ID: 935088416

View in Genome Browser
Species Human (GRCh38)
Location 2:99870510-99870532
Sequence CTGCATGGGTAGATCCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935088416_935088420 0 Left 935088416 2:99870510-99870532 CCCTGCTGGATCTACCCATGCAG 0: 1
1: 0
2: 2
3: 14
4: 218
Right 935088420 2:99870533-99870555 ACCCCACCCCTGTGATCTCCTGG 0: 1
1: 0
2: 1
3: 21
4: 199
935088416_935088428 21 Left 935088416 2:99870510-99870532 CCCTGCTGGATCTACCCATGCAG 0: 1
1: 0
2: 2
3: 14
4: 218
Right 935088428 2:99870554-99870576 GGAGAGCTACTTCCTAGATAAGG 0: 1
1: 0
2: 2
3: 8
4: 100
935088416_935088429 24 Left 935088416 2:99870510-99870532 CCCTGCTGGATCTACCCATGCAG 0: 1
1: 0
2: 2
3: 14
4: 218
Right 935088429 2:99870557-99870579 GAGCTACTTCCTAGATAAGGAGG 0: 1
1: 0
2: 1
3: 23
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935088416 Original CRISPR CTGCATGGGTAGATCCAGCA GGG (reversed) Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
906058062 1:42931207-42931229 CTGCAGGGGGAGATGCAGCCTGG + Intronic
908382456 1:63609491-63609513 CTCCATGGGTAGTTACAACAGGG + Intronic
908648489 1:66305983-66306005 CTGAGTAGGGAGATCCAGCATGG + Intronic
909023696 1:70460304-70460326 CTGCAGGGGTAGAGCCCTCATGG + Intergenic
911376392 1:97056841-97056863 CTGCATGGGTGGAGCCCTCAAGG + Intergenic
912820383 1:112863003-112863025 CTGAATGGGGATACCCAGCAAGG - Intergenic
913094488 1:115503424-115503446 CTGCATGGGTGGAGCCCTCATGG + Intergenic
915910337 1:159910959-159910981 CAGCATGGGGAGGCCCAGCAGGG + Intergenic
916296749 1:163228219-163228241 CTGCAGGGGCAGAGCCATCATGG - Intronic
916948872 1:169758751-169758773 CTGCAGGGGTAGAACCCTCATGG - Intronic
919027908 1:192201486-192201508 CTGCATGGGCGGAGCCCGCATGG - Intergenic
919277468 1:195439641-195439663 CTGCATGGGCAGAGCCCTCATGG - Intergenic
919669145 1:200322898-200322920 CTTCATGGTTAGAAGCAGCAGGG - Intergenic
921051229 1:211513271-211513293 CTGCATGGTGAGAAGCAGCATGG - Intergenic
921723146 1:218495662-218495684 CTGAGTGGGGAAATCCAGCAAGG + Intergenic
922423032 1:225471960-225471982 CGGCATGGGCAGACCTAGCAGGG + Intergenic
923491275 1:234486134-234486156 CTGGATGGGAACGTCCAGCAGGG + Intergenic
923851664 1:237802891-237802913 GGGCATGGATAGATCCAGGATGG + Intronic
924885244 1:248208858-248208880 TTGGATGTTTAGATCCAGCAAGG + Intergenic
1062972456 10:1659666-1659688 CTGCAGGGGTAGCTCCTGCTGGG + Intronic
1068155149 10:53188275-53188297 CTGCAGGGGTAGAGCCCTCATGG + Intergenic
1068395536 10:56456819-56456841 CAGCATGGGTAGCACCTGCAAGG + Intergenic
1069756441 10:70776778-70776800 CTGCATGGCTAGGCCCAGCCTGG - Intronic
1071076295 10:81757081-81757103 CTGAATGGGAAAATCCAGTAAGG - Intergenic
1072491306 10:95908133-95908155 CTGCATGGGCAGAACTAGCTGGG + Intronic
1074260502 10:111848689-111848711 CTGCAGGGGTGGATCCTTCATGG + Intergenic
1075566229 10:123506440-123506462 CTGCATGGGAAGATGCAGGAAGG - Intergenic
1078257626 11:9673591-9673613 CTGAGTGGGAAAATCCAGCAAGG + Intronic
1079302266 11:19288450-19288472 CTGGATGGGTAGAGCCAGATGGG + Intergenic
1079445872 11:20555722-20555744 CTGCAGGGGTGGATCCCTCATGG - Intergenic
1079633992 11:22712423-22712445 CTGGGTGGCTAGATCCAGAAGGG + Intronic
1079676423 11:23232536-23232558 CTGAGTGGGAAAATCCAGCAAGG + Intergenic
1081388744 11:42503809-42503831 CTGCAGGGGTAGAACCCTCATGG - Intergenic
1088837489 11:113590096-113590118 CTCCATGGGTAGGTACAGCTGGG + Intergenic
1090098907 11:123773232-123773254 CTGAGTGGGGAAATCCAGCAAGG + Intergenic
1090978677 11:131697332-131697354 CTGCAACGGTAGATCAAGTAAGG - Intronic
1094379851 12:29831082-29831104 CTGCAGGGGTGGAACCATCATGG - Intergenic
1095489103 12:42714457-42714479 CTCCATTAGTAGATCCATCAGGG - Intergenic
1095640875 12:44483536-44483558 CTGCAGGGGCAGATCCCTCATGG - Intergenic
1095704584 12:45222858-45222880 CTGAATGGGGAAACCCAGCAAGG - Intronic
1097355919 12:58601649-58601671 ATGCATGTGGAAATCCAGCATGG - Intronic
1097356027 12:58602952-58602974 ATGCATGTGGAAATCCAGCAAGG + Intronic
1099415149 12:82375324-82375346 CTGCATGTGAAGATGTAGCAAGG + Intronic
1099669696 12:85674261-85674283 CTGCAGGGGTAGAGCCCTCATGG - Intergenic
1099813386 12:87614641-87614663 CTTCATGGGAAGATCCATCATGG + Intergenic
1100368505 12:93943501-93943523 CTGAGTGGGGAGACCCAGCAAGG - Intergenic
1102169012 12:110827865-110827887 CAGGATGGGGAGAGCCAGCAGGG + Intergenic
1102532388 12:113556138-113556160 CTGCATGGGGAGGTCCAAGAAGG + Intergenic
1104450246 12:128863230-128863252 CTGCTTGGGGAGGCCCAGCAAGG + Intronic
1106127306 13:26911017-26911039 CTGCATTGTTAGATCAAGCCTGG - Intergenic
1106844617 13:33724979-33725001 CTGCATGGCCAGCCCCAGCAAGG - Intergenic
1108277533 13:48826302-48826324 CTGCAGGGGTAGAGCCACCATGG - Intergenic
1108885684 13:55178519-55178541 CTGCAGGGGTAGAGCCCTCATGG + Intergenic
1109484649 13:63002436-63002458 CTGAGTGGCTAGATCCAGAAGGG + Intergenic
1109616221 13:64837251-64837273 CTGCAGGGGCAGAGCCATCATGG + Intergenic
1111318072 13:86586683-86586705 CTGCAGGGGTAGAGCCCTCATGG + Intergenic
1111334570 13:86803112-86803134 CTGCAGGGGCAGAGCCTGCATGG - Intergenic
1112163040 13:96889039-96889061 CTGCAGGGGCAGATCCCTCATGG - Intergenic
1112826583 13:103398675-103398697 CTGCAGGGGTAGAGCCCTCATGG - Intergenic
1113683711 13:112262996-112263018 CTAGATGGGTAGTTCCAGCTTGG + Intergenic
1114243482 14:20891326-20891348 CTGCATGGCCAGACCCACCAAGG + Intergenic
1116161160 14:41268246-41268268 CTGCATGGGTATATCTATCCTGG + Intergenic
1116566515 14:46451273-46451295 CAGCATGGGTAGATTCACCTGGG - Intergenic
1117112835 14:52476051-52476073 CTGGGTGGCTAGATCCAGAAGGG + Intronic
1119350353 14:73959554-73959576 CTGCAGGGGGAGATACAGAAAGG + Intronic
1120280142 14:82428925-82428947 CTGAGTGGGGAAATCCAGCAAGG - Intergenic
1120933785 14:89874036-89874058 CTGCAGGGGTAGAGCCCTCATGG - Intronic
1121237928 14:92406475-92406497 CTGCAGGGGTAGAGCCCTCATGG - Intronic
1122821182 14:104345973-104345995 CTGGATGGGCAGCCCCAGCAGGG - Intergenic
1126256093 15:46627404-46627426 CTGCAGGGGTAGAGCCCTCATGG + Intergenic
1126533240 15:49733181-49733203 CTGCAGGGGCAGAGCCATCATGG - Intergenic
1128320688 15:66691762-66691784 CTGCAGGGGTGGATCCAGGCTGG + Intergenic
1132971514 16:2691548-2691570 CAGCCTGGGTAGGTCCTGCATGG + Intronic
1133468122 16:6047541-6047563 CAGCAAGGGCAGAGCCAGCAGGG + Intronic
1134462991 16:14446080-14446102 CTGCAGGGGGCGGTCCAGCAAGG - Intronic
1136642388 16:31577869-31577891 CTGCAGGGGTAGAGCCCTCATGG + Intergenic
1137265848 16:46868376-46868398 CTGCAGGGGTAGAGCCCTCATGG - Intergenic
1137445678 16:48530603-48530625 CTGCACAGGCAGATGCAGCAAGG - Intergenic
1140854391 16:78965045-78965067 CTGCATGGGTGGAGCCCTCATGG + Intronic
1142257997 16:89024529-89024551 CTGCAGGGGTGGCTCCAGGAGGG + Intergenic
1142305034 16:89280110-89280132 CTGCAGGGGAAGCTCCGGCAGGG + Exonic
1145056734 17:19708007-19708029 CTGCCTTGGTAGAGCCACCATGG - Intronic
1147246611 17:39125268-39125290 CTGCAAGGGGAGATCCAGGCTGG + Intronic
1149589272 17:57816529-57816551 TTCCATGGGTAGAACCAGCCTGG - Intergenic
1150281350 17:63931214-63931236 CTGGATGGGGAGATCAGGCAAGG + Intronic
1151789124 17:76292796-76292818 CAGCATGGTTTGATCCAGCCTGG - Exonic
1152982867 18:295431-295453 CGGCATGGTCAGTTCCAGCATGG + Intergenic
1155340138 18:24805422-24805444 CTGAGTGGGGAGACCCAGCAAGG - Intergenic
1157040028 18:44027745-44027767 CTGCATGGGTGGAACCCTCATGG - Intergenic
1157055872 18:44227918-44227940 CTGCAATGGGAAATCCAGCATGG + Intergenic
1161457455 19:4376690-4376712 CAGCATGGGAAGATCCAGGGAGG - Intronic
1168320817 19:55508573-55508595 CTCCAAGGCTAGAGCCAGCAAGG - Intronic
925814299 2:7732657-7732679 GTGCATGGGTCAGTCCAGCAGGG + Intergenic
930439604 2:51390036-51390058 CAGCATGTTTAGATCCAGCCAGG - Intergenic
931679090 2:64728300-64728322 TTGCATGGGCAGCTCCAGCAAGG + Intronic
931848173 2:66225923-66225945 CTGGATGAGTAGATACAGCCGGG + Intergenic
932827673 2:74956704-74956726 CTGAATGGGGAAACCCAGCAAGG - Intergenic
933181317 2:79230522-79230544 CTGCAGGGGTAGAGCCCTCATGG + Intronic
933324238 2:80815418-80815440 CTACCTGGGAAGATCCAGCTTGG + Intergenic
935088416 2:99870510-99870532 CTGCATGGGTAGATCCAGCAGGG - Intronic
935418881 2:102846151-102846173 CTGGATGGTGAGTTCCAGCAGGG - Intergenic
938718152 2:134039796-134039818 CTGCAGGGGTAGAGCCTTCATGG - Intergenic
939703257 2:145420413-145420435 CTGCAAGGGTAGAGCCTTCATGG - Intergenic
940121917 2:150276740-150276762 CTGCATGGGTGGAGCCTTCATGG - Intergenic
940175096 2:150870127-150870149 CTGAATGGGGAAACCCAGCAAGG + Intergenic
941977747 2:171424217-171424239 CTGCATGGGTGGAGCCCTCATGG + Intronic
942397907 2:175571075-175571097 TTGCATGGGTAGATTCATAAGGG + Intergenic
945218493 2:207460556-207460578 CTGCAGGGGAAAACCCAGCAAGG - Intergenic
945979133 2:216295084-216295106 ATGCATGGGGTGATACAGCATGG + Intronic
946515380 2:220405510-220405532 CTGCAGGGGTAGAGCCCTCATGG - Intergenic
947464746 2:230332808-230332830 CAGAATGGGTAGCTCCAGAAGGG - Intronic
948088456 2:235270124-235270146 AGGCCTGGGTAAATCCAGCAAGG + Intergenic
948930042 2:241126240-241126262 CTGCAGCGGGAGATCCAGGAGGG - Exonic
1170201529 20:13749532-13749554 CTGAATGGGTAGATTGAGCAAGG + Intronic
1170337080 20:15281878-15281900 CTGCAGGGGTAGAGCCCTCATGG - Intronic
1170822622 20:19767224-19767246 CTGCTTGGGGAGATCCAGCAAGG + Intergenic
1175056733 20:56205549-56205571 CTGCATGGGAAAATCCAGCAAGG - Intergenic
1177206449 21:18016550-18016572 CTGCAGGGGTAGAGCCCTCATGG + Intronic
1177212044 21:18083335-18083357 CTGCAGGGGTAGAACCTTCATGG + Intronic
1177303198 21:19277304-19277326 CTGAGTGGGAAAATCCAGCAAGG + Intergenic
1177632565 21:23746445-23746467 CTGCAGGGGCAGATCCTTCATGG - Intergenic
1177722678 21:24928199-24928221 CTGCATGGGCAGAGCCCTCATGG + Intergenic
1179765921 21:43573119-43573141 CTGCATGGGTAAGCCAAGCATGG + Intronic
1180322162 22:11332102-11332124 CTGCATGGGTGGAGCCCTCATGG - Intergenic
1182242256 22:28925440-28925462 GTGCATGGGTAGAGGCATCATGG - Intronic
1182816821 22:33171764-33171786 CTGCAAGGGTAGAGCCCTCATGG + Intronic
1183812305 22:40267392-40267414 GTCCATGGGTAGAACCAGAATGG - Intronic
1185097762 22:48821049-48821071 CTGCATGTGTGGAGCCAGGATGG - Intronic
953713755 3:45297624-45297646 CTGCGTGGGTAGTACCAGCATGG + Intergenic
955450677 3:59064100-59064122 CTGGGTGGCTAGATCCAGAAGGG - Intergenic
957303134 3:78419843-78419865 CTGAATGGGAAAACCCAGCAAGG + Intergenic
958474937 3:94568901-94568923 CTGCAGGGGCAGATCCTTCATGG + Intergenic
960543965 3:118890919-118890941 CTTCATGGGTGGATCCAGCTTGG - Intergenic
961636095 3:128334049-128334071 CTCCATGGGCAAGTCCAGCAGGG + Intronic
962119196 3:132544283-132544305 CTGCATGGGGAAACCCAGCAAGG + Intergenic
962706989 3:138053108-138053130 CTGCATCTTTACATCCAGCAGGG + Intergenic
962866074 3:139448923-139448945 CTGAATGGGAAAACCCAGCAAGG + Intergenic
963391151 3:144665555-144665577 CTGCAGGGGCAGATCCCTCATGG - Intergenic
963791659 3:149589092-149589114 CTCCTTGGGCAGATCCAGCAGGG + Intronic
964084285 3:152797626-152797648 CTGAGTGGGCAAATCCAGCAAGG + Intergenic
964926419 3:161963721-161963743 CTGCAGGGGTAGAGCCCTCATGG + Intergenic
964974877 3:162606313-162606335 CTGCAGGGGCAGAGCCATCATGG + Intergenic
970130598 4:12865693-12865715 CTGAATGGATGGATCCACCAAGG - Intergenic
971119651 4:23689571-23689593 CTGCATGGGCAGAGCCCTCATGG + Intergenic
971794950 4:31215424-31215446 CTGCCTGGGGATATCCAGGATGG + Intergenic
972832710 4:42832958-42832980 CTGCAGGGGTAGAGCCCTCATGG + Intergenic
973822651 4:54676583-54676605 CTGCATGGGTGGAGGGAGCAGGG + Intronic
973987841 4:56372942-56372964 CTGAGTGGGAAAATCCAGCAAGG + Intronic
974467161 4:62272115-62272137 CTGAATGGGGAAACCCAGCAAGG - Intergenic
974625958 4:64429316-64429338 CTGCAGGGGTAGAGCCCTCATGG + Intergenic
975718256 4:77226717-77226739 CTGGGTGGCTAGACCCAGCAGGG - Intronic
977014058 4:91670368-91670390 CTGCAGGGGTGGAACCATCATGG - Intergenic
981346717 4:143684379-143684401 CTGGGTGGCTAGATCCAGAAGGG + Intronic
982504922 4:156205483-156205505 CTGCATGGGCAGAGCCCTCATGG - Intergenic
982927243 4:161353755-161353777 CAGCATGGGTAGACCTTGCAAGG - Intergenic
984318557 4:178161223-178161245 CTGCATGGGTGGAGCCCTCATGG - Intergenic
984699803 4:182811578-182811600 CTGCAGGGGTAGAGCCTTCATGG - Intergenic
987282563 5:16425943-16425965 CTGCATGTGTGAATCCAGCTGGG - Intergenic
987744105 5:21948096-21948118 CTGCAGGGGTGGAGCCATCATGG + Intronic
988272320 5:29032822-29032844 CTGCAGGTGTAGATCCCTCATGG - Intergenic
988720135 5:33869396-33869418 CTGCAGGGGTAGAGCCCTCATGG + Intronic
989144487 5:38235192-38235214 CTGCAGGGGTAGAGCCCTCATGG + Intergenic
991136261 5:63185838-63185860 CTGCAGGGGTAGAGCCCTCATGG + Intergenic
992188317 5:74265374-74265396 CAGCATGGGTAGACCTAGTAAGG + Intergenic
995608123 5:113880151-113880173 CTGCAGGGGTAGAGCCCTCATGG + Intergenic
995702839 5:114955321-114955343 CTGCAGGGGTAGAACCCTCATGG + Intergenic
996542765 5:124647607-124647629 CTGCATGTGTTGACCCAGAATGG - Exonic
997486442 5:134234859-134234881 ATTCATGGGTAGGTTCAGCAGGG + Intergenic
1000515465 5:162232901-162232923 CTGCAGGGGTGGATCCCTCATGG + Intergenic
1000781056 5:165481777-165481799 CTGCATGAATAGATCATGCATGG - Intergenic
1000933913 5:167285131-167285153 CTGCTTTTGGAGATCCAGCATGG + Intronic
1002081277 5:176739051-176739073 CGCCAGGGGTAGAGCCAGCAGGG - Intergenic
1006852098 6:37106042-37106064 CAGCATGGGTAGAGGCAGGAAGG + Intergenic
1006936466 6:37722205-37722227 ATGCATGTGTAGTCCCAGCATGG - Intergenic
1008952442 6:57175564-57175586 CTGAATGGGGAAACCCAGCAAGG - Intronic
1010892286 6:81327978-81328000 ATGCATTTGTAGATCAAGCATGG - Intergenic
1012125264 6:95420678-95420700 CTGCAGGGGCAGATCCCTCATGG - Intergenic
1012499413 6:99872410-99872432 CAGTATGGGTAGAGCCAGTAAGG - Intergenic
1013913690 6:115309778-115309800 CTGGGTGGCTAGATCCAGAAGGG - Intergenic
1013928617 6:115502888-115502910 CTGCAGGGGTGGATCCCTCAAGG + Intergenic
1017879942 6:158554683-158554705 CTTCATGGTAAGATCTAGCATGG - Intronic
1019496862 7:1344851-1344873 CTGAGTGGGTGGACCCAGCAGGG + Intergenic
1021073628 7:16273805-16273827 CTCCATGGCTACATCTAGCAGGG - Intronic
1023348317 7:39293917-39293939 CTGGATGGGGAGGTCCAGCTTGG + Intronic
1026614070 7:71886237-71886259 CTTCATTGTTAAATCCAGCAGGG + Intronic
1029961471 7:104692765-104692787 CTGCAGGGGTGGATCCCTCATGG + Intronic
1030173293 7:106626426-106626448 CTGCATTGGTTGTTCCAGCAAGG - Intergenic
1030459069 7:109808160-109808182 CTGCAGGGGTAGAGCCCTCATGG + Intergenic
1031806810 7:126316997-126317019 CTGCAGGGGTAGAGCCCTCATGG - Intergenic
1032922557 7:136566567-136566589 CTGGGTGGCTAGATCCAGAAGGG - Intergenic
1033672913 7:143510845-143510867 CTGCATGGGGAAAGCCAACAAGG - Intergenic
1033712866 7:143966850-143966872 CTGCATGTGTTCATCCATCAAGG + Intergenic
1033721106 7:144060328-144060350 CTGCAGGGGCAGATCCCTCATGG + Intergenic
1034742927 7:153495257-153495279 CTGCAGGGGTGGAGCCTGCATGG + Intergenic
1036190856 8:6669678-6669700 TTCCATGGGTAGCTTCAGCAGGG + Intergenic
1037819611 8:22129349-22129371 CTGCATGTGGAGAGGCAGCATGG - Intronic
1038132402 8:24747495-24747517 CTTCAAGAGTAGATCCAGCCTGG + Intergenic
1039903048 8:41766940-41766962 CTGGCCGGGTAGATTCAGCAGGG - Intronic
1041430681 8:57777838-57777860 CTGCATGGGTGGAGCCCACATGG + Intergenic
1041869642 8:62618378-62618400 CTTCATGAGTCGATCCAGCAGGG + Intronic
1042867281 8:73366934-73366956 CTGCATGGCTCGATCCTGCTAGG - Intergenic
1043883878 8:85575708-85575730 AGGCAGGGGCAGATCCAGCAGGG + Intergenic
1044326922 8:90869226-90869248 CTGCAGGGGTAGAACCCTCATGG + Intronic
1044581454 8:93830075-93830097 CTGAGTGGGGAGACCCAGCAAGG - Intergenic
1047592087 8:126337059-126337081 CTGGGTGGCTAGATCCAGAAGGG + Intergenic
1048038993 8:130706917-130706939 CTGCATGGGCAGAGCCCCCATGG - Intergenic
1048989485 8:139752914-139752936 ATGCATGGGTAGATGCTGGATGG - Intronic
1050915210 9:11122585-11122607 CTGCATGGGCAGAGCCCTCATGG - Intergenic
1054846630 9:69805557-69805579 CTCCTTGGGTAGATCAAACAGGG + Intergenic
1055739314 9:79368515-79368537 CAGCATGGGTACATCAAACAAGG - Intergenic
1056236296 9:84598083-84598105 ATGCATGGCTAGAACCATCATGG - Intergenic
1058288559 9:103209919-103209941 CTGCATGAGCAGAGCCATCATGG - Intergenic
1059045488 9:110861830-110861852 CTGCATGGGTGGAGCCCTCATGG + Intergenic
1059570637 9:115430763-115430785 CTGCCTGGGTAGATACAGGAGGG + Intergenic
1060532348 9:124355250-124355272 CTGCTTGGGAAGAATCAGCAAGG - Intronic
1060806498 9:126580872-126580894 CTACCTGGGTAGATCCAAAACGG - Intergenic
1061918451 9:133769350-133769372 CTGCCTTGGGAGACCCAGCACGG - Intronic
1062609171 9:137366216-137366238 CTGCATGAGAAGAGCCACCACGG + Intronic
1185491893 X:524209-524231 CTGCATGGATGCACCCAGCATGG - Intergenic
1188833393 X:34928351-34928373 CTGCATGGGCAGAGCCTTCATGG - Intergenic
1193506222 X:82348021-82348043 CTGCATGGGTGGATCCCTCATGG - Intergenic
1193678214 X:84483295-84483317 CTGCATGGGTGGAGCCCTCATGG - Intronic
1193795304 X:85866441-85866463 CTGCAGGGGTAGAGCCCTCATGG + Intronic
1194328889 X:92556827-92556849 CTGCATGGGTGGAGCCCTCATGG - Intronic
1194805929 X:98328180-98328202 CTGAGTGGGGAAATCCAGCAAGG + Intergenic
1194982337 X:100453350-100453372 CTGCAGGGGTGGAGCCATCATGG + Intergenic
1195507992 X:105681009-105681031 TTGCGTGGGGGGATCCAGCAAGG + Intronic
1195654150 X:107318787-107318809 TTGCATTGGTAGAACCATCATGG - Intergenic
1197366758 X:125572969-125572991 CTGCAGGGGTAGAGCCCTCATGG - Intergenic
1198836083 X:140806045-140806067 CTGCAGGGGTAGAGCCCTCATGG - Intergenic
1198873749 X:141201970-141201992 CTGCAGGGGTGGATCCCTCATGG + Intergenic
1199301713 X:146221072-146221094 CTGCAGTGGTAGATCCTGCATGG - Intergenic
1199909662 X:152272003-152272025 CTGCAGGGGTAGAGCCCTCATGG + Intronic
1200637595 Y:5676029-5676051 CTGCATGGGTGGAGCCCTCATGG - Intronic