ID: 935085208

View in Genome Browser
Species Human (GRCh38)
Location 2:99838157-99838179
Sequence CTTAAAATGCTCCCCAGAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935085208_935085212 6 Left 935085208 2:99838157-99838179 CCGACTCTGGGGAGCATTTTAAG 0: 1
1: 0
2: 0
3: 9
4: 179
Right 935085212 2:99838186-99838208 AGATGCTGTGTGGGTCCTGCTGG 0: 1
1: 0
2: 1
3: 31
4: 243
935085208_935085214 27 Left 935085208 2:99838157-99838179 CCGACTCTGGGGAGCATTTTAAG 0: 1
1: 0
2: 0
3: 9
4: 179
Right 935085214 2:99838207-99838229 GGCTACACAGCCAAGAGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 164
935085208_935085209 -4 Left 935085208 2:99838157-99838179 CCGACTCTGGGGAGCATTTTAAG 0: 1
1: 0
2: 0
3: 9
4: 179
Right 935085209 2:99838176-99838198 TAAGTTCCAGAGATGCTGTGTGG 0: 1
1: 0
2: 2
3: 26
4: 237
935085208_935085210 -3 Left 935085208 2:99838157-99838179 CCGACTCTGGGGAGCATTTTAAG 0: 1
1: 0
2: 0
3: 9
4: 179
Right 935085210 2:99838177-99838199 AAGTTCCAGAGATGCTGTGTGGG 0: 1
1: 1
2: 6
3: 41
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935085208 Original CRISPR CTTAAAATGCTCCCCAGAGT CGG (reversed) Intronic
900196049 1:1376076-1376098 CTAATGATGCTCCCCAGAGTAGG + Intergenic
901692255 1:10981073-10981095 TTTAAAAAGCTCCTGAGAGTGGG - Intronic
901846262 1:11984669-11984691 CTTAAAACCCTCCCCTGAGAGGG + Intronic
902929546 1:19721189-19721211 CTGAGAATGGTCCCCAGAGAGGG + Intronic
903917014 1:26772089-26772111 CCTAAAATGCATCCCAGATTTGG + Intronic
905822136 1:41001555-41001577 CTTAAAATGCTCCCCTAAGGGGG - Intronic
906159124 1:43634797-43634819 CTTAAGAGCCTACCCAGAGTCGG + Intergenic
908828798 1:68158984-68159006 AATAAAATGCTCCGCAGAGCAGG + Intronic
915033463 1:152903404-152903426 CTGAGTATGCTCCCCTGAGTGGG - Intergenic
915632737 1:157164415-157164437 CTGAAAATCCTCCCCAGGGCTGG - Intergenic
918200580 1:182262537-182262559 CTTAAAGTGCTCCCCTCAGTGGG - Intergenic
920823045 1:209399305-209399327 GCTAAAAAGATCCCCAGAGTGGG - Intergenic
921594654 1:217041087-217041109 TTTAAAATTCTCCACAGAGTGGG + Intronic
921979377 1:221239147-221239169 CTTTACCTGCTCCCCAGAGCTGG + Intergenic
922130007 1:222768192-222768214 CTGGAAATGTGCCCCAGAGTAGG + Intergenic
1062788756 10:287551-287573 GTTAGAATGCTTCACAGAGTTGG - Intronic
1066229997 10:33422875-33422897 CTTAAAATTCAACCCAGTGTGGG - Intergenic
1066327578 10:34378779-34378801 CATAATATGATCCCCAGATTTGG - Intronic
1067175644 10:43943643-43943665 CTTGTCATGCTCCACAGAGTCGG - Intergenic
1067381149 10:45774756-45774778 CTGAGAATGCGTCCCAGAGTGGG + Intronic
1067696704 10:48541139-48541161 CATAGGCTGCTCCCCAGAGTAGG - Intronic
1067888846 10:50115385-50115407 CTGAGAATGCGTCCCAGAGTGGG + Intronic
1068254279 10:54488850-54488872 GTTAAAATTTTCCCAAGAGTAGG + Intronic
1069011171 10:63374659-63374681 CTTATAATGCTCCCTAGAACTGG + Intronic
1069526213 10:69174346-69174368 CTCAAAAATCTACCCAGAGTTGG + Intergenic
1070426132 10:76289458-76289480 CTTAAAGTGCTCCACAGACATGG + Intronic
1070557780 10:77542454-77542476 CTTAAAATGGATCCCAGACTTGG + Intronic
1071806553 10:89127973-89127995 ATTAAACTGCACTCCAGAGTGGG + Intergenic
1072337272 10:94408827-94408849 TTTTAAAAGCTCCCCAAAGTGGG + Intronic
1072824527 10:98592969-98592991 CTATAACTGCTCCTCAGAGTGGG + Intronic
1074962850 10:118463665-118463687 CTGAACATGATGCCCAGAGTGGG - Intergenic
1075450639 10:122549704-122549726 CTTAGAATGCTGCCCAGAGCTGG - Intergenic
1079794684 11:24785997-24786019 CTTCAAGTGGTACCCAGAGTTGG + Intronic
1081853030 11:46286932-46286954 GTTTAAAATCTCCCCAGAGTGGG - Intronic
1083275133 11:61592674-61592696 CTTAAAAGGCTCCTGAGGGTGGG - Intergenic
1086835332 11:91613958-91613980 CTTATAATGTTCCTCAGTGTAGG + Intergenic
1089705643 11:120275739-120275761 CTTAGAATGCTGCCAAGTGTGGG - Intronic
1090771451 11:129923248-129923270 CTTAAATTGCTTCCCACAGGTGG + Exonic
1092495117 12:8985894-8985916 CTTAAAACCTTCCCCAGAGAGGG - Intronic
1093563836 12:20578159-20578181 TCTAATATGCTCCCCAGAGAAGG + Intronic
1093759381 12:22890351-22890373 TTTAAATTGCTCACCAGAATTGG - Intergenic
1093817597 12:23568654-23568676 CTTAAATTACTCCCAAGAATCGG - Intronic
1095363133 12:41368306-41368328 CTGGAAATGCTCAACAGAGTGGG - Intronic
1096257929 12:50074123-50074145 GTTAAAGGGCTCCCCAGAGAAGG - Intronic
1098790201 12:74812813-74812835 CTTATAATGGTCCACAGAGAAGG + Intergenic
1099474717 12:83094309-83094331 GTGGAAATGCTCCCCAGAGCAGG - Intronic
1100158393 12:91828827-91828849 CTTAAAATCCTCCCCTTACTAGG - Intergenic
1101587158 12:106094977-106094999 CTAGAAATGCTCCCCAGGGATGG - Intronic
1102733594 12:115137097-115137119 ATTAAAAATCTCCCCAGACTTGG - Intergenic
1103223866 12:119269940-119269962 TTTAAAATACTCTCAAGAGTGGG - Intergenic
1106544429 13:30717838-30717860 CTTAAAACCCTCCCCAGAGAAGG - Intronic
1107098187 13:36559375-36559397 CTTAAAATGCCCTGGAGAGTGGG - Intergenic
1109552581 13:63922896-63922918 CTTAAAAAGCTCTTCAGTGTAGG + Intergenic
1109681455 13:65757682-65757704 CTGAAGAAGCTCCCCAGTGTGGG + Intergenic
1110439497 13:75511735-75511757 CTAAAAATGCCACCCAGAGAGGG - Intergenic
1111750185 13:92319605-92319627 CATAAAATGCTACCCTGAGAAGG - Intronic
1112598599 13:100832781-100832803 CTTTCAATGCTCCACAGTGTTGG + Intergenic
1117398391 14:55334977-55334999 TATGAAATGGTCCCCAGAGTGGG + Intronic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1125442480 15:39717824-39717846 CTTAAAATGATCCCTGGATTGGG - Intronic
1130056866 15:80533552-80533574 CTGAAAATGCCCCTCAGAGCAGG - Intronic
1132367032 15:101265141-101265163 CCAACAATGCTCCCCAGAGATGG - Intergenic
1132988469 16:2780341-2780363 CTTAAGACCCTCCCCAGAGAGGG + Intergenic
1133915565 16:10106523-10106545 CTTAGAATCATCCCCAGAGAAGG - Intronic
1136089036 16:27905145-27905167 CTAAAAATTCACCCCAGAGAGGG + Intronic
1137069567 16:35890351-35890373 ATAAAAATGCAGCCCAGAGTGGG + Intergenic
1138511226 16:57509600-57509622 CTTCAAATGCCTCCAAGAGTGGG + Intergenic
1138731754 16:59202991-59203013 CTTGGAATGCTTCCCAGAGGAGG - Intergenic
1140514394 16:75531695-75531717 CATAGAAAGCTCCCCAGGGTGGG + Intronic
1140747168 16:77990992-77991014 CTTAGAATGTTCCTCAGATTGGG - Intergenic
1142482839 17:229374-229396 CTGAAAATGCTCCCCAGGACAGG + Intronic
1143007588 17:3846796-3846818 CTTAAAAGTCTCCCCAAAATTGG + Intergenic
1143900159 17:10168438-10168460 CTTAAAAGGCTCCTTAGAGAGGG - Intronic
1147898681 17:43769431-43769453 CTTTATGTGCTCCCCAGGGTGGG + Exonic
1148810973 17:50290824-50290846 ATTAAACTGCTCTTCAGAGTGGG - Intergenic
1149639918 17:58195865-58195887 CTGAGAAGGCTCCCCAGAGGAGG - Intronic
1152175732 17:78785995-78786017 CTTAAGACCCTCCCCAGAGAGGG + Intergenic
1152737501 17:82004631-82004653 CTCAAAATGCGCCACAGGGTGGG - Intronic
1153445906 18:5172800-5172822 CTTAAAATGTTCCTTAGAGGGGG - Intronic
1154171416 18:12055323-12055345 ATAAAAATGCAACCCAGAGTGGG + Intergenic
1155233225 18:23794197-23794219 CTTAAGACTCTCCCCAGAGAGGG - Intronic
1156195914 18:34774120-34774142 CTTAAAATGCTCCTGTCAGTTGG + Intronic
1159280767 18:66281664-66281686 TTTAAAATGTTCCCCAATGTTGG + Intergenic
1160425449 18:78775733-78775755 CTTAAAGTTGTCCCCATAGTTGG - Intergenic
1163270524 19:16250559-16250581 CTTAAAGTGCTACCCAGGCTGGG + Intergenic
1164651110 19:29891603-29891625 TTTAATATGCTCCCCAGGCTTGG - Intergenic
928007150 2:27573098-27573120 GTTGAAATCCTCCACAGAGTCGG + Intergenic
931051617 2:58421399-58421421 CTTTTATTGATCCCCAGAGTAGG - Intergenic
933502826 2:83137645-83137667 TTTCAGATGCTCCCCAGAGCAGG + Intergenic
935085208 2:99838157-99838179 CTTAAAATGCTCCCCAGAGTCGG - Intronic
941206787 2:162582953-162582975 TTTAAAATGCTACTCAGCGTGGG - Intronic
942781317 2:179646827-179646849 CAGAAAATTTTCCCCAGAGTAGG - Intronic
943762136 2:191621664-191621686 TTTAAAAGGGCCCCCAGAGTGGG - Intergenic
946034189 2:216728730-216728752 CTTCAAATGCTCCTCTGAGAGGG - Intergenic
946973271 2:225119527-225119549 CTTAAAATACTCACCAGGGGAGG - Intergenic
947262079 2:228234511-228234533 GTTAAAATGCTCCCCAGTCGGGG - Intergenic
947537640 2:230950835-230950857 CTTAAGACTCTCCCCAGAGAGGG + Intronic
948382148 2:237558347-237558369 ACTGAAATGCACCCCAGAGTAGG + Intergenic
1169712240 20:8577838-8577860 CTTATAATGCTTCCCATATTAGG + Intronic
1170216873 20:13900893-13900915 TTTAAAATGCTCCCAATAATGGG - Intronic
1171359878 20:24579758-24579780 CGTGAGATGCTCACCAGAGTCGG + Intronic
1173738062 20:45375624-45375646 CTTAACAGGCTCCCCTGAGCTGG - Intronic
1174060322 20:47827841-47827863 CTTTAAATTCTCCCCAGAACGGG + Intergenic
1174071576 20:47903529-47903551 CTTTAAATTCTCCCCAGAACGGG - Intergenic
1174152473 20:48495106-48495128 CTTTAAATTCTCCCCAGAACGGG + Intergenic
1175012598 20:55754629-55754651 CTTAACATCCTCCCCAGAGAGGG - Intergenic
1175024118 20:55883234-55883256 CATAAAAGGCTCCACAGGGTTGG - Intergenic
1177252114 21:18606329-18606351 CTTAAAATGATCCACAGGGTAGG + Intergenic
1177756837 21:25358925-25358947 ATTAAAAATCTACCCAGAGTAGG - Intergenic
1178190971 21:30280485-30280507 AATAAAATGATCCCCAGAGATGG - Intergenic
1179495838 21:41770850-41770872 CTTAACATGGTGCCCACAGTAGG + Intergenic
1183310044 22:37104662-37104684 TTTAAAATGCACCCCAGGGCCGG + Intronic
953882381 3:46697332-46697354 CTTAAGACCCTCCCCAGAGAGGG + Intergenic
954532684 3:51334376-51334398 CTGAAAATGCTCCCCTCATTTGG - Intronic
954600693 3:51865545-51865567 TTTAAAATGTTCACAAGAGTGGG - Intergenic
955393469 3:58537590-58537612 CTTAATAGGCTCCCCTGAGATGG + Intergenic
955724531 3:61919058-61919080 CCTAAAATGTTCCCAAAAGTCGG + Intronic
957167974 3:76699550-76699572 TTTAAATTGCTGCCCAGACTTGG + Intronic
958479137 3:94624777-94624799 CATAAAATGCTCCTCAGTTTGGG + Intergenic
959689068 3:109178753-109178775 TTGAAAAGGCTCCCCAGAGGAGG + Intergenic
960199905 3:114820166-114820188 ATAAAAATGATCCTCAGAGTAGG + Intronic
960815386 3:121666471-121666493 CTGAAAATGCTCGGCAGAGATGG + Intronic
961156656 3:124685313-124685335 CTTAAAATTCTCCCAGGAGAGGG - Intronic
961165793 3:124762894-124762916 CTTAAAATGGTGCCCCCAGTGGG - Exonic
961522534 3:127475311-127475333 CTTGGAAGGATCCCCAGAGTGGG + Intergenic
967612243 3:191521212-191521234 GTTAAAATGCTGGCCAGAGCTGG + Intergenic
974105218 4:57462080-57462102 CTTCTAATAATCCCCAGAGTTGG - Intergenic
975256334 4:72240137-72240159 TTTCAAATGATCCCCACAGTTGG + Intergenic
978007444 4:103634795-103634817 TTTAAAATAATCACCAGAGTTGG - Intronic
978508230 4:109484243-109484265 TGTAAAATGTTCCCCAGTGTGGG + Intronic
979409565 4:120360003-120360025 TTTACAATGCTTCACAGAGTGGG + Intergenic
981356929 4:143799538-143799560 CTTGAATTTCTCCCCAGAATGGG + Intergenic
981378256 4:144040420-144040442 CTTGAATTTCTCCCCAGAATGGG + Intergenic
982673395 4:158348692-158348714 CTTAAGACCCTCCCCAGAGAGGG + Intronic
982699691 4:158646219-158646241 CTTAAATTACTTACCAGAGTTGG - Intronic
983393386 4:167162349-167162371 CTTAAAATAATGCCCAGGGTAGG - Intronic
984450848 4:179899186-179899208 TATAAAATGCTACCCTGAGTAGG - Intergenic
986870087 5:12035859-12035881 CTTAATCTCCTCCCCAGTGTTGG + Intergenic
988205595 5:28129622-28129644 CTTAAAATGCTCAAAAGAGGAGG + Intergenic
992767449 5:80014216-80014238 CTTTAAATGCTGCCCAGCTTTGG + Intronic
994683887 5:102924886-102924908 CATAAATTGCTCCCCATGGTGGG - Intronic
997596106 5:135108334-135108356 TTTAAAATGAGCCTCAGAGTGGG + Intronic
1000658988 5:163915930-163915952 ATTACATTTCTCCCCAGAGTAGG + Intergenic
1001309447 5:170600447-170600469 CAAAAAAGGCTCCCAAGAGTAGG - Intronic
1001377580 5:171276988-171277010 GTTAAAACGCTTCCCAGAGTTGG - Intronic
1005194939 6:23271423-23271445 CTTAAGACCCTCCCCAGAGAGGG - Intergenic
1006258435 6:32849338-32849360 AGTAAAATGCTCCCCAGACAAGG - Intronic
1008015705 6:46516992-46517014 CTTAGAATGAAACCCAGAGTGGG - Intergenic
1008068874 6:47079371-47079393 CGTGAAATGTACCCCAGAGTTGG + Intergenic
1008105157 6:47433196-47433218 CTAAAAATGCTTCCCACATTTGG + Intergenic
1009339865 6:62541240-62541262 CTGGAGATGCTCCCCAGTGTGGG + Intergenic
1011674146 6:89714995-89715017 CTTCAGATATTCCCCAGAGTAGG + Intronic
1012885921 6:104845775-104845797 CTTAAAAGTTTACCCAGAGTTGG - Intronic
1012953279 6:105541490-105541512 CATAAGATCCTCCCCAGAGAGGG + Intergenic
1014548033 6:122755264-122755286 GTTCAAATGCAGCCCAGAGTAGG - Intergenic
1017067303 6:150540867-150540889 TTTAATATGCTCCCCTGGGTGGG - Intergenic
1017600324 6:156073434-156073456 CTCAAAATTATCTCCAGAGTTGG - Intergenic
1018047163 6:159975472-159975494 CTTAAGATCCTCCCCAGTGAGGG - Intronic
1020415400 7:7940490-7940512 CATATAATGGTCCCCAGAGGAGG - Intronic
1021326702 7:19279709-19279731 CTTAAAATCCTCCCCCAAGAGGG - Intergenic
1022011954 7:26315880-26315902 CTTAAAATTATACCTAGAGTTGG + Intronic
1022180505 7:27914361-27914383 CATAACATACTCCCCACAGTTGG - Intronic
1024108593 7:46120423-46120445 CTTAAAATGATCCCCTGGCTGGG + Intergenic
1025234614 7:57226189-57226211 CTTTAAATTCTCCCCAGAACGGG - Intergenic
1030999995 7:116404080-116404102 TTTAAAATGCTCCCTAGAAATGG + Intronic
1033481777 7:141749460-141749482 CATAAAATGTTCCCAAGAATTGG + Intronic
1033656772 7:143380651-143380673 CTTAAGAGGCTGCCCAGCGTTGG + Intergenic
1041631176 8:60089069-60089091 CCTAAATTTCTCCCCAGAGGAGG + Intergenic
1042149568 8:65767574-65767596 CTTAAGACTCTCCCCAGAGAGGG + Intronic
1042261241 8:66861667-66861689 CTTAAAATGTTCAGCAGAATTGG + Exonic
1046082705 8:109391439-109391461 TTGCAAATGCTCCCAAGAGTGGG - Intronic
1047294795 8:123561224-123561246 CTTGGAATGCTCTGCAGAGTGGG - Intergenic
1048340843 8:133537362-133537384 CTTGAGATCCTCCCCAGAGAGGG - Intronic
1048356485 8:133657988-133658010 CTTCAAAGGCTCCCCATCGTGGG + Intergenic
1048972318 8:139652123-139652145 CTTTCAATGCTCCCAAGAGCTGG + Intronic
1052949153 9:34193878-34193900 CTTAACACCCTCCCCAGAGAGGG - Intronic
1053055980 9:34993349-34993371 CTTAAACTTCTCCTCAGCGTTGG - Exonic
1056408140 9:86296588-86296610 ATTAAAGTACTGCCCAGAGTAGG - Intronic
1059788267 9:117610988-117611010 CAGAATATACTCCCCAGAGTGGG - Intergenic
1186393975 X:9189313-9189335 CTTAACACTCTCCCGAGAGTTGG - Intergenic
1187311605 X:18149457-18149479 CATAAACTGCACCACAGAGTTGG - Intergenic
1192242905 X:69348986-69349008 CTGAGAAGGCTCCCCAGAGGTGG - Intergenic
1193930034 X:87542253-87542275 CTTAAATTTCTCCCCAGAAAAGG - Intronic
1196195139 X:112831614-112831636 CTGAAAAAGCTCCCAAGAGGAGG + Intronic
1198540322 X:137631795-137631817 CTTAAAGTGCTAGCCAGACTGGG + Intergenic
1199526554 X:148798838-148798860 CTTGAGATGCTCCACAGAGCTGG + Intronic
1199723132 X:150557571-150557593 CTTAAGATCCTCTCCAGAGAGGG + Intergenic
1201789942 Y:17828201-17828223 CTTTAAATGTGCCCCAGAGATGG - Intergenic
1201811612 Y:18077788-18077810 CTTTAAATGTGCCCCAGAGATGG + Intergenic