG + Intergenic
1100662678 12:96717201-96717223 GCTTCTTTTGTACCACGTTCAGG + Intronic
1102444971 12:112995026-112995048 CCATCTCTTGTCCCTCCATTAGG + Intronic
1103274542 12:119700700-119700722 GCTTCTCTTTTGCCAGCAGCTGG - Exonic
1103321105 12:120093361-120093383 GCTTCCCTTGGCCCACCGCCTGG + Exonic
1107709143 13:43135174-43135196 GCTTATATGGTCCCACCATGGGG + Intergenic
1111384828 13:87511697-87511719 GATTCTCCTGTCTCAGCATCAGG + Intergenic
1112485634 13:99817078-99817100 GATTCTCTTGTTCCATCACCAGG + Intronic
1114005448 14:18307804-18307826 GATTCTCTTGTCTCAGCCTCTGG - Intergenic
1117559931 14:56926952-56926974 GATTCTCTTGTCTCAGCCTCCGG + Intergenic
1118244276 14:64093705-64093727 GCTTCTCTTGATCAAACATCAGG - Intronic
1120161498 14:81150253-81150275 GCTTATCTTGTAGCAACATCTGG + Intergenic
1120492699 14:85196549-85196571 GCCTCTCTTGTTCCATCTTCTGG - Intergenic
1123389901 15:19860036-19860058 GATTCTCTTGTCTCAGCCTCTGG - Intergenic
1124119028 15:26872665-26872687 ACTTCTCTTGTCCTAGAATCAGG - Intronic
1129944651 15:79528189-79528211 GCTTATCTGGTCCCAACTTCAGG - Intergenic
1130838220 15:87672597-87672619 GCTTCTCCTGTCCAAGCCTCTGG - Intergenic
1131258365 15:90875943-90875965 TCTTCTCTGGTCCCACCCCCTGG - Intronic
1131985168 15:98035732-98035754 GCTTCTCTTGACCCAACATGAGG - Intergenic
1132399959 15:101499057-101499079 GCTCTTCCTGTCCCACCATAGGG + Intronic
1133305734 16:4807215-4807237 GATTCTCCTGTCCCAGCCTCCGG + Intronic
1134241941 16:12512979-12513001 GCTTCCCTTGTCCCCCCAGAGGG + Intronic
1135461981 16:22652286-22652308 GATTCTCTTGTCTCAGCCTCTGG - Intergenic
1136148071 16:28327585-28327607 GATTCTCTTGTCCCAGCCTCCGG - Intergenic
1140309999 16:73840025-73840047 GTTTCTCTTGTCCAGGCATCTGG + Intergenic
1140731090 16:77857029-77857051 GCTTCTTTTGTCCCACCATGGGG - Intronic
1140824200 16:78690674-78690696 CTTTGTCTTGTCCCTCCATCTGG + Intronic
1141323739 16:83036473-83036495 GGTTCTATTGGCTCACCATCTGG + Intronic
1142228643 16:88889222-88889244 GCTTCTCTTTTGTCACCATCTGG + Intronic
1145234878 17:21201386-21201408 GAGGCTCTTGTCCCACCCTCAGG - Intronic
1146724794 17:35148245-35148267 GCTTCTCCTGTCCCAGCAGATGG + Exonic
1150062724 17:62082678-62082700 GATTCTCCTGTCCCAGCCTCTGG - Intergenic
1150293552 17:63995840-63995862 GCTGCTCCTGTGCCACCTTCTGG + Intergenic
1150868663 17:68880407-68880429 GCTTTTTTAGTCCCACCATTTGG - Intronic
1151150644 17:72083178-72083200 GCCTCCCTTCTCCCACCTTCTGG - Intergenic
1152439284 17:80295535-80295557 CTTCCTCTTCTCCCACCATCAGG + Exonic
1154531984 18:15356066-15356088 GATTCTCTTGTCTCAGCCTCTGG + Intergenic
1155531521 18:26771725-26771747 ACTTCTCTGGTCTCACCAGCAGG - Intergenic
1159431892 18:68362873-68362895 GGTTCTCCACTCCCACCATCAGG - Intergenic
1160072533 18:75641135-75641157 GTTTTTCTTGTCTCACAATCAGG - Intergenic
1160910987 19:1473710-1473732 GCTTTCCTTGTCCCCCCAGCTGG - Exonic
1161219883 19:3113628-3113650 TCTGCTCTGGTCCCTCCATCCGG - Intronic
1161453199 19:4357929-4357951 GCCTCCCTGGTCCCACCACCAGG + Intronic
1161879985 19:6942428-6942450 GTTTCTCATGTCCCTCCAGCAGG - Intergenic
1162125331 19:8496617-8496639 GATTCTCCTGTCCCACCCTCTGG - Intronic
1168717466 19:58537941-58537963 GATTCTCCTGTCCCAGCCTCCGG + Intronic
926303725 2:11622184-11622206 GATTCTCTTGTCTCAGCCTCTGG + Intronic
928277350 2:29915189-29915211 TCTTTTCTTCTCCCACCTTCAGG + Intronic
930739295 2:54813588-54813610 GTTCCCCTAGTCCCACCATCTGG + Intronic
935084648 2:99833121-99833143 GCTTCTCTTGTCCCACCATCCGG + Intronic
935547038 2:104411284-104411306 GCTCCTCTTGTCCCAAGCTCAGG - Intergenic
935586433 2:104803928-104803950 GCTTCTCTTCTCCCACCCTGGGG + Intergenic
936574141 2:113639514-113639536 GATTCTCTTGTCTCAGCCTCCGG - Intronic
936628390 2:114173733-114173755 GCTTCTATTGTTCAAACATCAGG - Intergenic
938531081 2:132187297-132187319 GATTCTCTTGTCTCAGCCTCTGG + Intronic
939873373 2:147549473-147549495 GAGTCTCTTGGCCCATCATCAGG - Intergenic
941615590 2:167714825-167714847 GCTTCTCTTATTCCTCTATCTGG + Intergenic
942064413 2:172257081-172257103 GCTTCTCTTGGCAGACCAACAGG + Intergenic
942492573 2:176504786-176504808 GCTTCTCTGGTCCCACCCCCTGG - Intergenic
945220683 2:207480781-207480803 GCTCCCCTTGTCCAACCCTCAGG + Intergenic
945474679 2:210266986-210267008 CCTTCTCTTCTCCCACCAAAGGG - Intergenic
947522913 2:230862255-230862277 GCTTCTCCTGTCCCCCTTTCTGG - Intergenic
948730684 2:239961898-239961920 GCCCCACTTCTCCCACCATCTGG + Intronic
1172001845 20:31784624-31784646 GCTTCTTGTTTCCCACCGTCAGG - Intronic
1172167213 20:32906748-32906770 GCTGCTCTTGTCCCCACTTCTGG + Intronic
1172606928 20:36220389-36220411 GCTTCTCATGTCCCATAAACAGG - Intronic
1172691766 20:36795042-36795064 GATTCTCCTGTCTCAGCATCCGG + Intronic
1173182825 20:40817542-40817564 GCTTGGCTTGACCCAGCATCTGG + Intergenic
1175488904 20:59365445-59365467 CCTTCTCTTCCCCCACCATCAGG + Intergenic
1175710858 20:61219704-61219726 AATTCTCTTGTCTCACCCTCTGG + Intergenic
1176765381 21:13012124-13012146 GATTCTCTTGTCTCAGCCTCGGG - Intergenic
1177093833 21:16806287-16806309 TCTTCTTTTTTCCCACCATTTGG - Intergenic
1178150244 21:29786092-29786114 GATTCTCTTGTCTCAGCCTCCGG + Intronic
1178671366 21:34594444-34594466 GATTCTCCTGTCCCAACCTCTGG - Intronic
1180429956 22:15238593-15238615 GATTCTCTTGTCTCAGCCTCTGG - Intergenic
1180512567 22:16106923-16106945 GATTCTCTTGTCTCAGCCTCCGG - Intergenic
1181344297 22:22206915-22206937 GCTTCACATGTCCCTACATCTGG + Intergenic
1182637065 22:31736589-31736611 CCTGCTCTAGACCCACCATCAGG - Intronic
1185009367 22:48304726-48304748 TCTGCTCGTGTCCCACCATGAGG + Intergenic
1185426033 22:50771380-50771402 GATTCTCTTGTCTCAGCCTCCGG + Intronic
949474698 3:4432310-4432332 GCTTCTCTCTTCCTACCACCTGG + Intronic
951600860 3:24373253-24373275 GCTGCTCTTTTCTCACGATCTGG + Intronic
953415259 3:42712061-42712083 CTTTCTCTTCTCCCACCAGCAGG - Intronic
953621152 3:44534007-44534029 GCTTCATTTCTCCCACCATCTGG + Intergenic
954455861 3:50599513-50599535 GCCTCTCTCCTCCCACCCTCAGG - Intergenic
959595498 3:108124732-108124754 GCTGTTCTTGTCTCACAATCTGG + Intergenic
960109827 3:113834832-113834854 GATTCTCCTGTCCCAGCCTCTGG - Intronic
960422632 3:117465933-117465955 GATTCTCTTGTCTCAGCCTCCGG - Intergenic
961839889 3:129700580-129700602 GCTTCTCTTGCCTCATCCTCCGG + Intronic
962087543 3:132207746-132207768 GCTTCTCTGCTCCCATGATCTGG - Intronic
962335602 3:134527547-134527569 GCTTTTCTTGCCCCACCAGCAGG - Intronic
966166581 3:177025876-177025898 GCTACCCTTTTCCCACCTTCTGG + Intronic
966943780 3:184763305-184763327 GCCTAACTTGTCCCACCAGCTGG - Intergenic
974242159 4:59263717-59263739 TCTTCTCTTGTCCCACATCCTGG + Intergenic
975339186 4:73218535-73218557 GATTCTCTTGTCTCAGCCTCTGG - Intronic
975498203 4:75057510-75057532 GGGTCTCCTGTCCCACCAGCTGG - Intergenic
975712147 4:77171411-77171433 GATTCTCTTGTCTCAGCCTCAGG - Intronic
976272912 4:83248471-83248493 GCTGCTCATTTCCCTCCATCAGG - Intergenic
980120575 4:128723894-128723916 GATTCTCCTGCCCCAGCATCCGG - Intergenic
982398901 4:154943992-154944014 GCTTGAGTTGTCCCACCTTCTGG + Intergenic
982526190 4:156482205-156482227 GCTTCTCCTGTCTCAGCCTCTGG + Intergenic
983718265 4:170813909-170813931 GCTTCTCTTTTAACACCATAGGG + Intergenic
985244856 4:187970374-187970396 CATTCTCTTCTCCCACCCTCGGG + Intergenic
989361467 5:40606348-40606370 GATTCTCATGCCCCACCCTCTGG + Intergenic
990441322 5:55848178-55848200 CCCTCTCTTCTCCCACCTTCAGG - Intergenic
994197024 5:96933336-96933358 GCTTCTCATGCCTCACCCTCCGG + Intronic
994245320 5:97470644-97470666 CCTTCTCTTTGCCCACCATGTGG + Intergenic
1002393273 5:178933255-178933277 GATGCTCTTGTTCCACAATCTGG + Intergenic
1003501799 6:6709271-6709293 GCTTATCAAGTCCCACCAACAGG + Intergenic
1005593976 6:27360255-27360277 GCTTCTTTTCTCCCAACATTTGG - Intergenic
1005855813 6:29862497-29862519 GCTTCTCATTTCACACTATCTGG - Intergenic
1005983615 6:30856318-30856340 ACCTCCCTTGTTCCACCATCAGG + Intergenic
1006068524 6:31479807-31479829 GCTCCTCATTTCACACCATCTGG + Intergenic
1006336040 6:33420885-33420907 TCTTCTCTCTTCCCTCCATCTGG - Intronic
1007725922 6:43915562-43915584 GGTTCATATGTCCCACCATCAGG + Intergenic
1011131142 6:84052833-84052855 GCTCCTCTCTTCCCACCTTCAGG + Intronic
1013112195 6:107073068-107073090 TCTTCTCTTGTGCCCCCATGAGG + Intronic
1013821166 6:114154877-114154899 GCCTCTCTCCTCCCATCATCTGG + Intronic
1015390381 6:132675065-132675087 CATTCTCTGGTCCCACCTTCTGG + Intergenic
1018792130 6:167156962-167156984 GCTTCTCCAGCCCCACCTTCAGG - Exonic
1023837267 7:44075603-44075625 GCTACTCTGGCCACACCATCTGG - Intronic
1027664101 7:81022786-81022808 ACTTCTCTTGTCGCATCATCGGG + Intergenic
1029446483 7:100615726-100615748 GGAACTCCTGTCCCACCATCTGG + Intergenic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1030976225 7:116126875-116126897 CATTCTCTTGTCCCAATATCTGG - Intronic
1030976393 7:116129211-116129233 CATTCTCTTGTCCCAATATCTGG + Intronic
1031140257 7:117934916-117934938 CCTACTCTTGTACCAACATCTGG + Intergenic
1031576545 7:123421676-123421698 CCTTCTCATTTCCCACCACCAGG + Intergenic
1031994387 7:128219778-128219800 ACTGCTCTTGTTCCTCCATCAGG - Intergenic
1032751630 7:134847201-134847223 GCTTCTCTTTCCACTCCATCTGG - Intronic
1033969737 7:147025178-147025200 GATTCTCTTGTCTCAGCCTCTGG - Intronic
1034225392 7:149477295-149477317 GCTTCTCTTGCCCCAGCATTGGG - Intronic
1034255108 7:149720527-149720549 GCTACACTTCTTCCACCATCTGG - Intronic
1034267437 7:149788042-149788064 GCTTCTCCTGTCCCACAAGACGG + Intergenic
1034493907 7:151409269-151409291 GCTTGTCTGGGCCCAGCATCTGG - Intronic
1035339783 7:158152812-158152834 TCTGCTCTTGTCCCACCAGTCGG - Intronic
1036613280 8:10368145-10368167 GGTACACTTGTCCCACGATCTGG - Intronic
1037777807 8:21847267-21847289 GCTTTTCTTGCCTCACCATTTGG + Intergenic
1038978408 8:32727654-32727676 GCTTCTCTTTTCCAACTACCTGG + Intronic
1041169270 8:55124371-55124393 GCTCCTTTTGTCCCGCCTTCAGG - Intronic
1041457196 8:58074082-58074104 GCTTTACTTTTCCCACCCTCCGG + Intronic
1041884831 8:62796276-62796298 GATTCTCCTGTCCCAACCTCTGG - Intronic
1045244376 8:100430075-100430097 GGTTCTGTTGTCCCACCATCAGG - Intergenic
1047714452 8:127582767-127582789 GCATCTCTTGTCCCAGCTTTTGG + Intergenic
1048738233 8:137525673-137525695 GCATCTATTAACCCACCATCTGG - Intergenic
1052907062 9:33844870-33844892 GATTCTCTTGCCTCACCCTCCGG + Intronic
1053109859 9:35449158-35449180 GCTTCTCTCTTATCACCATCTGG - Intergenic
1053709688 9:40793809-40793831 GATTCTCTTGTCTCAGCCTCTGG + Intergenic
1054419592 9:64914603-64914625 GATTCTCTTGTCTCAGCCTCTGG + Intergenic
1060299233 9:122364733-122364755 ACTTCTCTTGTCCCAAGATAAGG - Intergenic
1061247588 9:129408798-129408820 GCCTCCCTTGTCCCTCCATCTGG - Intergenic
1061312153 9:129770827-129770849 GCTCGACTTTTCCCACCATCAGG + Intergenic
1062296103 9:135828045-135828067 GCTTCTCTAGACCCAGCATGTGG + Intronic
1186808109 X:13160527-13160549 TCTTCTCTTCTCCCACAATAGGG + Intergenic
1186925455 X:14328804-14328826 TATTCTCTTCTCCCACCCTCGGG + Intergenic
1188160353 X:26793220-26793242 GTTTCTCTTGTGCCACCTGCAGG + Intergenic
1188226132 X:27600079-27600101 GTTTCTCTTGTGCCACCTTCTGG - Intronic
1189350195 X:40270172-40270194 GCTTCTCCTGTCCCACAGCCTGG - Intergenic
1192405506 X:70881921-70881943 GATTCTCCTGTCTCACCTTCTGG - Intronic
1192684489 X:73289203-73289225 GCTTTCCTTGTCCCGCCAGCAGG + Intergenic
1192775594 X:74241119-74241141 TCTTCTATTGTCCTACCCTCAGG + Intergenic
1193162335 X:78241550-78241572 CCTTCTCTTGTCCCAGTGTCAGG + Intergenic
1193987099 X:88256684-88256706 GCTTCTCTTGTCAAACTACCTGG + Intergenic
1195758664 X:108223771-108223793 GCCTCCCTTGTCCCAGCCTCAGG - Intronic
1199503913 X:148540247-148540269 GCTTCTCTAATCCCTCCTTCTGG - Intronic