ID: 935095006

View in Genome Browser
Species Human (GRCh38)
Location 2:99935864-99935886
Sequence CAGAGTCCCCAGCGACATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935095002_935095006 12 Left 935095002 2:99935829-99935851 CCATTCCACTTAAAGGAGCTAGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 935095006 2:99935864-99935886 CAGAGTCCCCAGCGACATGGAGG 0: 1
1: 0
2: 0
3: 14
4: 147
935095004_935095006 7 Left 935095004 2:99935834-99935856 CCACTTAAAGGAGCTAGGAGAGT 0: 1
1: 0
2: 1
3: 7
4: 111
Right 935095006 2:99935864-99935886 CAGAGTCCCCAGCGACATGGAGG 0: 1
1: 0
2: 0
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935095006 Original CRISPR CAGAGTCCCCAGCGACATGG AGG Intronic
902434835 1:16391809-16391831 CTGGGTCCCCAGTGACTTGGTGG + Intronic
903747632 1:25598961-25598983 GAGAAGCCCCAGCCACATGGAGG + Intergenic
904368491 1:30033812-30033834 CAGAGTCACCAGTGAGATTGAGG - Intergenic
904478821 1:30781767-30781789 CAGAGTCCCCACCAGCAAGGAGG + Intergenic
906096735 1:43229111-43229133 CAGAGGCCCCACCCACCTGGAGG + Intronic
906419698 1:45654782-45654804 CAGAGTCCACAGAATCATGGCGG + Exonic
912944184 1:114070821-114070843 CAGTGTCCCCAGCTTCATCGGGG + Intergenic
913195176 1:116450362-116450384 CAAAGCACCCAGCAACATGGTGG + Intergenic
919187194 1:194167582-194167604 GAGAGGCCTCAGAGACATGGTGG - Intergenic
919730330 1:200909406-200909428 CAGCTTCCCCAGAGAGATGGGGG + Intronic
920694950 1:208174951-208174973 CAGAGTTCCCAGCACCAGGGAGG - Intronic
924614104 1:245598617-245598639 CAGACACTCCATCGACATGGAGG - Intronic
1064471499 10:15640311-15640333 CAGATTTCCCAGCCACATTGGGG + Intronic
1075091221 10:119445106-119445128 CTGAGGCCCCAGCTGCATGGCGG - Intronic
1075648107 10:124109652-124109674 GAGAGTCCCCAGGGAGTTGGGGG + Intergenic
1076157444 10:128214610-128214632 CGGAGGCCCCAGCGATGTGGGGG + Intergenic
1076193364 10:128498345-128498367 CCCAGTCCCCAGAGACATGTGGG - Intergenic
1076818062 10:132924326-132924348 CAGAGGGCCCAGCGTCAGGGAGG - Intronic
1076824011 10:132958223-132958245 CAGAGACCCCACCCACATCGAGG + Intergenic
1077530036 11:3090745-3090767 CCCAGGCCCCAGGGACATGGTGG + Intronic
1077608259 11:3626774-3626796 CAGAGTGCCCAGCGACTCGTGGG - Intergenic
1077921626 11:6646298-6646320 CAGAGGCCCCAGGGACCTGGAGG - Intronic
1083103673 11:60336495-60336517 CAGACTCACCAGAGACATCGAGG + Intronic
1084407040 11:68980102-68980124 CACAGTCCCCAGGGACCTGGTGG + Exonic
1084421487 11:69062779-69062801 CAGAGACCCCAGTGCCCTGGGGG - Intronic
1084599247 11:70135158-70135180 CAGGGTCCCCAGGGCCAGGGAGG - Intronic
1088110983 11:106260993-106261015 CAGGGTCCCCAGCCTCATAGGGG - Intergenic
1091121556 11:133062143-133062165 CAGAGTCCACAGTGTCAGGGAGG + Intronic
1096384522 12:51186258-51186280 CACAGACCCCAGGGATATGGAGG + Intergenic
1096526009 12:52210910-52210932 CAGAGGCCCCAGGGACCTGTAGG + Intergenic
1097194267 12:57235177-57235199 CTGAGTGCCAAGCGACGTGGCGG - Exonic
1100788456 12:98104170-98104192 CACAGTCCCCACACACATGGAGG - Intergenic
1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG + Intronic
1103926874 12:124427999-124428021 CAGAGTCCTCAGGGACATCAAGG - Intronic
1107389110 13:39944909-39944931 CAGAGTCCCCAGTGATAAAGAGG + Intergenic
1107787479 13:43970432-43970454 CACAGTGCCCAGCGGCACGGAGG - Intergenic
1112446612 13:99470182-99470204 CAGAGCCCCCAGTGGCATTGAGG - Intergenic
1113704571 13:112419311-112419333 CAGAGGCCCCAGGCACAAGGGGG + Intronic
1113708449 13:112448779-112448801 CAGAGACCCCAGGGACGTGGCGG + Intergenic
1114141444 14:19915932-19915954 GAGAGTCCCCAGCTAAATTGGGG + Intergenic
1121753116 14:96375799-96375821 CAGAGTCCCCACCGCCAAGAAGG - Intronic
1122924411 14:104893024-104893046 CACCGTCCCCAGCCACATCGTGG - Exonic
1125523631 15:40361952-40361974 CAGAGTGCCCAGGGCCATGGGGG - Intronic
1127394709 15:58535228-58535250 AGGAGTCCCCAGCCCCATGGTGG - Intronic
1127650767 15:61004454-61004476 CAGAGTCCCAAGGCACATGGGGG + Intronic
1129330636 15:74825547-74825569 CAGAATCCCCAGGGCCCTGGGGG - Exonic
1129399054 15:75269276-75269298 CAGAGGCCCCAGCCCCAGGGAGG + Intronic
1129402661 15:75293552-75293574 CAGAGGCCCCAGCCCCAGGGAGG + Intronic
1129728477 15:77916084-77916106 CAGAGGCCCCAGCCCCAGGGAGG - Intergenic
1132457869 16:34022-34044 CAGGCTCCCCAGAGACAAGGTGG - Intergenic
1132682759 16:1150130-1150152 CAGAGCCCCCAAGGACAAGGTGG + Intergenic
1134066910 16:11234146-11234168 CAGAGTCATCACCGAGATGGTGG - Intergenic
1134306101 16:13033855-13033877 CACAGCGCCCAGCCACATGGAGG - Intronic
1135937996 16:26797253-26797275 CAGAGCCCCCAGAGGCCTGGAGG - Intergenic
1137802442 16:51273607-51273629 CAAAGTCCCCAGGCTCATGGAGG - Intergenic
1141609737 16:85174620-85174642 CAGAGCCTCCAGTGTCATGGGGG + Intronic
1141863786 16:86735929-86735951 CAGAGTCCCCACCAACAGGAAGG - Intergenic
1141951585 16:87343418-87343440 CAGAGTCCACTGCGCCACGGAGG + Intronic
1141987133 16:87587475-87587497 CAGCATCCCCATCAACATGGGGG - Intergenic
1146237841 17:31184957-31184979 CAGAGTCCCCAGCTTCATCAGGG - Intronic
1146637693 17:34518483-34518505 CAGAGTCCCCAGGGATATCCTGG - Intergenic
1147331852 17:39704009-39704031 CAGAGTCCAGAGAGACATGAAGG + Intronic
1147429702 17:40363809-40363831 CCGCGTCCCCAGCGCCATGGGGG - Exonic
1147913210 17:43870321-43870343 GAGAGGACCCAGCAACATGGTGG + Intergenic
1151767627 17:76140389-76140411 GAGAGTCCCCGCAGACATGGCGG - Exonic
1152547524 17:81009282-81009304 CAGAGTCCTCAGTGGCAGGGCGG - Intronic
1152961868 18:84725-84747 CAGGCTCCCCAGAGACAAGGTGG - Intergenic
1156373424 18:36491187-36491209 GAGAGTCCCCAGGCTCATGGAGG - Intronic
1159982876 18:74807368-74807390 CAGGGTCCCGAGAGTCATGGAGG + Intronic
1160004726 18:75061473-75061495 CTGAGTCGCCAGTGACATTGAGG + Intronic
1161914885 19:7221060-7221082 CAGAGTCCCCACCGGCAAGAAGG + Intronic
1162608030 19:11726646-11726668 CAGAGTCCCCACCAGCAAGGAGG + Intronic
1163229659 19:15992659-15992681 CTGAGTGCCCAGGGGCATGGAGG - Intergenic
1166252248 19:41579157-41579179 CAGAGACCCCAGGGACCAGGAGG - Intronic
1166310161 19:41958353-41958375 CAGAGCCACCAGCAACATAGGGG + Exonic
1168726608 19:58586338-58586360 CAGGCTCCCCAGAGACAAGGTGG + Intergenic
925275772 2:2647196-2647218 CAGAGGCCCCAGCCTCTTGGAGG + Intergenic
926036012 2:9636389-9636411 TAAAGTCACCAGGGACATGGAGG - Intergenic
927954949 2:27201559-27201581 CAGAGGCCCCAGGGAAATGTTGG - Intronic
928387874 2:30885019-30885041 CACATTCCCCAGGGAGATGGAGG + Intergenic
934516695 2:94992863-94992885 CACATTCCCCAGAGACAAGGGGG - Intergenic
935095006 2:99935864-99935886 CAGAGTCCCCAGCGACATGGAGG + Intronic
935455210 2:103259449-103259471 CAGAGTCCCCAGCCATATTGTGG - Intergenic
937921742 2:127136299-127136321 GAGAGTCCCCAGCAGCATGAAGG + Intergenic
946549315 2:220783162-220783184 GAGAGCCCCCAGCTAAATGGAGG - Intergenic
948060176 2:235037276-235037298 CAGTGTCCCCAGCTGCTTGGTGG + Intronic
1170999153 20:21396439-21396461 CAGCGGGCCCAGCGACTTGGCGG + Exonic
1173663763 20:44751482-44751504 AAGTGGCCCCAGTGACATGGTGG - Exonic
1173849911 20:46211269-46211291 CAGGGACCTCAGCTACATGGTGG + Intronic
1175685049 20:61022806-61022828 CACAGTCCCCAGCAACATTGAGG - Intergenic
1176130692 20:63495607-63495629 CAGAGTCCCCAGATAGATGGGGG - Intronic
1176867478 21:14062336-14062358 CAGAGTCCCCCGCCACACGCTGG + Intergenic
1178942268 21:36915873-36915895 CAGAGACCCCAGGGACAGGCCGG - Intronic
1179304516 21:40142111-40142133 AAGAGTGCCCAGGCACATGGAGG - Intronic
1179982719 21:44905028-44905050 CGGCGTCTGCAGCGACATGGAGG + Intronic
1181474515 22:23160062-23160084 CTGAGTCCCCAGAGCCTTGGGGG - Intronic
1181682357 22:24504197-24504219 GAGAGTCCCTAGCTAAATGGGGG - Intronic
1181931190 22:26402914-26402936 CAGAGTTCCCAGGGAGATCGGGG + Intergenic
1182664075 22:31944718-31944740 CCGAGCCGCGAGCGACATGGGGG + Exonic
1184654968 22:45936493-45936515 CAGAGTCCTCAGAGACATGTGGG + Intronic
1184676569 22:46046172-46046194 CAGAGAGTCCAGGGACATGGTGG - Intergenic
950410624 3:12834082-12834104 CAGGGCCCCCAGTGAGATGGTGG - Exonic
953078886 3:39597074-39597096 CTGAGGCCACAGCTACATGGGGG - Intergenic
954115628 3:48465559-48465581 CTGAGTGTCCAGCCACATGGTGG + Exonic
957997659 3:87710748-87710770 CAGAGTCCCCAGCAGCAAGTAGG + Intergenic
960260624 3:115564209-115564231 CAGCATCTCCAGGGACATGGTGG - Intergenic
961012992 3:123448398-123448420 CAGAGCCCCCGGGGGCATGGGGG + Exonic
962970109 3:140392911-140392933 CAGAGTCCCCACCGGCAAGAAGG - Intronic
966624200 3:181999043-181999065 CTGGATCCCCAGGGACATGGTGG + Intergenic
967081980 3:186058258-186058280 CAAGGTGCCTAGCGACATGGTGG - Intronic
967403472 3:189089580-189089602 CAGAGTCCCCACCAGCAAGGAGG - Intronic
967654598 3:192031827-192031849 CAGAGTCCACAGATGCATGGAGG - Intergenic
968338006 3:197930222-197930244 CTGGGTCCCCAGCGACTTGAGGG + Intronic
969845426 4:9916742-9916764 CAGAATGCCCAGGGTCATGGTGG - Intronic
971331938 4:25688847-25688869 CAGAGTCCCCAGTGGCAAGAGGG + Intergenic
979562951 4:122120585-122120607 CAGAGGCCTCAGTGACAAGGAGG + Intergenic
985081084 4:186264807-186264829 CACAGTCCCCAGCCACCTGCAGG - Intergenic
985655504 5:1129545-1129567 CAGCGTCCCAGGCGACAGGGTGG + Intergenic
988777029 5:34486237-34486259 CTGAGTCCCCAGTGACATTCTGG - Intergenic
995428086 5:112046446-112046468 CAGTGTCCCCAGCTTCATTGGGG + Intergenic
995571994 5:113490349-113490371 CAGAGTCCCCACCAGCAGGGTGG + Intergenic
997690598 5:135825382-135825404 CACAGTGCCCAGCTGCATGGTGG - Intergenic
999080445 5:148838480-148838502 CAGAGTACCCAGGGACAAGGTGG + Intergenic
1001891611 5:175344096-175344118 CAGTGTACACAGCCACATGGGGG + Intergenic
1002198298 5:177512961-177512983 CAGAGTCCCCAGGACCAGGGAGG - Intronic
1002344029 5:178535783-178535805 CAGAGTCCCCAGCCCCATCGTGG + Intronic
1002591699 5:180295152-180295174 CAGAGTCCCCAGCAGCAAGAAGG + Intergenic
1004884410 6:20037637-20037659 CAGAGTCCCCAGGCACATTCAGG + Intergenic
1005321143 6:24655617-24655639 CAGAGTCACCAGCCACAGGGAGG + Intronic
1011626530 6:89287698-89287720 CTGAGTCCCCAGCTAGAGGGAGG + Intronic
1013483270 6:110570256-110570278 CAGAGTCCTCAGTGACAAGCAGG - Intergenic
1015313635 6:131792915-131792937 CACAGTCACCAGCTGCATGGAGG + Intergenic
1019255301 7:45967-45989 CAGAGACACCAGCCACATGTGGG - Intergenic
1019416898 7:932005-932027 CAGAGTCCCCAGCAAGAAGCCGG + Intronic
1019535836 7:1529640-1529662 CTAAATCCCCAGCCACATGGTGG + Intergenic
1021611727 7:22464400-22464422 AAGAGTCCCCAGCCAGATGTAGG - Intronic
1024315666 7:48014383-48014405 AAGAGTCCCCAGGTAAATGGAGG - Intronic
1024958616 7:54951753-54951775 CAGTGTCCCCAGCTTCATCGGGG + Intergenic
1029224195 7:99013323-99013345 CAGAGGCCCCAGAGACAGTGTGG + Intergenic
1031125317 7:117767003-117767025 CAGAGGCCCCAGCAGCATAGGGG + Intronic
1032010112 7:128340443-128340465 CAGAGTCCCCACCAACAAGAAGG + Intronic
1034421822 7:150994718-150994740 CAGAGCCACCAGCGGCAGGGAGG - Intronic
1034939085 7:155218792-155218814 CAGAGACCCCAGCGACTCCGAGG - Intergenic
1035270792 7:157718876-157718898 GAGAGGCCACAGCGACAAGGTGG - Intronic
1035828008 8:2665169-2665191 CAGAAGCCCCAGCCACCTGGGGG + Intergenic
1041751194 8:61262738-61262760 CAGAGTGCACAGTGACAGGGTGG + Intronic
1048187022 8:132250736-132250758 CAGAGTGCCCAGTGAGCTGGGGG - Intronic
1049010351 8:139883240-139883262 CAGAGTCCCCAGCAGCAAGAGGG + Intronic
1049018750 8:139939640-139939662 CAGAGCCCCCAGCGACGGGGTGG - Intronic
1049411087 8:142474315-142474337 CAGCGGCCCCAGCTCCATGGTGG + Intronic
1057312625 9:93951681-93951703 TAGGGGCCCCAGCGACATCGGGG + Exonic
1060201605 9:121654725-121654747 CAGCCTCCCCATCCACATGGGGG + Intronic
1061292923 9:129662460-129662482 TATAGTCCCCAGCTACTTGGAGG - Intergenic
1061488892 9:130934381-130934403 AAGGGTCCCCAGCGGTATGGCGG - Intronic
1062553915 9:137105442-137105464 CAGAGGCCCTGGTGACATGGGGG - Intronic
1062736275 9:138139379-138139401 CAGGCTCCCCAGAGACAAGGTGG + Intergenic
1185478133 X:427437-427459 CAGAGACCCCAGAGACAGGACGG + Intergenic
1190247842 X:48702265-48702287 CAGTGACCCCAGTGACCTGGAGG + Intronic
1194375545 X:93128331-93128353 CAGAGTCCCCACCAGCAGGGAGG + Intergenic
1197572615 X:128167589-128167611 TAGAGTCCCCAGAGACAAGTTGG + Intergenic
1199024038 X:142917036-142917058 CAGTGTCCCCAGCTTCATTGGGG - Intergenic
1200398509 X:156005461-156005483 CAGGCTCCCCAGAGACAAGGTGG + Exonic