ID: 935085592

View in Genome Browser
Species Human (GRCh38)
Location 2:99841547-99841569
Sequence CAGAACACTGAGAAATGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935085591_935085592 -8 Left 935085591 2:99841532-99841554 CCTCTTGAGTCTTTTCAGAACAC 0: 1
1: 0
2: 2
3: 20
4: 189
Right 935085592 2:99841547-99841569 CAGAACACTGAGAAATGTTCTGG 0: 1
1: 0
2: 2
3: 24
4: 264
935085588_935085592 29 Left 935085588 2:99841495-99841517 CCTTAAATTACAGCATGGACAGT 0: 1
1: 1
2: 1
3: 16
4: 120
Right 935085592 2:99841547-99841569 CAGAACACTGAGAAATGTTCTGG 0: 1
1: 0
2: 2
3: 24
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935085592 Original CRISPR CAGAACACTGAGAAATGTTC TGG Intronic
900769275 1:4528044-4528066 CAGAGCACCGAGAAATGTTGGGG + Intergenic
904255904 1:29254789-29254811 CAGAACACTGAGTAACAATCCGG + Intronic
904382614 1:30121597-30121619 CAGCTCACTGAGAAATGTCTGGG + Intergenic
907344537 1:53763889-53763911 AAGAATGCTGAGCAATGTTCAGG - Intergenic
909175059 1:72346968-72346990 TAGAACAGTGAGAAAATTTCTGG - Intergenic
909182207 1:72439169-72439191 CAGAACAGAGAGAAAGGCTCTGG - Intergenic
909245290 1:73273631-73273653 CAGAATACTTAGAAATGGTTTGG - Intergenic
910492466 1:87787642-87787664 GAGAACACTGTGAAAGGTGCTGG - Intergenic
912228758 1:107767628-107767650 CAAAACACAAAGAACTGTTCAGG + Intronic
913451259 1:118994166-118994188 CAGGACAGTGAGAAATGGTGGGG + Intergenic
913486398 1:119335663-119335685 CAGGAAACTGAGAACTGCTCTGG + Intergenic
915283055 1:154835918-154835940 CAGAAGACTTGGAAATGTTTTGG - Intronic
915653106 1:157334087-157334109 CAGGTCAGTGAGAAATGTGCTGG - Intergenic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
917083703 1:171284067-171284089 CAAAACAATCAGAAATGTTTTGG - Intronic
917328100 1:173853945-173853967 CACAAAACTGAAAAATATTCTGG - Intronic
918346257 1:183610024-183610046 CAGACCCCTGAGAAAAGTTTGGG - Intergenic
918369201 1:183841611-183841633 CAGGACACTCAGAGATGTTAAGG - Intronic
918412772 1:184277469-184277491 CAGAGCACAGAGAAATTTTAGGG + Intergenic
919176848 1:194029708-194029730 TAGAACACTGAAAAATATTTTGG + Intergenic
920741725 1:208587177-208587199 CAAAACACTCAGAAATATTAAGG + Intergenic
921042715 1:211448925-211448947 CAGAACAAAGAGAAATACTCTGG + Intergenic
921164646 1:212498063-212498085 CTGAAATCTGAGAAATGTCCTGG + Intergenic
921704508 1:218306460-218306482 CACAACCCTGAGAAATGGCCTGG + Intronic
921901933 1:220460616-220460638 CTGAAAACTGAGAAATGTTTAGG + Intergenic
922061362 1:222095883-222095905 TACAAAACTGAGAAATGTCCTGG - Intergenic
923743707 1:236681340-236681362 CACAACCCTGAGAAATGGGCGGG + Intergenic
923843330 1:237698910-237698932 AAGAACATTGAGAAATTCTCAGG + Intronic
924145156 1:241066781-241066803 CAGAACATTCCTAAATGTTCAGG + Intronic
924218217 1:241847422-241847444 CAGACCACAAAGTAATGTTCTGG - Intergenic
924552049 1:245088085-245088107 AAGAATACTGAGAAATGTTATGG + Intronic
924901127 1:248401151-248401173 CAGACCACAATGAAATGTTCTGG - Intergenic
1063257094 10:4340398-4340420 CAGAGCAAGGACAAATGTTCTGG - Intergenic
1063876056 10:10479964-10479986 CAAAAGGCTGAGAAATGATCAGG - Intergenic
1064349894 10:14567260-14567282 CAGAAAAATGAGAAAAGTACAGG + Intronic
1064861825 10:19835067-19835089 CAGAGAACTGTGAAATCTTCAGG + Intronic
1065148187 10:22794293-22794315 CAGACCTCTGAGAAAAGTTCAGG + Intergenic
1066067112 10:31770449-31770471 CAGAACAAACAGAAATGTGCAGG + Intergenic
1066425000 10:35300059-35300081 CAGAGATCTGAGAGATGTTCAGG - Intronic
1067203114 10:44191981-44192003 CAGAGAACAGAGAAATGTTAGGG + Intergenic
1067705527 10:48604239-48604261 CAGAACACTCAGAAAGCTGCAGG - Intronic
1067722781 10:48742180-48742202 CAGATCACTGAGAGCTGTACTGG - Intronic
1067787149 10:49258842-49258864 CAGAGCACCCTGAAATGTTCTGG + Intergenic
1067879153 10:50028874-50028896 GCGAACACTGAGCCATGTTCAGG + Intergenic
1068570370 10:58621456-58621478 CAGGGCACTTAGAAATGCTCGGG - Intronic
1069199651 10:65597323-65597345 AAGGACACTGTGAAATGTTGGGG - Intergenic
1071048793 10:81419776-81419798 GAAAACACTGAGAAATTGTCAGG + Intergenic
1073098236 10:100993439-100993461 CAGAACTCTGAGATTTGCTCAGG + Exonic
1074183384 10:111082062-111082084 GAGAGCCCTGAGAAATGATCTGG + Intergenic
1074893757 10:117757152-117757174 CAGAACCCTGACCAATGCTCAGG - Intergenic
1076317104 10:129550379-129550401 CGGAACACTGTGAAACATTCCGG - Intronic
1077404376 11:2376649-2376671 CAGAACAGTGTGAAGTGTCCAGG - Intronic
1078945042 11:16056307-16056329 AAGAATCCTTAGAAATGTTCAGG - Intronic
1079834655 11:25318641-25318663 GAGAACAATGATAAATGTTGAGG - Intergenic
1079869492 11:25780233-25780255 TAGACTACTGAGAAATGTTATGG + Intergenic
1079886341 11:25993871-25993893 CAAAACACTGGGAAATGTTGTGG - Intergenic
1080185898 11:29485721-29485743 CAAAACACTGTTAAATGTTGTGG - Intergenic
1080535999 11:33222354-33222376 AAGAATAATGAGAAAAGTTCAGG - Intergenic
1083091743 11:60207162-60207184 CACAAAACTAAGAAAAGTTCTGG + Intronic
1083251141 11:61468100-61468122 CAGAACCGTGAGAAAATTTCTGG - Intronic
1083526828 11:63375151-63375173 GAGAACACTGAGGAATATTTAGG + Intronic
1083839887 11:65298339-65298361 CAGAACACTCAGACAGGGTCAGG + Exonic
1087155259 11:94895678-94895700 CACAACTCTGAGAAATGATCTGG + Intergenic
1089344077 11:117778908-117778930 TAGAACACAGAGATATGCTCAGG - Intronic
1089785590 11:120904753-120904775 CAGAACACTGAGAGATGGAAGGG - Intronic
1092504881 12:9088201-9088223 CAAAGTACTGAAAAATGTTCAGG + Intronic
1094415920 12:30214733-30214755 CTGAATAGTCAGAAATGTTCAGG - Intergenic
1097266736 12:57750236-57750258 CAGAAAGCTCTGAAATGTTCTGG - Intronic
1098116267 12:67180162-67180184 CAGATCACTGACAAAGGTACAGG - Intergenic
1098219215 12:68250997-68251019 CAGAACAATGAGAAAAGAGCTGG - Intronic
1099017329 12:77359543-77359565 CAGAACACAGAGAATTTTTAGGG - Intergenic
1099348499 12:81534353-81534375 CATAAAATTGAGAAATTTTCAGG + Intronic
1100926641 12:99556107-99556129 CAGAACTCATAGAATTGTTCAGG + Intronic
1102259006 12:111432099-111432121 AAGAATACAGAAAAATGTTCAGG - Intronic
1102692351 12:114771294-114771316 CAGATCACTGAGAGATGTTCAGG + Intergenic
1102692583 12:114773005-114773027 CAGACCATTGGGAGATGTTCAGG + Intergenic
1102993180 12:117329358-117329380 CAGAGCACTTAGAGATCTTCAGG - Intronic
1103199634 12:119076912-119076934 TAAAGCACTGGGAAATGTTCTGG + Intronic
1105255025 13:18738724-18738746 CAGAAACCTGAGAAATGTGGAGG + Intergenic
1106440671 13:29764671-29764693 CAGAACACTTAACAAAGTTCAGG + Exonic
1106893524 13:34272381-34272403 AAGAAGGCTGAGAAATGTGCTGG + Intergenic
1107998142 13:45881662-45881684 CACAACACTGATAAAGCTTCAGG - Intergenic
1108527956 13:51301792-51301814 CAGAACACAGAGGATTTTTCGGG - Intergenic
1108582396 13:51838444-51838466 CACAACTCTGAGAAATGCCCTGG - Intergenic
1109786369 13:67180832-67180854 CTTATCAGTGAGAAATGTTCAGG - Intronic
1111328446 13:86731218-86731240 CAGAACAGTGAGCAATCTTCTGG - Intergenic
1111477387 13:88769456-88769478 CAGAACACAGAGAAATTTTAGGG + Intergenic
1112179002 13:97058223-97058245 CTTAACACAGAGAAATATTCTGG - Intergenic
1114197235 14:20489629-20489651 TAGCAAACTGAGAAATTTTCAGG + Intergenic
1114602664 14:23969284-23969306 CCCAACACTGAGAAATGAACAGG - Intergenic
1114607032 14:24006413-24006435 CCCAACACTGAGAAATGAACAGG - Intergenic
1115328641 14:32169685-32169707 AAGAAAACTCAGAATTGTTCTGG + Intergenic
1115727058 14:36228511-36228533 CAGAGCTCAGAGAAATGCTCTGG - Intergenic
1118923173 14:70168274-70168296 CAGAACAATGAGTCCTGTTCAGG - Exonic
1119756298 14:77122255-77122277 CAGAAGAAGGAGAAATGTTCGGG - Intronic
1120305208 14:82761034-82761056 CAGAAGACTGAGTATTTTTCTGG + Intergenic
1121659616 14:95625057-95625079 CAGAACAATAAGTACTGTTCTGG + Intergenic
1202885833 14_KI270722v1_random:106275-106297 CAGAGCACAGAAAAATGTTCTGG + Intergenic
1126044377 15:44625163-44625185 AATAACACTGAGAAATGTTTTGG - Intronic
1126734720 15:51719177-51719199 CACAACCCTGTGAGATGTTCAGG - Intronic
1127808937 15:62546508-62546530 CAGAAAGCTGGGAAGTGTTCTGG + Intronic
1129368055 15:75069133-75069155 TAGAACTCTGAGAAATGACCTGG + Intronic
1129627910 15:77224184-77224206 CAAAAGACTGAGATATTTTCTGG + Intronic
1131214820 15:90528800-90528822 CAGAACACTGACACACGCTCAGG + Intergenic
1132376659 15:101332575-101332597 CAGGACAGTGAGGGATGTTCTGG + Intronic
1133781127 16:8940329-8940351 CAGAACACCGCCAAATGCTCTGG + Intronic
1134162971 16:11907187-11907209 CAGAACACAGAGAAATGCCATGG + Intronic
1135999957 16:27284884-27284906 CAGAACACTGGGAAATGAAAGGG + Intronic
1136676593 16:31913995-31914017 CACCACAGTGGGAAATGTTCTGG + Intronic
1137955828 16:52828028-52828050 CAGATCTCTTAGAAATGTCCAGG + Intergenic
1138615722 16:58164313-58164335 CCAAACACTGAAAAATGATCAGG + Intronic
1139393233 16:66619431-66619453 CAGAACACTGAGAAAAACTAAGG + Intronic
1140075771 16:71697672-71697694 CAGTACACAGAGAAACGTTCAGG + Intronic
1140575490 16:76163094-76163116 CAGGAAACTGAGATAAGTTCTGG + Intergenic
1144234298 17:13242301-13242323 CAGGAGAATGAGAAGTGTTCTGG + Intergenic
1145761099 17:27425846-27425868 CAGAACACTGGGCAGTGTCCCGG - Intergenic
1147537923 17:41332952-41332974 CAGAACACTGGGAAAGGCTGTGG + Intergenic
1149030775 17:52079951-52079973 CAGAACATTGAGAATTGAACTGG + Intronic
1150632923 17:66892806-66892828 TAGGACACTGAGAAATGCTATGG - Intergenic
1150829031 17:68502088-68502110 CAGACTCCTGAGAAGTGTTCAGG + Intergenic
1150867571 17:68869975-68869997 CAGAACACAGAAAAATGTGAAGG - Intronic
1151784122 17:76266638-76266660 CAGCACACAGAGAAGTGGTCCGG + Intronic
1154436001 18:14341882-14341904 CAGAAACCTGAGAAATGTGGAGG - Intergenic
1154961010 18:21308705-21308727 CAAAGCACTGACAAAGGTTCAGG - Intronic
1155807220 18:30186747-30186769 CAGAACAGTGACAAAACTTCTGG + Intergenic
1156659179 18:39326460-39326482 CAGACCATTGAAAAATGGTCTGG + Intergenic
1156680382 18:39581359-39581381 CAAAACACTCAGAAATATTCTGG - Intergenic
1158864269 18:61622611-61622633 CAGAATAGAGAAAAATGTTCAGG + Intergenic
1163287283 19:16356628-16356650 CAGAACACTGACAAAAGGTGTGG + Intronic
1164562917 19:29306007-29306029 CACATCTCTGAGAAATGCTCTGG + Intergenic
1165190616 19:34059915-34059937 CAGAATACTAAGAAATGATTAGG + Intergenic
1165535953 19:36444869-36444891 CAGAACTCTAATAAATTTTCAGG + Intergenic
926053374 2:9758697-9758719 CATAAAAATGAGAAATGTTATGG + Intergenic
926803818 2:16686157-16686179 CAGAACCCTCAGAGAGGTTCAGG + Intergenic
927029647 2:19107162-19107184 GGGAACACAGAGAAATGGTCTGG + Intergenic
928354853 2:30602391-30602413 GAGAACTTTGAGAAATTTTCAGG + Intronic
928624871 2:33129286-33129308 CGGAACACCCAGAAAAGTTCAGG + Intronic
928719784 2:34106611-34106633 CAGAACACAGAGAATTTTTAGGG - Intergenic
928975327 2:37081077-37081099 CAGAATACTGACCACTGTTCTGG + Intronic
929398251 2:41548620-41548642 CAGAACCCTGAAAAATCATCAGG + Intergenic
931656510 2:64513510-64513532 CATTACAATGAAAAATGTTCTGG + Intergenic
933069734 2:77842263-77842285 CAGTAGACTGGGAAAGGTTCGGG + Intergenic
935085592 2:99841547-99841569 CAGAACACTGAGAAATGTTCTGG + Intronic
935198226 2:100833500-100833522 GAGAACACTGGGATATGTTGGGG - Intronic
937189145 2:120077006-120077028 CTGAACTCTGAGACAAGTTCAGG - Exonic
939456254 2:142440615-142440637 TAGAAGACTGAAAATTGTTCTGG - Intergenic
940508124 2:154581832-154581854 CACAACACTGAAAAATATTGAGG - Intergenic
941044111 2:160653241-160653263 CAGCTCTCTGAGAAATGGTCAGG - Intergenic
942795986 2:179819617-179819639 CAGAACACTGTGAGGTGCTCAGG + Intronic
945520712 2:210823964-210823986 CAGAACACTGAGAAAGAGTCTGG + Intergenic
945559235 2:211317785-211317807 CAAAACACTAAGAAATTTCCAGG + Intergenic
945633663 2:212318944-212318966 GAGAACACTGAAAAATGGTGAGG - Intronic
945691754 2:213045175-213045197 CAGAAAACTGAAAGATGTTAGGG + Intronic
948448514 2:238052921-238052943 CAGAATACTGAAAACTGTTCAGG + Intronic
1169187646 20:3632128-3632150 CAGAACCCTGAGATATCTACCGG - Intronic
1169677651 20:8172704-8172726 AAGAACAAAGAAAAATGTTCAGG - Intronic
1173333145 20:42092324-42092346 CAGAATTCTCAGAAATGTTGGGG + Intronic
1173461210 20:43244809-43244831 GGGGACACTCAGAAATGTTCAGG - Intergenic
1174540785 20:51287723-51287745 AAGAACCCTGAGATATGATCAGG + Intergenic
1176841035 21:13843753-13843775 CAGAAACCTGAGAAATGTGGAGG + Intergenic
1178724284 21:35037322-35037344 CAGAACTGAGAGAGATGTTCAGG - Intronic
1180914330 22:19474762-19474784 CAGAATACTGAGAACAGTTGGGG + Intronic
1181772062 22:25132725-25132747 AAGAACTCTGGGAAATGTCCAGG - Intronic
950274803 3:11650906-11650928 TAGTACACTGAGGAATGTGCTGG - Intronic
952167978 3:30772394-30772416 CAGAATACTGAGTAATGATGGGG + Intronic
952447963 3:33401734-33401756 CAGAACACTTAGAACAGTGCTGG + Intronic
953183454 3:40617348-40617370 CAGAACACTGCCAAAGGCTCTGG - Intergenic
953848991 3:46450818-46450840 CAGAACACTCAGAAAGGTAAAGG + Intronic
954040408 3:47882479-47882501 TAGAATTCTAAGAAATGTTCAGG - Intronic
956556557 3:70529888-70529910 AAGATCACTGATAAATGTACTGG - Intergenic
957758823 3:84527863-84527885 GAGGACACTGAGCAATCTTCAGG + Intergenic
958712808 3:97738899-97738921 GAGAACGCTGATAAAGGTTCAGG - Intronic
959406284 3:105965665-105965687 CAGTAGATTGAGAAATTTTCAGG + Intergenic
960536069 3:118815771-118815793 CAGACCACTGAGCAATGTAATGG + Intergenic
960679099 3:120228212-120228234 CACAACCCTGAGAAATGGCCTGG - Intronic
961134158 3:124494639-124494661 CAGTTGACTTAGAAATGTTCTGG + Intronic
962464949 3:135649355-135649377 CAGTAAACAGAGAGATGTTCAGG + Intergenic
963254133 3:143127878-143127900 GAGAACACTCAGAACTGATCCGG + Intergenic
964188835 3:153979200-153979222 AGGAACACTTAGAAATGTTTAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
970425492 4:15941947-15941969 CAGAACACAGAGAATTTTTAGGG - Intergenic
972062156 4:34889189-34889211 AAGATAACTGAGAAATGTACTGG + Intergenic
973565858 4:52186741-52186763 ATGAACACTAAGAAATCTTCTGG + Intergenic
973647444 4:52964113-52964135 CAGGCCACTTAGCAATGTTCTGG + Intronic
974494591 4:62609963-62609985 GAGAAGAATGAGAAATGTTGAGG + Intergenic
974835789 4:67249156-67249178 CACAACTCTGAGAAACGTTCAGG + Intergenic
975362260 4:73484873-73484895 CCCAACACTGAGAAAATTTCTGG + Intronic
979101613 4:116623699-116623721 CAGATCAGTGAGAAATCTGCAGG + Intergenic
979542866 4:121906181-121906203 ACTGACACTGAGAAATGTTCAGG + Intronic
980257568 4:130402331-130402353 CACCACACTGTGAAATGCTCTGG - Intergenic
981298540 4:143160631-143160653 CTCAACCTTGAGAAATGTTCTGG - Intergenic
981858927 4:149330865-149330887 TAGAACATAGAGGAATGTTCTGG - Intergenic
981961101 4:150539711-150539733 TAGCACACTGAGTAGTGTTCAGG - Intronic
981969565 4:150650973-150650995 CAGAACACTAAGAAAATTTGTGG + Intronic
983129281 4:163995214-163995236 CAGAACTCAGGGAAATATTCAGG + Intronic
983606478 4:169591915-169591937 CAAATCACTGAGAAAAGTACTGG + Intronic
984331474 4:178325849-178325871 CAGAACCCTGATAAATTTTTAGG + Intergenic
984376408 4:178936687-178936709 AAGAACACTGAGAAATTCTGAGG - Intergenic
985326688 4:188778519-188778541 AAGAACAGTGAGAAATGGTGCGG + Intergenic
987245477 5:16043904-16043926 CACATCACTGAGCAATGCTCTGG + Intergenic
987251355 5:16104339-16104361 TAAAACAATGAGAAATGTTTTGG + Intronic
988338806 5:29942126-29942148 AACAAAACTGAGAAATGTTAAGG + Intergenic
988394671 5:30681233-30681255 TAGAACATGGAGAAATGTTACGG - Intergenic
988734980 5:34011459-34011481 CAAAACAATGATAAATGTTCTGG + Intronic
988976425 5:36521112-36521134 CAGTCTAGTGAGAAATGTTCTGG + Intergenic
990055317 5:51569820-51569842 CACAACAGTAAGAAATGATCAGG + Intergenic
990495472 5:56343498-56343520 CAAAATACTGAGAAATGTCCGGG - Intergenic
990945592 5:61245857-61245879 CAGAAGACTGAGAAATTCTCTGG + Intergenic
994091629 5:95814729-95814751 CAGAAGACTGTGACAAGTTCTGG - Exonic
994188342 5:96839886-96839908 CAGAGACCTGAGAAATATTCTGG - Intronic
996073331 5:119159973-119159995 CAGAAAACTGGAAAGTGTTCAGG + Intronic
997145670 5:131430396-131430418 GAGTATACTGAAAAATGTTCTGG + Intronic
997243321 5:132324567-132324589 AAGACCACTGGTAAATGTTCAGG - Intronic
997386166 5:133474445-133474467 CAGTGCACTGAGAAATGCACAGG + Intronic
997531237 5:134582554-134582576 CAAACCACTGAAAAATGATCTGG + Exonic
998632120 5:143910719-143910741 CAGAGCAGTGAGAAAGGTTCAGG + Intergenic
999564683 5:152844531-152844553 CAGAACACAGAGAATTTTTAGGG - Intergenic
1000296914 5:159920200-159920222 AAGGAAACTGAGAAATTTTCTGG - Intronic
1000479241 5:161751212-161751234 CAGAAGACTGTGACAAGTTCTGG - Intergenic
1001169832 5:169408681-169408703 CAGGAGACAGAGAGATGTTCAGG + Intergenic
1001741203 5:174054262-174054284 CAGAAAACTGTTAAATGTTAGGG + Intronic
1004797131 6:19099256-19099278 CACAACACTGAAAAATGACCAGG + Intergenic
1004979083 6:21002624-21002646 CAGATGACTGAGAAAACTTCAGG + Intronic
1007830589 6:44635376-44635398 CAGAACACTGAGGATTTTTAGGG - Intergenic
1010069366 6:71725387-71725409 CAAATCCCTAAGAAATGTTCAGG - Intergenic
1010231605 6:73540018-73540040 CATGACAATAAGAAATGTTCAGG - Intergenic
1010266316 6:73872198-73872220 CCGCACACTTAGAAATGTTTGGG - Intergenic
1011557040 6:88581434-88581456 CAGAATACTAAAAATTGTTCTGG - Intergenic
1012941879 6:105424128-105424150 CAAAACACACAGAAATGATCAGG - Intergenic
1012963620 6:105648692-105648714 CAGAAAAGTGAGAAATCATCTGG - Intergenic
1015730410 6:136341146-136341168 AAGCCCACTCAGAAATGTTCTGG - Intergenic
1015829563 6:137353405-137353427 TTGAACACTGAAAAATGTTAAGG - Intergenic
1017227122 6:152034597-152034619 CAGAAAACTCAGAAATGATATGG - Intronic
1019231076 6:170563938-170563960 AAGAACACTGAGAAATGAAAAGG + Intronic
1021829477 7:24589928-24589950 CTAAACACTGAGTAGTGTTCAGG - Intronic
1022106975 7:27203678-27203700 TGGAACACTGAGAAAGGCTCTGG - Intergenic
1022477639 7:30722249-30722271 CAGAAGACTGGAAAATGCTCTGG + Intronic
1024099191 7:46011639-46011661 CAAAATACTGAGAAATAGTCAGG + Intergenic
1024610968 7:51063833-51063855 TAGAACATTTAGAAATGTTTCGG - Intronic
1024716044 7:52080249-52080271 CAGACAGGTGAGAAATGTTCAGG + Intergenic
1025966825 7:66280925-66280947 CAGAACATGCTGAAATGTTCTGG - Intronic
1026403224 7:70037750-70037772 GAGAAAACTGAGACATGTCCAGG - Intronic
1027876964 7:83783105-83783127 CAGAAAACTGAGAAATTCTTGGG - Intergenic
1029306834 7:99625756-99625778 CAGAACAGTCAGAAATGGCCAGG - Intronic
1029742034 7:102496421-102496443 CAGAACACTGGGAGGTGTTTGGG - Intronic
1029760023 7:102595586-102595608 CAGAACACTGGGAGGTGTTTGGG - Intronic
1031267204 7:119596129-119596151 CAAGACACTAAGAAATGTTTTGG + Intergenic
1031584872 7:123522102-123522124 CAGAACCCTGAGAAATGGTCTGG - Intronic
1031833643 7:126656253-126656275 CAAAACAGTGAGAAATGTGAAGG + Intronic
1032065802 7:128769568-128769590 GAGATCAATAAGAAATGTTCAGG + Exonic
1032102361 7:128992606-128992628 CAGAATACTCAGAGATGTTCTGG + Intronic
1034037497 7:147839676-147839698 CAGTTCATTGAGAAATCTTCAGG - Intronic
1035859899 8:3016829-3016851 CATAGCACTGAGACATGTTTGGG + Intronic
1035884957 8:3281694-3281716 CAGAACACAGGGAATTGTTAGGG + Intronic
1035990459 8:4484299-4484321 CAGATAACTTAGAAATGATCAGG - Intronic
1037690129 8:21174572-21174594 CAGAGGACTGAGAAAAGTCCAGG + Intergenic
1037932287 8:22888720-22888742 CAGAACACTGAGATTTGATGGGG - Intronic
1038693415 8:29783371-29783393 CCGAACACTAAGAAATATTAGGG - Intergenic
1039165191 8:34671153-34671175 CAGAACACAGAGGAATTTTCGGG - Intergenic
1039553970 8:38463734-38463756 AAGAACCCTGAGAAAATTTCTGG + Intronic
1041643409 8:60226963-60226985 CTAAACACTGAAAAATGTTGTGG - Intronic
1041894278 8:62905942-62905964 CACAACGCTGAGAAATTCTCAGG - Intronic
1042657182 8:71112573-71112595 CAGACGACAGACAAATGTTCAGG - Intergenic
1045139225 8:99261250-99261272 TAGAACACAGAGAAATTTTAGGG - Intronic
1046125095 8:109896659-109896681 AAGAACATTTAGAAATGATCAGG - Intergenic
1048232927 8:132661281-132661303 CACTACACACAGAAATGTTCAGG + Intronic
1049940721 9:543911-543933 CAAAAAACTGAGAAATTATCAGG - Intronic
1050132419 9:2426574-2426596 CAGTACACAGAGAAATGTGCTGG - Intergenic
1051472738 9:17467229-17467251 CTGAACACTGAGCAAGTTTCTGG - Intronic
1052105076 9:24504508-24504530 CAGAACTGTGCCAAATGTTCTGG + Intergenic
1052481054 9:29026768-29026790 CAGAACAATGAAAAATGTAATGG - Intergenic
1052738602 9:32371818-32371840 CACAACCCTGAGAAATGGCCTGG + Intergenic
1054789489 9:69242328-69242350 CACAACGCTGGGAAATGTTCAGG - Intronic
1055806230 9:80096610-80096632 CAGAACACTGAACCATGTGCAGG + Intergenic
1056253782 9:84777585-84777607 TAGTATGCTGAGAAATGTTCAGG + Intronic
1056321547 9:85439981-85440003 CACAACACGTAGAAATATTCTGG + Intergenic
1058014987 9:100021160-100021182 CACAACTCTGAGAAATGGCCTGG - Intronic
1058071517 9:100605430-100605452 AAGAACACTAAGAAATGGTAAGG - Intergenic
1059603758 9:115810652-115810674 CAGAGCACAGAGAATTGTTAGGG + Intergenic
1059967953 9:119634639-119634661 CAGAACTCTAAAAAATCTTCTGG - Intergenic
1060239330 9:121889472-121889494 GAGAACTATGAGAAAAGTTCTGG - Intronic
1061323801 9:129849778-129849800 CAGAACTGTGTGAAATGCTCTGG + Intronic
1203494549 Un_GL000224v1:138756-138778 CAGAACCCACAGAAGTGTTCTGG - Intergenic
1203507168 Un_KI270741v1:80631-80653 CAGAACCCACAGAAGTGTTCTGG - Intergenic
1185985752 X:4831151-4831173 GAGAAGGCTGAAAAATGTTCTGG + Intergenic
1186756879 X:12680557-12680579 CATAAAACTGACAAATGTTTTGG - Intronic
1189022622 X:37357037-37357059 CAGAACACAGAGAATTTTTGGGG - Intronic
1190369531 X:49727467-49727489 CAGAAGACAGAGAAATGATGGGG + Intergenic
1197585227 X:128338603-128338625 CAGTTCTCTGAGAAATGCTCAGG + Intergenic
1199726848 X:150591905-150591927 CAGAACACTAAGTAATGCTTTGG - Intronic
1200291304 X:154877183-154877205 CATAACACAGTCAAATGTTCTGG - Intronic