ID: 935099107

View in Genome Browser
Species Human (GRCh38)
Location 2:99975592-99975614
Sequence AGGAGGAAGCAGTAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1378
Summary {0: 1, 1: 2, 2: 10, 3: 140, 4: 1225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935099104_935099107 -8 Left 935099104 2:99975577-99975599 CCTTAAGGTGTATGTAGGAGGAA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 935099107 2:99975592-99975614 AGGAGGAAGCAGTAGGAGGCAGG 0: 1
1: 2
2: 10
3: 140
4: 1225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935099107 Original CRISPR AGGAGGAAGCAGTAGGAGGC AGG Intronic
900172302 1:1274913-1274935 AGGAGGCAGAGGAAGGAGGCTGG - Intergenic
900227703 1:1540650-1540672 GGGAGGAGGGAGGAGGAGGCAGG - Intergenic
900384010 1:2401204-2401226 AGGAGGAGGGAGGAGGAGGGAGG - Intronic
900384054 1:2401321-2401343 AGAAGGAGGGAGGAGGAGGCAGG - Intronic
900384072 1:2401373-2401395 AGGAGGAGGGAGGAGGAGGGAGG - Intronic
900384076 1:2401383-2401405 AGGAGGAGGGAGGAGGAGGGAGG - Intronic
900427014 1:2585539-2585561 AAGGGGAAGCACTAGGAGGGAGG - Intergenic
900479493 1:2891223-2891245 AAGAGGAAGCCGCAGGAGGGAGG + Intergenic
900621005 1:3587928-3587950 AGGAGGGGGCAGGAGGGGGCAGG + Intronic
900621010 1:3587938-3587960 AGGAGGGGGCAGGAGGGGGCAGG + Intronic
900621015 1:3587948-3587970 AGGAGGGGGCAGGAGGGGGCAGG + Intronic
900621101 1:3588158-3588180 AGGAGGGGGCAGGAGGGGGCAGG + Intronic
900621131 1:3588228-3588250 AGGAGGGGGCAGGAGGGGGCAGG + Intronic
900621161 1:3588298-3588320 AGGAGGGGGCAGGAGGGGGCAGG + Intronic
900621182 1:3588348-3588370 AGGAGGGGGCAGGAGGGGGCAGG + Intronic
900621203 1:3588398-3588420 AGGAGGGGGCAGGAGGGGGCAGG + Intronic
900621259 1:3588538-3588560 AGGAGGGGGCAGGAGGGGGCAGG + Intronic
900700309 1:4044209-4044231 AAGAGGAAGAAGAAAGAGGCTGG - Intergenic
900725553 1:4214191-4214213 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
900950857 1:5857687-5857709 AGGAGGAGGGAGGAGCAGGCGGG + Intergenic
901052994 1:6434988-6435010 AGGAGGAAGACCTGGGAGGCTGG + Intronic
901296052 1:8161707-8161729 AGGAGGAAGGAGAAGCCGGCAGG - Intergenic
901357462 1:8663781-8663803 AGGTGGAAGCAGTAGGGGAGAGG - Intronic
901774532 1:11551100-11551122 AGGAGGTGGCAGTAGAAGGGAGG - Intergenic
901781971 1:11600067-11600089 AGGAGGAGCCAGGAGGAAGCCGG - Intergenic
902190193 1:14757288-14757310 AAGAGAAAGCAGGAGCAGGCAGG - Intronic
902405419 1:16180817-16180839 AGGAGGCTGAGGTAGGAGGCTGG - Intergenic
902481247 1:16713061-16713083 AGGAGGAAGACCTGGGAGGCTGG - Intergenic
902862660 1:19257317-19257339 AGCAGGAAGGAGTGGGAGGCAGG - Intronic
902885822 1:19403977-19403999 AAGAGGTAACAGTAGTAGGCCGG + Intronic
902919044 1:19655778-19655800 GGCAGGAAGCAGGAGGAGGCTGG - Intronic
902922828 1:19677427-19677449 AGGAGGAAGGGGTAGGAGGGAGG - Intronic
903364526 1:22797796-22797818 AGGAGGAAACGGGAGGAGACCGG - Intronic
903450009 1:23446786-23446808 AGGATGGAGCAGAAGGATGCAGG - Intronic
903474990 1:23613400-23613422 AGGAGGAAGCTCTAGGGGGCAGG + Intronic
903601125 1:24541583-24541605 AGGAGGAAGTGGAGGGAGGCAGG - Intergenic
903655973 1:24948942-24948964 AGGGGCAAGCAGCAGGAGGCAGG - Intronic
903676539 1:25068050-25068072 AGGAAGAACCAGGAGGAGGGTGG - Intergenic
903742428 1:25565949-25565971 AGGAAGAGGAAGGAGGAGGCAGG - Intronic
903776507 1:25797531-25797553 AAGAGGGAGGAGGAGGAGGCAGG - Intergenic
903989195 1:27253425-27253447 AGGAGGAAGGAGGAGGAGGGAGG - Intronic
903989196 1:27253428-27253450 AGGAGGAGGAAGGAGGAGGAGGG - Intronic
904030047 1:27528045-27528067 CGGAGGAAGGAGTTGGAGGAGGG + Intergenic
904087077 1:27916760-27916782 AGGAGGAAAGAGGAGGAGGAAGG - Intergenic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904201063 1:28819298-28819320 AGGAGGCAGCAGGAGGAGGCTGG + Intronic
904456581 1:30651633-30651655 AGGAGGAGGTAGGAGGAGGTGGG - Intergenic
904848834 1:33441545-33441567 AGGAGGAAGGAGAAGGAAGAAGG - Intergenic
905016401 1:34781630-34781652 AGGAGGGAGCAGGAGGGAGCCGG - Exonic
905915059 1:41678824-41678846 AAGAGGAAGCAGTTAGAGGTGGG + Intronic
905963762 1:42070464-42070486 AGGAGGAAGAAGGAGGAAGTTGG + Intergenic
906129361 1:43446929-43446951 GGGAGGCAGCAGCAGGAGACAGG - Intronic
906180877 1:43817733-43817755 AGGAGGAAGAAGGAGGAGGAGGG - Intronic
906270095 1:44470781-44470803 AGGAGGATGCAGGAAGAGGACGG - Intronic
906664112 1:47606562-47606584 AGGAGGCTGCAGTAGGCTGCTGG + Intergenic
906741581 1:48190137-48190159 AGGAGGAAGCTGGAGGAAGAAGG + Intergenic
906951835 1:50341102-50341124 AGGAGGAGGGAGGAGGAGGGAGG - Intergenic
907223960 1:52927640-52927662 AGGAGGAAGCAGAAGGCCGCAGG - Intronic
907757970 1:57329265-57329287 GGGAGGAAGGAGGATGAGGCTGG - Intronic
907837599 1:58125950-58125972 AGGAGGAAGGAGAAGGGGACAGG + Intronic
907865112 1:58391737-58391759 TGCAGGAAGCAGTAAGAGGGTGG - Intronic
908388150 1:63662197-63662219 GGGAGGAAGAAGGAGGTGGCTGG + Intergenic
908825212 1:68126369-68126391 AGGAGGAAGGAGAAGCAAGCTGG + Intronic
909288630 1:73853991-73854013 AGGAGGAACCTGAAGGAAGCTGG - Intergenic
910205090 1:84742061-84742083 AGGAGGAAGGAGTTGGAGGATGG + Intergenic
910276420 1:85454046-85454068 AGTAGGAAGCAGTAGCATCCAGG - Intronic
910332976 1:86097460-86097482 AGGAGGGAGGAGGAGGAGGGAGG - Intronic
910332977 1:86097463-86097485 AGGAGGAGGGAGGAGGAGGAGGG - Intronic
910332981 1:86097473-86097495 AGGAGGGAGGAGGAGGAGGGAGG - Intronic
910332982 1:86097476-86097498 AGGAGGAGGGAGGAGGAGGAGGG - Intronic
910447252 1:87311117-87311139 AGGTTGAAGCAATGGGAGGCTGG + Intergenic
911008756 1:93255780-93255802 AAGAGGAAGAAGAAGGAGGGGGG + Intronic
911528244 1:99012286-99012308 AGGAGGCAGAAGTAGGAAGATGG - Intergenic
911733737 1:101315330-101315352 ACATGGAAACAGTAGGAGGCAGG - Intergenic
912186046 1:107276980-107277002 AAGAGGAAGCTGGGGGAGGCTGG + Intronic
913083594 1:115413120-115413142 AGGAGGAGGGAGGAGGAGGGAGG + Intergenic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913450209 1:118987940-118987962 AGGAGGACGCAGGGGGAGGGTGG - Intronic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
914448880 1:147773396-147773418 AGTAGGAAGAAGTGGGAGGAGGG - Intergenic
914506824 1:148296574-148296596 AGGAGGAGGGAGGAGGAGGTGGG - Intergenic
914807864 1:151004830-151004852 AGAAGGAAGCAGTCTCAGGCTGG - Intronic
914926395 1:151892251-151892273 AGGAGCAAGTAGAAGGAGGAGGG + Intronic
915035312 1:152918739-152918761 AGGAGGAGGGAGGAGGAGGGAGG + Intergenic
915035317 1:152918752-152918774 AGGAGGGAGGAGGAGGAGGAGGG + Intergenic
915342121 1:155182260-155182282 AGGAGGAAGTAGTAGGAGCCTGG + Intronic
915345024 1:155193017-155193039 AGGAGGAAGAGGTAGGAGGTAGG - Intergenic
915409315 1:155688398-155688420 AGGAGGGAGGAGTGGGAGGTTGG - Exonic
915446489 1:155977587-155977609 AGAAGGAAGAGCTAGGAGGCTGG + Intronic
915581633 1:156816424-156816446 AGGAGGGAGCAGGAGGATGAAGG - Intronic
915751246 1:158212972-158212994 AGGATGAGGCAGCAGGCGGCTGG - Intergenic
915840429 1:159208571-159208593 AGGAGGATGTAGCAGGGGGCGGG - Intergenic
916149335 1:161771206-161771228 AGGAGAAAGGAGGAGGAGGAGGG - Intronic
916678007 1:167080465-167080487 AGAGAGAAGCACTAGGAGGCAGG - Intronic
916738714 1:167630208-167630230 ACGAGGAAGGAGGAGGAGGGAGG - Exonic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
918188457 1:182148437-182148459 AGGAGAAGGAAGTAGGAGGAAGG - Intergenic
919718528 1:200806871-200806893 ATGAGGAAGAAGTTGGAGGCAGG + Intronic
919799510 1:201344937-201344959 AATGGGAAGCAGCAGGAGGCAGG - Intergenic
919842552 1:201619759-201619781 ATGAGGAAGAGGCAGGAGGCAGG + Intergenic
919938717 1:202271875-202271897 TGGAGGAGGCAGCAGGAGACAGG - Intronic
920036991 1:203072540-203072562 AGGAGGGAGGAAGAGGAGGCGGG - Intronic
920092426 1:203464124-203464146 GGGAGGAAGGAGGAGGAGGAGGG + Intergenic
920360629 1:205413526-205413548 AGGAGGCTGAGGTAGGAGGCTGG - Intronic
920367359 1:205455214-205455236 ATGGGGAGGCAGTGGGAGGCAGG + Intronic
920509749 1:206542127-206542149 AGGAGGAAGGGGTAGGACTCTGG - Intronic
920573063 1:207032660-207032682 AGAAGAAAACAGTAGGAGGCAGG - Exonic
920649539 1:207826418-207826440 ATGAGGAGGCTGGAGGAGGCAGG + Intergenic
920663398 1:207939284-207939306 AGGAGGAACAAGTAGGAGGTGGG + Intergenic
921377257 1:214487257-214487279 TGAAGGAAGGAGGAGGAGGCAGG + Intronic
921676621 1:217983184-217983206 AGGAGGGAGGAGGAGGAGGAGGG + Intergenic
922187935 1:223292971-223292993 AGGAGGGAACAGTAGGTGGGAGG + Intronic
922574926 1:226655099-226655121 AGGAGGAAGAAGAGGGAGGAAGG + Intronic
922722571 1:227906316-227906338 AGGAGGAGGGAGGAGGAGGGTGG - Intergenic
922722598 1:227906386-227906408 AGGAGGATGGAGTAGGAGGAGGG - Intergenic
922722607 1:227906416-227906438 AGGAGGGAGTAGGAGGAGGAGGG - Intergenic
922722616 1:227906440-227906462 AGGAGGAGGGAGGAGGAGGGAGG - Intergenic
922722633 1:227906481-227906503 AGGAGGGAGTAGGAGGAGGGAGG - Intergenic
922722634 1:227906484-227906506 AGGAGGAGGGAGTAGGAGGAGGG - Intergenic
922722644 1:227906518-227906540 AGGAGGGAGGAGGAGGAGGGTGG - Intergenic
922722645 1:227906521-227906543 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
922722649 1:227906531-227906553 AGGATGGAGCAGGAGGAGGGAGG - Intergenic
922722654 1:227906547-227906569 AGGAGGAGGGAGTAGAAGGATGG - Intergenic
922722679 1:227906625-227906647 GGGAGGAGGGAGTAGGAGGAGGG - Intergenic
923123113 1:231012507-231012529 AGAAAGAAGCAGAGGGAGGCTGG - Intergenic
923127049 1:231041163-231041185 AGTGGGAGGCAGCAGGAGGCGGG - Intergenic
923475302 1:234326086-234326108 AGGAAGGAGCAGGAGGAGGATGG + Intergenic
923654163 1:235900960-235900982 GGGAGGACGCATTTGGAGGCAGG + Intergenic
923782254 1:237035639-237035661 AGGAGGGAGCAGGAGGGTGCTGG - Intergenic
924503467 1:244658405-244658427 AGGAGCAAGCAGGAGGTTGCAGG - Intronic
924645324 1:245872345-245872367 TGGGTGAAGCAGCAGGAGGCGGG - Intronic
924657644 1:245988048-245988070 CAGAGGAATCACTAGGAGGCAGG + Intronic
1062936557 10:1394899-1394921 AGGAAGAAGAAGGAGGAGGAGGG - Intronic
1063159454 10:3408756-3408778 AGGAGGAAAGAGGAGGAGGAGGG + Intergenic
1063159459 10:3408769-3408791 AGGAGGAGGGAGGAGGAGGGAGG + Intergenic
1063159493 10:3408898-3408920 AGGAGGAAAGAGGAGGAGGGAGG + Intergenic
1063159497 10:3408908-3408930 AGGAGGAGGGAGGAGGAGGAGGG + Intergenic
1063159498 10:3408911-3408933 AGGAGGGAGGAGGAGGAGGGAGG + Intergenic
1063760980 10:9076459-9076481 AGGAGGAAGCAGTAGTTGAAAGG - Intergenic
1064032896 10:11894382-11894404 AGGAGAAACAAGGAGGAGGCAGG - Intergenic
1064971041 10:21067465-21067487 AAGAGAAAGCAGGAGGAGGGAGG + Intronic
1065487617 10:26249917-26249939 AGGAGGGCGGAGAAGGAGGCAGG + Intronic
1065692602 10:28350866-28350888 AGGCGGAGGCAGGAGAAGGCAGG - Intergenic
1065894000 10:30145414-30145436 GGGAAGAGGCAGTGGGAGGCAGG + Intergenic
1065967178 10:30779802-30779824 GAGAGGAAGCACAAGGAGGCAGG - Intergenic
1065999112 10:31087642-31087664 AGGAGGTAGCAGGAGGAGGCAGG - Intergenic
1066198230 10:33122512-33122534 AGGTGGTAGCAGCAGGAGGTTGG - Intergenic
1066441282 10:35441468-35441490 TGGAAAAAGCGGTAGGAGGCTGG + Intronic
1067038188 10:42934218-42934240 AGGAGGCAGCAGTAGGGAGTGGG - Intergenic
1067557812 10:47284871-47284893 GGGAGGAAGAAGGAGGAGGAGGG + Intergenic
1067557813 10:47284874-47284896 AGGAAGAAGGAGGAGGAGGGAGG + Intergenic
1067557818 10:47284891-47284913 GGGAGGAAGAAGGAGGAGGAGGG + Intergenic
1067557819 10:47284894-47284916 AGGAAGAAGGAGGAGGAGGGAGG + Intergenic
1067696918 10:48542485-48542507 AGGCAGAGGCAGCAGGAGGCAGG - Intronic
1067843642 10:49701599-49701621 AGGAGGAAGCAGCACGAGGAAGG - Intronic
1068174006 10:53433494-53433516 AGAAGGAAGAAGAAGGAGGAAGG + Intergenic
1069718514 10:70535570-70535592 AGGAGGAAGAAGGAGGAGGAAGG - Intronic
1069960131 10:72074688-72074710 AGAAGGAGGCAGCAGGAGTCGGG + Intronic
1069963735 10:72096224-72096246 AGGAGGCAGGGGTGGGAGGCTGG + Intronic
1070480674 10:76879525-76879547 AGAAAGAAGCTGTAGGAGTCTGG - Intronic
1070487236 10:76942776-76942798 AGAAGCCAGCAGGAGGAGGCAGG - Intronic
1070524468 10:77283334-77283356 AGGAGGAGGGAGAAGGAGGCAGG + Intronic
1070715211 10:78715406-78715428 AGGAGGAAGTAGAATGAGACTGG + Intergenic
1070733809 10:78849966-78849988 AGGAGGCAGCAGGGAGAGGCCGG - Intergenic
1070823378 10:79376048-79376070 AGCAGGAAGCAGCAGGAGGCAGG + Intergenic
1072085632 10:92076762-92076784 AGAAGGAAGAAGAAGGAGGAAGG + Intronic
1072639583 10:97201868-97201890 AGGAGGGAGCAGGTGGAGGGAGG - Intronic
1072720769 10:97779752-97779774 GGGAGGAAGTAGTAGAAGGAAGG + Intergenic
1073072558 10:100803766-100803788 AAGAGGTGGCAGTGGGAGGCGGG - Intronic
1073327494 10:102651094-102651116 AGCAGGAAGAGGAAGGAGGCTGG - Intronic
1073438992 10:103541315-103541337 AGGAGGAAGCTGGGGGAGTCTGG + Intronic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1073759828 10:106617284-106617306 AGGAGGAGGCAGAAGGAGGGAGG - Intronic
1073891820 10:108111345-108111367 AGGGGAATGAAGTAGGAGGCAGG - Intergenic
1073928560 10:108546186-108546208 AGGAGTAGGGAGTGGGAGGCTGG + Intergenic
1074446708 10:113526688-113526710 AGGAGGAAGCACTGGGTGGCAGG - Intergenic
1074773772 10:116751071-116751093 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1074877149 10:117622339-117622361 ATGAGGAAGCAGTAAGGAGCAGG - Intergenic
1075106386 10:119542654-119542676 AGGAGGAAGAAGGAGCAGCCCGG + Exonic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1075481929 10:122789613-122789635 AGCAGGAGGCTGCAGGAGGCAGG - Intergenic
1075645222 10:124092476-124092498 AGGAGGAAGGAGGAGGGGGCGGG + Intronic
1076121404 10:127939798-127939820 AGGTGGAGGCAGGAGGAGACAGG + Intronic
1076121417 10:127939858-127939880 AGGTGGAGGCAGGAGGAGACAGG + Intronic
1076121419 10:127939868-127939890 AGGAGGAGACAGGAGGAAGCAGG + Intronic
1076121429 10:127939918-127939940 AGGTGGAGGCAGGAGGAGACAGG + Intronic
1076121432 10:127939928-127939950 AGGAGGAGACAGGAGGAGGCAGG + Intronic
1076206683 10:128609741-128609763 AGGAGGAAACAGTTGGGGGCAGG - Intergenic
1076370516 10:129949944-129949966 AGCAGAAAGCAGTTGGGGGCAGG - Intronic
1076736440 10:132461250-132461272 AGGAGGATGAAGGAGGAGGGAGG - Intergenic
1076833720 10:133009573-133009595 AGGAGGAAAGAGAAGGAGGTGGG + Intergenic
1076879536 10:133233138-133233160 AGGCTGAGGCAGGAGGAGGCAGG + Intergenic
1076889979 10:133278686-133278708 AGGAGGAAGCGGTTTGTGGCTGG + Exonic
1076998045 11:308642-308664 AGGAGGAGGCTCCAGGAGGCTGG + Intronic
1076999266 11:314561-314583 AGGAGGAGGCTCCAGGAGGCTGG + Intronic
1077000599 11:320339-320361 AGGAGGAGGCTCCAGGAGGCTGG - Intronic
1077074462 11:694181-694203 AGGGGGGACCAGTAGGAGGCGGG + Intronic
1077154128 11:1083956-1083978 AGCAGGAAGCAGCAGGGGCCGGG - Intergenic
1077200984 11:1307457-1307479 GGCAGGGAGCAGTGGGAGGCAGG - Intronic
1077392509 11:2306733-2306755 AGGAGGACGAAGAAGGAGGAGGG + Intronic
1077483853 11:2830001-2830023 AGGAGGAAGGAGGAGGAAGGAGG + Intronic
1077483855 11:2830008-2830030 AGGAGGAGGAAGGAGGAGGAAGG + Intronic
1077483856 11:2830011-2830033 AGGAGGAAGGAGGAGGAAGGAGG + Intronic
1077483859 11:2830018-2830040 AGGAGGAGGAAGGAGGAGGGAGG + Intronic
1077501512 11:2911614-2911636 AGGAGGCGGCAGCAGGCGGCTGG - Intronic
1077869559 11:6250497-6250519 AGGAGCCAGAAGCAGGAGGCAGG + Intergenic
1077887402 11:6395844-6395866 ATGTGGCAGCAGAAGGAGGCTGG + Exonic
1077925220 11:6675075-6675097 AGGAGGAAACAGGAGAAGGGAGG + Intergenic
1078040293 11:7855529-7855551 AGCGGTAAGCTGTAGGAGGCAGG + Intergenic
1078270485 11:9789958-9789980 AGGAGGATGCAGCTGGAGGAAGG + Intronic
1078280987 11:9900965-9900987 AGGTGGAGGCAGAAGGAAGCAGG - Intronic
1078464261 11:11538801-11538823 AGGAGGCAGCAGCAGGAGTAAGG - Intronic
1078509760 11:11976617-11976639 AGGAGGTGGCAGTGTGAGGCAGG + Intronic
1078694905 11:13620999-13621021 AGGATGAAGGGGTAGGAAGCTGG - Intergenic
1079099286 11:17530910-17530932 AGGAGGCAGCAGTTGGAAGCAGG + Intronic
1079237501 11:18700654-18700676 AGGAGGGAGAAGGAGGGGGCAGG + Intronic
1079405304 11:20140143-20140165 AAGAGGGAGGAGGAGGAGGCGGG - Intergenic
1079445538 11:20553548-20553570 AGGAGGAAGGAGGAGGAAGGAGG - Intergenic
1079810180 11:24988983-24989005 GGGAGGCAGCCATAGGAGGCCGG + Intronic
1080237896 11:30092861-30092883 AGGAGGAGGGAGGAGGAGGGAGG - Intergenic
1080237900 11:30092871-30092893 AGGAGGAAGGAGGAGGAGGGAGG - Intergenic
1080616656 11:33950274-33950296 AGGAGAGAGAAGTATGAGGCTGG + Intergenic
1080720300 11:34841943-34841965 AGGAGGCAGAAGTGGGAGCCAGG - Intergenic
1080806926 11:35662604-35662626 AGGAGGAGGGAGAAGGAGGATGG - Intergenic
1081194106 11:40140243-40140265 ATGAGGAGGCAGCAGGAGGCAGG - Intronic
1081692268 11:45086576-45086598 CGGAGAGAGCAGGAGGAGGCCGG - Intergenic
1081740167 11:45433668-45433690 GGGAGGCTGCAGTAGGAGGATGG + Intergenic
1081866022 11:46361282-46361304 AGGAGGGAGAAGTGGGAGCCAGG - Intronic
1082877362 11:58001849-58001871 AGTAAGAAGCAGTAAGAGACAGG - Intergenic
1082892404 11:58154101-58154123 AGGAGGAAGGAGGAGGGGGAAGG + Intronic
1082991827 11:59213196-59213218 TGGAGGAAGCAGTAGGGTGTGGG - Intergenic
1083616367 11:64028482-64028504 GGAAGGAAGGAGCAGGAGGCAGG + Intronic
1083697658 11:64453470-64453492 AGGAGGGGGCAGGAGGGGGCTGG + Intergenic
1083755480 11:64789629-64789651 AGGAGAGAGGAGTAGGGGGCAGG + Intronic
1084010077 11:66342943-66342965 AAGAGGAAGCAGAAGGAGATGGG - Intronic
1084230779 11:67751117-67751139 AGGAGGAAGGAGAAGAAGGAAGG + Intergenic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084347667 11:68566300-68566322 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
1084347671 11:68566313-68566335 AGGAGGAAAGAGAAGGAGGAAGG - Intronic
1084760688 11:71268764-71268786 AGGAGGGAGGAGAAGGAGGGAGG + Intergenic
1084899024 11:72295768-72295790 AGGAGGAAGCAGCTGGCTGCTGG - Intronic
1085235159 11:75008974-75008996 AGGGGGAAGAAGTAAGAGGAGGG - Exonic
1085243751 11:75080436-75080458 AGGTGGGGGCAGTAGGAGGAGGG - Intergenic
1085299543 11:75450185-75450207 AGGAGGAGGCAGCAGGAGGCCGG + Intronic
1085822670 11:79809833-79809855 AGTATGAAGCAGAAAGAGGCAGG + Intergenic
1085931554 11:81089343-81089365 GGGAGGAAGCAGAAGGAAGGAGG - Intergenic
1086196268 11:84143794-84143816 AGGAGGAAGCAGGGAGAAGCAGG + Intronic
1086708488 11:89980387-89980409 AGGAGGCAGGCGCAGGAGGCGGG + Intergenic
1086998895 11:93392910-93392932 AGGAGGGAGGAGAAGGAGGAGGG - Intronic
1087056194 11:93938883-93938905 GGGAGGAAGCAGGAGCTGGCAGG - Intergenic
1087560620 11:99785043-99785065 AGGTGGAGGCAGGCGGAGGCAGG - Intronic
1088259911 11:107934327-107934349 AGGAGGCTGAAGTAGGAGGGTGG + Intronic
1088920278 11:114255535-114255557 GGGAGGGGGCAGCAGGAGGCAGG - Intergenic
1089604629 11:119634795-119634817 ACGAGGGAGCAGCAGGTGGCAGG - Intronic
1089672320 11:120065043-120065065 GGGAGGAATCAGTAGGGGGTCGG - Intergenic
1089744907 11:120609829-120609851 AGGAGAAAGGGGTAGAAGGCAGG - Intronic
1089770961 11:120802606-120802628 AGGTGGCAGCAGGGGGAGGCTGG + Intronic
1091074183 11:132599367-132599389 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074185 11:132599377-132599399 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074187 11:132599387-132599409 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074189 11:132599397-132599419 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074191 11:132599407-132599429 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091116176 11:133015821-133015843 AGGAGGAAACAGCAGGAGCAAGG - Intronic
1091273618 11:134334645-134334667 AGCAGGGAGGAGTAGGAGGGAGG - Intronic
1091289333 11:134428666-134428688 AGGAGGGAGCAGGAGGGAGCAGG - Intergenic
1091289336 11:134428676-134428698 AGGAGGGAGCAGGAGGGAGCAGG - Intergenic
1091410392 12:235280-235302 AGGAGGCAGGGGCAGGAGGCAGG + Intronic
1091536478 12:1414713-1414735 AGGAGGGAGGAGGAGGAGGGAGG - Intronic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1092165924 12:6342113-6342135 AGGAGGAGGCCACAGGAGGCGGG + Exonic
1092237478 12:6819134-6819156 AGGAGGCAGAAGTGGGAGGATGG + Intronic
1092268502 12:7002191-7002213 AGGAGGAAGCAGTAACAGAGAGG - Intronic
1092743827 12:11654637-11654659 AAGAGGAAGTAGTAGGAGGGAGG + Intronic
1092775636 12:11942949-11942971 ATGAGAAAGCAGTAGGAGCAAGG + Intergenic
1092873921 12:12831999-12832021 AGGAGTAAAGAGTAGGAGGCAGG + Intergenic
1093027742 12:14260102-14260124 AGGAGGCAGCACAAGCAGGCGGG + Intergenic
1093492157 12:19717505-19717527 AGGAGGAAACAACAGGTGGCAGG - Intronic
1093508394 12:19896745-19896767 AGGAGGAAGAAGGAGGAAGGAGG - Intergenic
1093508397 12:19896755-19896777 AGGAGGAAGAAGGAGGAAGAAGG - Intergenic
1093508399 12:19896765-19896787 AGGAGGAAGGAGGAGGAAGAAGG - Intergenic
1094070935 12:26412299-26412321 AGGAGGAGGCAGAGTGAGGCTGG + Intronic
1094355492 12:29573501-29573523 AGGGTGAAGAAGTAGGAGGAGGG + Intronic
1094628262 12:32146926-32146948 AGGAAGAAGAAGGAGGAGGAAGG - Intronic
1095198158 12:39348685-39348707 AGGAGGCAGCTGTAGAAGCCAGG + Intronic
1095223305 12:39645839-39645861 AGGAGGCTGCAGTTGGAGGATGG - Intronic
1095242496 12:39877989-39878011 AGGAGCAAGCAGTAGGAGAGTGG - Intronic
1096080648 12:48830266-48830288 AGGACGACGCTGTCGGAGGCAGG - Exonic
1096098788 12:48956668-48956690 AGGAGGCAGGAGAAGGAGGAGGG - Intronic
1096254941 12:50057265-50057287 AGGAAGCAGCAGCAAGAGGCAGG + Intergenic
1096449178 12:51722665-51722687 AGGAGGAAAAAGTGGGAGGTTGG + Intronic
1096556747 12:52408563-52408585 AGAAGGACACAGGAGGAGGCTGG - Intergenic
1096574653 12:52545059-52545081 AGGAGGAAGAGGTTAGAGGCTGG - Intronic
1096595009 12:52689471-52689493 AGGAGGAGGGAGGAGGAGGAGGG + Intergenic
1096597600 12:52706639-52706661 AGGGGGAAGAAGTAGGGGTCTGG + Intergenic
1096601509 12:52733046-52733068 AAGACGATGCTGTAGGAGGCAGG + Intergenic
1096771512 12:53938768-53938790 AGGTGGAAGCACTAGGAGGAGGG + Exonic
1096815619 12:54200095-54200117 GGGAGGAAACAGGAGGAGCCAGG + Intergenic
1097231958 12:57518136-57518158 AGGAAGGACCAGTAGGAGGCTGG - Intronic
1097251096 12:57632701-57632723 AGGAGGAGGCGGGAGGAGGCGGG - Intronic
1097310859 12:58117635-58117657 AGGAGGGAGCAGGAGTGGGCAGG + Intergenic
1097790667 12:63811973-63811995 AGGAGGAAGGAGGGGGAGGGGGG + Intergenic
1097790678 12:63812031-63812053 AGGAGGAAGAAGAAGAAGGAGGG + Intergenic
1098106035 12:67069517-67069539 AGGAAGAAGGAGGAGGAGGAGGG - Intergenic
1098191430 12:67953250-67953272 GGGAGGAGGGAGAAGGAGGCTGG + Intergenic
1098194935 12:67989723-67989745 GGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1098202977 12:68076857-68076879 AGAAGGAAGCAGTGCCAGGCAGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098394423 12:70003098-70003120 AGGAGGAGGGAGGAGGAGGCAGG + Intergenic
1098394428 12:70003118-70003140 AGGAGGAGGCAGCAGGAGGCAGG + Intergenic
1098416558 12:70241931-70241953 AGGAGAAAGCAGGAAGAGGAAGG + Intergenic
1098850388 12:75589100-75589122 GGGAGGAAGCTGGAGGAGACTGG - Intergenic
1099379781 12:81939605-81939627 TGGAGGAAGGAGAAGGAGACAGG - Intergenic
1099619528 12:84983467-84983489 AGAAGGGAACAGTAGGGGGCAGG + Intergenic
1100406449 12:94276463-94276485 AGGTGGAACCAGAAGGAGGGAGG + Intronic
1100449932 12:94696083-94696105 AGGAGGGAGAAGAGGGAGGCTGG + Intergenic
1100826333 12:98478085-98478107 AGGAGGAAGATGTAGGAAGATGG + Intergenic
1101518331 12:105458510-105458532 TGGAGGCTGCAGTAGGAGCCTGG - Intergenic
1101856531 12:108448161-108448183 AAGAGCAAGGAGTGGGAGGCAGG - Intergenic
1102090663 12:110184602-110184624 GGAAGGGAGCAGGAGGAGGCAGG + Intronic
1102230367 12:111257636-111257658 AGGAGGAAGGAGGAGGAAGAGGG - Intronic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102645826 12:114403265-114403287 CGGAGGAGGCAGGAGGAGGCAGG + Intronic
1102645830 12:114403275-114403297 AGGAGGAGGCAGGAGGAGGCGGG + Intronic
1102792322 12:115657807-115657829 ACGAGGAAGAAGGAGGAGGAGGG - Intergenic
1102799154 12:115716469-115716491 TAAAGGAAGCAGGAGGAGGCTGG + Intergenic
1102800109 12:115724738-115724760 AGGAGGAAGCAGGAATAAGCAGG + Intergenic
1102908447 12:116694873-116694895 AGGAAGAGGGAGGAGGAGGCAGG + Intergenic
1103219468 12:119231861-119231883 AGGAGGAAGGAGGGAGAGGCAGG - Intergenic
1104309888 12:127645076-127645098 AAGAGGAAGTAGTGGTAGGCTGG + Intergenic
1104328298 12:127820684-127820706 AGCAAGAAAGAGTAGGAGGCAGG - Intergenic
1104661365 12:130613335-130613357 ATGAGGTCGCAGTAGGAGCCTGG - Intronic
1105257403 13:18753225-18753247 AGTAGGAAGGAGGAGAAGGCTGG - Intergenic
1105575809 13:21650568-21650590 AAGAGGAAGAAGGAGGGGGCTGG - Intergenic
1105955909 13:25282464-25282486 AGGAGGAAGCAGCCAGAGGATGG + Intronic
1106230485 13:27817418-27817440 GGGATGGAGCAGCAGGAGGCTGG + Intergenic
1106346420 13:28883664-28883686 AAGGGGTAGCAGGAGGAGGCAGG + Intronic
1106558369 13:30829078-30829100 AGAAGAAAGCAGGAGGCGGCCGG - Intergenic
1106766823 13:32921871-32921893 GGGAGGAAGCAGGAGGAAGAGGG + Intergenic
1107508355 13:41058309-41058331 AGGGGGAACAAGTATGAGGCTGG - Intronic
1107876732 13:44797343-44797365 AGGAGGAAGCTGTCAGAAGCTGG + Intergenic
1108021894 13:46136170-46136192 AGCAGGAGGCAGAAGGAGGATGG - Intronic
1108122183 13:47201294-47201316 AGGAGGCTGAGGTAGGAGGCTGG - Intergenic
1108192755 13:47959425-47959447 AGGAGGGAGAAGGAGGAGGAGGG + Intronic
1109470511 13:62798888-62798910 AGGAGGAGCCAGGAGGAGCCAGG + Intergenic
1109910775 13:68907342-68907364 AGGAGGAGGCAGGAGTAGTCAGG - Intergenic
1110772501 13:79366070-79366092 AGGGTGGAGCAGGAGGAGGCTGG + Exonic
1111178848 13:84635820-84635842 AGGAGGAGGCTGTAGGTGGGTGG - Intergenic
1111957523 13:94775152-94775174 AGGAGGAAGCAGTGGCTGGTAGG - Intergenic
1112034555 13:95485146-95485168 ACCAGGAAGCTGTGGGAGGCAGG + Intronic
1112120147 13:96401111-96401133 GGGAGGGTGCAGAAGGAGGCTGG + Intronic
1112224108 13:97520872-97520894 AGAAGGAAGAAGTTGGAGGAGGG + Intergenic
1112536547 13:100262695-100262717 AGAAGGAAGAAGGAGGAGGGGGG - Intronic
1112626572 13:101111468-101111490 GGGAGGAGGCAGAAGGAGGAGGG - Intronic
1112924674 13:104659573-104659595 AGGAGGAAGAGGGAGGAGGGAGG - Intergenic
1113354652 13:109566912-109566934 AGCAGCAAGAACTAGGAGGCGGG - Intergenic
1113698267 13:112364339-112364361 AGGTGGAGGCAGGAGGAGCCTGG + Intergenic
1113876400 13:113597463-113597485 TGGAGGAAGCTGTGTGAGGCAGG + Intronic
1114004751 14:18300430-18300452 AGGAGGAAGCAGGAGAAGGTGGG + Intergenic
1114552116 14:23538724-23538746 AGGAGGAAGGAGGAAGAGGGTGG + Intronic
1114623538 14:24114034-24114056 AGGAGGGGGCAGGAGGGGGCAGG + Intronic
1114812039 14:25912129-25912151 GGGAGGTAGGAGTAGGAGGTTGG + Intergenic
1115507339 14:34104932-34104954 AGGAGGAAGCAGTAACTGACAGG + Intronic
1115514896 14:34175363-34175385 TGGAGGAGGCAGTGGGAGCCTGG - Intronic
1115945259 14:38652735-38652757 AGGAGACAGCACTAGGAGGACGG + Intergenic
1116870573 14:50065909-50065931 AGGAGGAGACAGGAGGGGGCTGG + Intergenic
1116968702 14:51042331-51042353 AGGAGGAAGGAAGAGGAGACTGG - Intronic
1117372761 14:55093967-55093989 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1117475038 14:56085545-56085567 AGGGGAAAGCAGTAGGAAACGGG - Intergenic
1117730892 14:58720536-58720558 TGGAGGCAGGAGTCGGAGGCAGG + Intergenic
1118349822 14:64965759-64965781 AGAAGGAAGGAGGAGGAGGAAGG + Intronic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1119067405 14:71542652-71542674 AGGAGGAGGGAGGAGGAGGAGGG - Intronic
1119736309 14:76984942-76984964 AGGAGGAAGCTGATGGAGGAGGG - Intergenic
1119860007 14:77929479-77929501 AAGAGGAAGCTGTTGGAGGGAGG - Intronic
1120470513 14:84918054-84918076 AGGAGGAGGAAGGAGGAGGGGGG - Intergenic
1120603516 14:86542414-86542436 AGGAGGAGCCAGTAGAATGCTGG - Intergenic
1121083066 14:91124327-91124349 AGGAGGCATCAGGAGGAGGGAGG - Intronic
1121613128 14:95294669-95294691 AGGAAGATGAAGTAGGAGGAGGG - Intronic
1121667826 14:95686258-95686280 AGGAGGGAGGAGGAGGAGGGGGG - Intergenic
1121667839 14:95686285-95686307 AGGAGGAAGGGGGAGGAGGGAGG - Intergenic
1121735710 14:96216685-96216707 AGGAGGAGGAAGGAGGAGGAAGG + Intronic
1121735711 14:96216688-96216710 AGGAGGAAGGAGGAGGAAGGAGG + Intronic
1121735718 14:96216714-96216736 AAGAGGAAGGAGGAGGAGGAAGG + Intronic
1122061116 14:99137307-99137329 AGGAGGAGGCTGTAGCAGACGGG - Intergenic
1122440984 14:101731665-101731687 GGGAGGAAGAAATTGGAGGCTGG + Intronic
1122586072 14:102807399-102807421 AGGAGGAAACTGTAGGACACAGG - Intronic
1122607245 14:102955014-102955036 AGGAGGCTGCAGGAGGGGGCGGG - Intronic
1122850166 14:104523718-104523740 GGGAGAAAGCAGGAGCAGGCGGG + Intronic
1123033686 14:105463135-105463157 AGCAGGAAGGGGCAGGAGGCAGG - Intronic
1123117005 14:105899378-105899400 GGCAGGAAGCAGTAGCAGGAAGG + Intergenic
1123389211 15:19852676-19852698 AGGAGGAAGCAGGAGAAGGTGGG + Intergenic
1123998606 15:25735708-25735730 ACGTGGAAGCAGGAGTAGGCCGG - Intronic
1124430998 15:29608493-29608515 AGGAGGAGGCAGGAGGAGGCAGG - Intergenic
1124816754 15:33001583-33001605 AGGAGGGAGGAGGAGGAGGATGG - Intronic
1124905205 15:33861917-33861939 GGGATAAAGCAGTATGAGGCTGG - Intronic
1125119810 15:36141853-36141875 AGGAGGAAGAAAGAGGAGGAAGG + Intergenic
1125534559 15:40435983-40436005 AGGAGCCTGCAGTCGGAGGCTGG - Intergenic
1125547027 15:40513351-40513373 AGGAGGACCCAGGAGGATGCAGG - Intergenic
1125608895 15:40957810-40957832 AGGAGGAGGCAGCAGGTGGCAGG + Intergenic
1125916790 15:43494818-43494840 GGGAGGAAGCAGAAGCAGGCTGG - Intronic
1126114827 15:45199058-45199080 TGGAGGATGCAGCAGGAGGGAGG - Exonic
1126114859 15:45199218-45199240 AGGAGGAGTCAGGAGGAGTCAGG - Intronic
1126268301 15:46781010-46781032 AGGAGGGAGCAGGAGAAAGCTGG - Intergenic
1126432128 15:48597557-48597579 AAGAGGAAGCAGAAGTAGGAGGG - Intronic
1126896064 15:53258335-53258357 AGGAGGATGAAGTTGGAGGCAGG + Intergenic
1127098171 15:55534829-55534851 AGGCTGAAGCAGGAGGAAGCTGG + Intergenic
1127122083 15:55780459-55780481 AGGAGGATTAAGAAGGAGGCAGG + Intergenic
1127215618 15:56820459-56820481 AGGAGGGAGTAGTTGGAGGAGGG - Intronic
1127262135 15:57334412-57334434 GGGAGGAAGCAGTACAGGGCGGG + Intergenic
1128081267 15:64858281-64858303 AGGAGGAGGCAGTGGCAGCCAGG + Intronic
1128107469 15:65055278-65055300 GTGAGGAAGCAGTGTGAGGCAGG + Intronic
1128237990 15:66080460-66080482 AGGAGGGAGGAGGAGGAGGCAGG - Intronic
1128557463 15:68641466-68641488 GGGAGGAAGCAGAAGGAGCAGGG + Intronic
1128802022 15:70502881-70502903 TGGAGGAGGCAGTAGGTGGAGGG - Intergenic
1128836703 15:70814669-70814691 TGCAGGAAGCAGCAGGATGCTGG + Intergenic
1129824509 15:78625823-78625845 ATGATGCAGCAGGAGGAGGCTGG - Intronic
1130042700 15:80418389-80418411 AGGAGGAAGCAGCCGGATCCAGG - Intronic
1130242181 15:82204716-82204738 AGGAGGAAAGAGTAGGTGGGCGG - Intronic
1130355352 15:83124948-83124970 AGGAGGTGACAGCAGGAGGCTGG - Intronic
1130458192 15:84136106-84136128 AGGAGGAAAGAGTAGGTGGGCGG + Intergenic
1130460475 15:84155793-84155815 AGGAGGCTGCACTGGGAGGCAGG + Intergenic
1130721079 15:86386211-86386233 AGGAGGAAGGGGGAGGAGGGAGG - Intronic
1131137996 15:89953046-89953068 AGGCGGCAGCAGTCAGAGGCTGG + Intergenic
1131230616 15:90656258-90656280 AGGAGGCAGCTGTAGGCGACCGG + Intergenic
1131278658 15:91003396-91003418 GGGAGGATGCAGCAGGAGGGAGG + Intronic
1131488431 15:92841463-92841485 TGGAGGAAGCAGGAGCAGGGAGG - Intergenic
1131591847 15:93758349-93758371 AGGAGGAAGGAGAAGGAAGAAGG + Intergenic
1131612277 15:93977719-93977741 AGGAGGAAGCAGTAGGTTGAAGG - Intergenic
1131901090 15:97088613-97088635 AGGAGGAAGGAGGAGGAAGGAGG - Intergenic
1131901091 15:97088616-97088638 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1131901094 15:97088626-97088648 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1132050555 15:98604593-98604615 AGAAGGCAGCAGAAGGAGGGAGG + Intergenic
1132057129 15:98660889-98660911 AGGAGGAAGCATCTGCAGGCTGG + Intronic
1132078622 15:98845463-98845485 AGGAGGGAGGAGGAGGGGGCAGG - Intronic
1132078628 15:98845476-98845498 AGAAGGAAGGAGGAGGAGGGAGG - Intronic
1132078636 15:98845502-98845524 AGGAGGAAGGAGGAGGAGGGAGG - Intronic
1132255672 15:100373840-100373862 GGGAGGGAGCAGTGGGCGGCCGG + Intergenic
1132387545 15:101411148-101411170 ATCAGGTAGCAGCAGGAGGCGGG + Intronic
1132491051 16:231172-231194 AGGAGGGAGAAGGAGGCGGCGGG - Intergenic
1132611459 16:818380-818402 AGGCCAAAGCAGAAGGAGGCAGG + Intergenic
1132701851 16:1225352-1225374 GGGAGGACGGAGGAGGAGGCCGG + Intergenic
1132841783 16:1981532-1981554 AGGAGGAGGGAGGAGAAGGCAGG + Exonic
1132885200 16:2179386-2179408 GGGAGGAAGCCGCGGGAGGCTGG - Intronic
1133039658 16:3053676-3053698 AGCATGAAGGAGTAGGTGGCAGG + Intronic
1133043505 16:3073309-3073331 AGCATGAAGGAGTAGGTGGCAGG + Intronic
1133137300 16:3720905-3720927 AGGAGGAGGCAGAAGGAGTTTGG - Intergenic
1133208617 16:4249636-4249658 AGGAGGATGGACTAGGATGCGGG + Intergenic
1133327251 16:4949262-4949284 AGGAGGAGCCAGGAGGAGGGAGG - Intronic
1133460690 16:5984021-5984043 AGGAGGAAGAAGAAGGAAGAAGG - Intergenic
1133520126 16:6549124-6549146 GGGAGGAAGGAGGAGGAGGAGGG + Intronic
1133520172 16:6549233-6549255 GGGAGGAGGGAGTAGGAGGAGGG + Intronic
1133520173 16:6549236-6549258 AGGAGGGAGTAGGAGGAGGGAGG + Intronic
1133520184 16:6549267-6549289 AGGAGGGAGGAGGAGGAGGGAGG + Intronic
1133520188 16:6549280-6549302 AGGAGGGAGGAGTAGGAGGGAGG + Intronic
1133520237 16:6549404-6549426 AGGAGGGAGGAGGAGGAGGAGGG + Intronic
1133520247 16:6549428-6549450 AGGAGGGAGGAGGAGGAGGGAGG + Intronic
1133582614 16:7160824-7160846 AGGAGGAGGAAGGAGGAGGGAGG - Intronic
1134060021 16:11193775-11193797 AGGAGGAAGAAGAAGGAAGAAGG - Intergenic
1134287182 16:12872038-12872060 AGGAAGAAGAAGGAGGAGGGGGG - Intergenic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134815094 16:17199156-17199178 AGGAGCAATCAGTAGGAGTGGGG - Intronic
1135186070 16:20316942-20316964 ACGAGGAAGGAGAAGGAGGGAGG - Intronic
1135660956 16:24296175-24296197 AGGAGGAAGGACCAGGAGTCGGG - Intronic
1136062333 16:27735218-27735240 AGAGGGAAGCAGGCGGAGGCAGG - Intronic
1136229540 16:28878440-28878462 ATGAGGGAGCAGGGGGAGGCCGG - Exonic
1136539100 16:30918720-30918742 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1136539107 16:30918743-30918765 AGGAGGAAGGAGAAGAAGGAAGG - Intergenic
1136993921 16:35174508-35174530 AGGAGGCAGCTGTGGTAGGCTGG - Intergenic
1137333765 16:47527858-47527880 AGGACAAAGCAGCAGGAGGATGG + Intronic
1137374560 16:47941604-47941626 AAGAGGAAGGAGTAGGGGGAGGG + Intergenic
1137440879 16:48497764-48497786 AGGAAGAAGCAGCAGCATGCAGG + Intergenic
1137695744 16:50460938-50460960 AGGAGCAAGGGGTGGGAGGCGGG - Intergenic
1137709253 16:50555129-50555151 AGGAGGAAGGAGTTGGAGGTGGG + Intronic
1137775256 16:51048810-51048832 AGGAGGAACCAGGGGGAGGTGGG - Intergenic
1137783162 16:51114677-51114699 TAGAGGAAGCAGTAGGAACCCGG - Intergenic
1137844565 16:51674586-51674608 AGGAGGGAGCTGGAAGAGGCAGG - Intergenic
1137876035 16:51997577-51997599 AGGAGAAAGCTACAGGAGGCAGG + Intergenic
1137926227 16:52545621-52545643 AGGAGGGAGGAGCAGGAGGAAGG + Intronic
1138126161 16:54440458-54440480 AGGAGGAAGGAGGAGGAGGGCGG - Intergenic
1138126162 16:54440461-54440483 AGGAGGAGGAAGGAGGAGGAGGG - Intergenic
1138133962 16:54505309-54505331 AGGAGAAGGGAGTGGGAGGCAGG + Intergenic
1138153970 16:54685879-54685901 AGGAGGAGGGAGCAGGAGGGAGG - Intergenic
1138202131 16:55097142-55097164 AAGAGGAAGAAGAAGGAGTCTGG + Intergenic
1138294403 16:55874052-55874074 GGGAGGAATCAGGAGCAGGCTGG + Intronic
1138532854 16:57644160-57644182 AGGAGAAAGCAAGAGAAGGCGGG - Intronic
1138887651 16:61098901-61098923 AGGAGGAAGAAGAAGGAAGAAGG + Intergenic
1139330323 16:66183563-66183585 AGGAGGAAGGAGGAGGAAGGAGG + Intergenic
1139330325 16:66183570-66183592 AGGAGGAGGAAGGAGGAGGAAGG + Intergenic
1139330326 16:66183573-66183595 AGGAGGAAGGAGGAGGAAGGAGG + Intergenic
1139330328 16:66183580-66183602 AGGAGGAGGAAGGAGGAGGAAGG + Intergenic
1139356682 16:66371064-66371086 AGGAGGAAGCAGAAGGGGCCAGG + Intronic
1139424954 16:66873774-66873796 AGGAGGAGGGGGTAGGAGGAGGG - Intergenic
1139424990 16:66873860-66873882 AGGAGGAGGGAGGAGGAGGGAGG - Intergenic
1139424994 16:66873870-66873892 AGGAGGAAGGAGGAGGAGGGAGG - Intergenic
1139424995 16:66873873-66873895 AGGAGGAGGAAGGAGGAGGAGGG - Intergenic
1139425054 16:66874040-66874062 AGGAGGAGGGAGGAGGAGGGGGG - Intergenic
1139425060 16:66874050-66874072 AGGAGGAGGGAGGAGGAGGGAGG - Intergenic
1139432478 16:66918560-66918582 AGAAGGTGGCAGTGGGAGGCAGG - Intronic
1139558866 16:67729254-67729276 AGGAGGAAGCAGAGCAAGGCAGG + Intronic
1139589332 16:67924730-67924752 AGGAGGACTCACTAGGAAGCAGG - Intronic
1139946308 16:70644822-70644844 AGGAGGAAGGAGGAAGAGGAAGG + Intronic
1139946317 16:70644861-70644883 AGGAGGAAGTAGGAAGAGGAAGG + Intronic
1139946376 16:70645108-70645130 AGGAGGAAGAAGAGGGAGGAAGG + Intronic
1140070992 16:71649447-71649469 AGAAGGTAGCAGAAGAAGGCTGG + Exonic
1140235040 16:73151433-73151455 AGGGGGAACCAGTCAGAGGCAGG + Intergenic
1140372510 16:74420942-74420964 AGGAGGAAGGAGGAGGAAGGAGG - Intronic
1140372511 16:74420945-74420967 AGGAGGAGGAAGGAGGAGGAAGG - Intronic
1140534923 16:75700960-75700982 AAGAGGAAGCAGTAGGGAGGAGG + Intronic
1140814179 16:78605262-78605284 AGGAAGAGGAAGCAGGAGGCTGG - Intronic
1141168427 16:81676062-81676084 AGGAGGATGGAGTAGGGGGCAGG + Intronic
1141278045 16:82605888-82605910 AGGAAGCAGCAGTAGGAAGATGG - Intergenic
1141417337 16:83886148-83886170 AGGAGGAAGCAGAAGGAGGCTGG + Intergenic
1141514572 16:84535141-84535163 AGGAGGAGGGAGTAGGGGGAGGG - Intronic
1141527181 16:84618701-84618723 AGGAGGAGGGAGTAGGGGACAGG - Intergenic
1141772793 16:86101310-86101332 AGGAGGCAGGACTAGGGGGCTGG - Intergenic
1141775719 16:86121605-86121627 AGGAGGAGGGAGGAGGAGGGTGG - Intergenic
1141775724 16:86121618-86121640 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1141775797 16:86121877-86121899 AGGAGGCAGGAGTAGGAGGGAGG - Intergenic
1141775798 16:86121880-86121902 AGGAGGAGGCAGGAGTAGGAGGG - Intergenic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1141845119 16:86603377-86603399 AGGAGGAGGAAGAAGGAGGAGGG - Intergenic
1141845233 16:86603942-86603964 AGGAGGGAGGAGGAGGAGGAGGG - Intergenic
1141980582 16:87547638-87547660 ACAAGGCAGCAGCAGGAGGCTGG - Intergenic
1141992447 16:87618299-87618321 AAGAGGAGGCAGGAGGAGGGAGG + Intronic
1142197558 16:88745804-88745826 AGGAGGAAACAGGAAGGGGCGGG + Intronic
1142202907 16:88769684-88769706 AGGAGGAAGCAGTGACAGCCAGG - Intronic
1142210389 16:88805767-88805789 TGGCGGAAGCGGTAGGAGGCCGG - Exonic
1142287167 16:89176181-89176203 AGGAGGCAGCGGTTGGGGGCTGG - Intronic
1142328848 16:89437403-89437425 TGGAGGAGTCAGTGGGAGGCGGG - Intronic
1142644784 17:1304711-1304733 TGGAGGAAGCAGGAGGGGGCAGG + Intergenic
1142664224 17:1453001-1453023 AGGAGGATGAAGTGGGAGGATGG + Intronic
1142887294 17:2920645-2920667 AGGAGGAAGCAGGCGGACGAGGG + Intronic
1143091260 17:4450243-4450265 AGGAGGAAGGAGGAGGAGGAGGG - Intronic
1143483410 17:7239487-7239509 AGGAGGAGGGAGCAGGCGGCCGG - Exonic
1143487702 17:7263521-7263543 AGGAGGAAGGAGCAAAAGGCTGG - Intronic
1143539883 17:7562438-7562460 AGGATGAAGTAGGAGGGGGCTGG + Intronic
1143632895 17:8148890-8148912 AGGAGGAGGCAGAGGTAGGCCGG + Intronic
1143794687 17:9327206-9327228 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1143794690 17:9327216-9327238 AGGAGGAAGAAGGAGGAAGGAGG + Intronic
1143794699 17:9327250-9327272 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1144209726 17:13003901-13003923 GAGAGGGAGCAGGAGGAGGCAGG - Intronic
1144226977 17:13158701-13158723 AGGAGCAAGCAACTGGAGGCAGG - Intergenic
1144338662 17:14295694-14295716 AGAAGGAAGGAGGAGGAAGCAGG + Intergenic
1144338665 17:14295704-14295726 AGGAGGAAGCAGGTGTGGGCAGG + Intergenic
1144579407 17:16449990-16450012 AGGAGGAAACAGTCTGTGGCAGG + Intronic
1144761139 17:17708135-17708157 AGGAGGAAGGAGGAGGAGCAAGG - Intronic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1145302418 17:21649896-21649918 AGGAAGAAGCAGAGGGAGGGAGG - Intergenic
1145347902 17:22053416-22053438 AGGAAGAAGCAGAGGGAGGGAGG + Intergenic
1145415691 17:22711966-22711988 AGGAAGAAGCAGAGGGAGGGAGG - Intergenic
1146380410 17:32323378-32323400 GGGAGGATGCAGAAGGAGTCAGG + Exonic
1146673679 17:34758586-34758608 AGGAGAAAGAAGAAGGAGGAAGG + Intergenic
1147055406 17:37830545-37830567 AGGGGGAAAGAGTAGCAGGCAGG + Intergenic
1147498808 17:40942517-40942539 AGAAGGAAGAAGGAGGAGGAGGG - Intergenic
1147498849 17:40942749-40942771 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1147498859 17:40942810-40942832 AGAAGGAAGAAGGAGGAGGAGGG - Intergenic
1147612428 17:41809843-41809865 GGGAGGCAGCAGTGAGAGGCTGG + Intronic
1147775511 17:42898097-42898119 TGGAGGAAGCAGAAAGGGGCTGG + Intergenic
1148024625 17:44578056-44578078 AGGAGGAAGCAATTTGAGGCAGG - Intergenic
1148108670 17:45132540-45132562 CGGAGGAGGCAGCAGGAGGTGGG + Intronic
1148324778 17:46776898-46776920 AGGGGGAGGAAGGAGGAGGCAGG - Intronic
1148355384 17:46972224-46972246 AGGAGGAAGAAGCGGGTGGCGGG - Intronic
1148437281 17:47694271-47694293 AGGAGGAGGCGGCAGGAGGGCGG + Intronic
1148789051 17:50162967-50162989 AGAAGGAAGAAGAAGGAGGGAGG + Intergenic
1148789059 17:50162997-50163019 AGAAGGAAGAAGAAGGAGGGAGG + Intergenic
1149273165 17:55004726-55004748 AGGGGGAAGGAGGAGGAGGCGGG + Intronic
1149563777 17:57627738-57627760 AGGACGGAGCAGGAGGAGGAGGG - Intronic
1149775732 17:59355582-59355604 AGGAGGGAGGTGTAGGAGGAGGG - Intronic
1149891268 17:60392159-60392181 AGAAGGGCGGAGTAGGAGGCAGG - Intronic
1150150648 17:62806568-62806590 AGGAGGAGGGAGTTGGAGGCAGG + Intronic
1150309365 17:64115253-64115275 AACAGGAAGAAGTATGAGGCAGG - Intronic
1150330212 17:64288187-64288209 AGGAGGAAGAGGGAGGAGGGAGG + Intergenic
1150702273 17:67458183-67458205 AGGAGGAAGCAGGAGGAGGCAGG - Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1151467481 17:74296758-74296780 AAGAGGGAGCAGAATGAGGCTGG - Intronic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1151683483 17:75633877-75633899 AGGAGGAAGGAGGAGGAGAGAGG + Intronic
1151801358 17:76381804-76381826 AGGAGGAGGAAGCAGCAGGCCGG - Intronic
1151861035 17:76762083-76762105 GGGAGGTTGCATTAGGAGGCTGG - Intronic
1151947184 17:77326089-77326111 TGGAAGAAGGGGTAGGAGGCGGG - Intronic
1151968775 17:77446312-77446334 AGGAGGAGGCTGTAGGAGGATGG - Intronic
1152000073 17:77639879-77639901 AGGAGGGAGGAGGAGGAGGAAGG - Intergenic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152043050 17:77917436-77917458 AGGAGGAGGGAGGAGGAGGGAGG + Intergenic
1152422658 17:80202478-80202500 AGGAGGAAGCCGAGGCAGGCTGG - Intronic
1152587229 17:81194498-81194520 AGGAGGAGGCAGGGGCAGGCAGG - Intronic
1152598375 17:81249257-81249279 AGGAGGAGGGAGGAGGAGGAAGG + Intronic
1152818814 17:82425167-82425189 TGGAGGAGGCTGGAGGAGGCCGG + Intronic
1152818823 17:82425197-82425219 TGGAGGAGGCTGGAGGAGGCTGG + Intronic
1152913131 17:83016781-83016803 GGGAGGAAGGAGGAGGAGGAGGG + Intronic
1153185255 18:2478918-2478940 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1153410700 18:4789455-4789477 TGGAGGATGCAGTGGGAGGAGGG - Intergenic
1153501895 18:5758123-5758145 ATCAGGAAGCAGTAAGTGGCAGG + Intergenic
1153592853 18:6692319-6692341 AGGAGGAACCAGGACTAGGCAGG + Intergenic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1154532676 18:15363438-15363460 AGGAGGAAGCAGGAGAAGGTGGG - Intergenic
1155066538 18:22273768-22273790 AGGAGGATGGAGGAGGAGGAGGG - Intergenic
1155066546 18:22273791-22273813 AGGAGGATGGAGGAGGAGGAGGG - Intergenic
1155066550 18:22273801-22273823 AGGAGGAAGGAGGAGGATGGAGG - Intergenic
1155066572 18:22273863-22273885 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1155066581 18:22273889-22273911 AGGAGGAGGAAGGAGGAGGAGGG - Intergenic
1155066597 18:22273938-22273960 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1155066606 18:22273964-22273986 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1155066610 18:22273974-22273996 AGGAGGGAGGAGGAGGAGGGAGG - Intergenic
1155066611 18:22273977-22273999 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1155066620 18:22274003-22274025 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1155372818 18:25121252-25121274 AGGAAGAAGAAGAAGAAGGCTGG - Intronic
1156017496 18:32563145-32563167 AGCAAGAACCAGTAGGAGGAAGG + Intergenic
1156560813 18:38123368-38123390 AGGAAGTTGCAGTAGGAGGAAGG - Intergenic
1156862752 18:41857237-41857259 AGGAAGAAGTAGAAGGAGACGGG + Intergenic
1157006482 18:43589885-43589907 GGGCCGAAGCAGCAGGAGGCTGG + Intergenic
1157280502 18:46343975-46343997 AGGAGGAAGCAGCAGCATCCGGG - Intronic
1157382017 18:47227145-47227167 AGGAGGAAGAAGGAGGAAGATGG - Intronic
1157449372 18:47773748-47773770 GGGAGGGAGCAGGGGGAGGCAGG + Intergenic
1157498616 18:48173585-48173607 AGTAGGCAGTAGTGGGAGGCAGG + Intronic
1157620418 18:49014091-49014113 AGGAGGAAGCTGAAGGTAGCGGG - Intergenic
1157768650 18:50325088-50325110 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1157768652 18:50325095-50325117 AGGAGGAAGGAGGAGGAAGGAGG - Intergenic
1157768653 18:50325098-50325120 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1157768655 18:50325105-50325127 AGGAGGAAGGAGGAGGAAGGAGG - Intergenic
1157768656 18:50325108-50325130 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1157768658 18:50325115-50325137 AGGAGGAAGGAGGAGGAAGGAGG - Intergenic
1157768659 18:50325118-50325140 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1157768661 18:50325125-50325147 AGGAGGAAGGAGGAGGAAGGAGG - Intergenic
1157768662 18:50325128-50325150 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1158396031 18:57078837-57078859 AGGAGGCAGCAGTGGGTGTCGGG + Intergenic
1158412691 18:57221884-57221906 AGGAGGAAGCAGTGGTAAGAGGG + Intergenic
1158940429 18:62402330-62402352 AGGAGGCCGCAGCAGGAGACAGG + Intergenic
1159174266 18:64813706-64813728 AGTCGGAGGCAGTCGGAGGCTGG - Intergenic
1159586659 18:70288987-70289009 AGGAGGAGGAGGAAGGAGGCGGG + Exonic
1160021799 18:75187035-75187057 AGGAGTCAGGAGGAGGAGGCAGG - Intergenic
1160367306 18:78337436-78337458 AGGTAGGAGCAGCAGGAGGCCGG - Intergenic
1160408117 18:78656651-78656673 GGGATGGTGCAGTAGGAGGCTGG - Intergenic
1160498592 18:79389930-79389952 AGGGGGAGGCAGAGGGAGGCAGG + Intergenic
1160560703 18:79754229-79754251 AGGAGGGAGCAGCAGGCGGCGGG - Exonic
1160827677 19:1088383-1088405 AGGAGGAAGCAGTGGCTGGTGGG + Exonic
1160901851 19:1432746-1432768 GGGAGGAAGCAGAAGAAGGCAGG - Intronic
1161314006 19:3609410-3609432 AGGAGGAGGAAGCAGGATGCTGG + Intergenic
1161403971 19:4081697-4081719 AGGAGGGGGGAGTAGGAGGGAGG - Intergenic
1161404019 19:4081849-4081871 AGGAGGGAGGAGTAGGAGGGAGG - Intergenic
1161404042 19:4081925-4081947 AGGAGCAAGAAGGAGGAGGAGGG - Intergenic
1161586979 19:5110950-5110972 AGGAGGACGAAAGAGGAGGCGGG - Intronic
1161734388 19:5982045-5982067 AGGAGGATGAAGTGGGAGGATGG + Intergenic
1161800575 19:6415101-6415123 AGGAGAAAGGAGGAGGAGGAGGG + Intronic
1161934344 19:7362304-7362326 AGGAGGAAGAAGAAGGAAGAAGG + Intronic
1162052491 19:8043055-8043077 AGTAGGTAGCAGTGGGAGGGAGG + Intronic
1162339208 19:10081742-10081764 AGGAGGAGGGAGGAGGAGGAAGG + Intergenic
1162339212 19:10081755-10081777 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1162854087 19:13454852-13454874 AGGAGGCTGCAGTGGGAGGATGG + Intronic
1163094730 19:15048823-15048845 AGGAGGCTGAGGTAGGAGGCTGG - Intergenic
1163153020 19:15425809-15425831 AGGAGGAGGGAGGAGGAGGGAGG + Intronic
1163153024 19:15425819-15425841 AGGAGGAGGGAGGAGGAGGGAGG + Intronic
1163153028 19:15425829-15425851 AGGAGGAGGGAGGAGGAGGAGGG + Intronic
1163153029 19:15425832-15425854 AGGAGGGAGGAGGAGGAGGGAGG + Intronic
1163643666 19:18476149-18476171 AGGAGGGAGCAGCAGGGGACTGG + Intronic
1163827730 19:19533015-19533037 AGGAGGTGGCAGAAGCAGGCGGG - Intronic
1163833180 19:19557524-19557546 AGGAGGAAGCAGCAGGGCGGGGG - Intergenic
1164064760 19:21706389-21706411 AGGAGGAGGCAGCAGGAAGCTGG - Intergenic
1164452797 19:28381273-28381295 AGGAGGGTGCAGGAGGAGGCAGG + Intergenic
1164521193 19:28981635-28981657 GGGAGGAAGGTGAAGGAGGCGGG + Intergenic
1164573568 19:29391881-29391903 AGTAGGAAGTTGTAGCAGGCTGG - Intergenic
1164809806 19:31147138-31147160 GGGAAGAAGCTGTAGGGGGCTGG + Intergenic
1165095596 19:33408105-33408127 AGGACGGAGCAGTAGGAGGGGGG + Intronic
1165416022 19:35694062-35694084 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1165416026 19:35694072-35694094 AGGAGGAGGGAGGAGGAGGGAGG - Intergenic
1165416030 19:35694082-35694104 AGGAGGGAGAAGGAGGAGGGAGG - Intergenic
1165416031 19:35694085-35694107 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
1165416035 19:35694098-35694120 AGGAGGAAGGAAGAGGAGGAGGG - Intergenic
1165468769 19:35990826-35990848 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165468771 19:35990836-35990858 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165468773 19:35990846-35990868 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165468775 19:35990856-35990878 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165690893 19:37862392-37862414 AGGAGGAGGAAGGAGGAGGGGGG + Intergenic
1165690894 19:37862395-37862417 AGGAGGAAGGAGGAGGGGGGAGG + Intergenic
1165690932 19:37862582-37862604 AGAGGGAAGCAGAAGGAAGCAGG + Intergenic
1165907926 19:39204904-39204926 GGGAGGCAGGAGTGGGAGGCTGG + Intergenic
1166222117 19:41372094-41372116 AGGCTGAGGCAGTAGGGGGCGGG + Intronic
1166222558 19:41375131-41375153 AGGAGGAAGCAGAGGCAGGTGGG - Intronic
1166331410 19:42079993-42080015 AGGAGGCAGCGGTAGGTGCCTGG - Exonic
1166404584 19:42510989-42511011 AGGAGGTGGCAGTTGGAGGGTGG + Intronic
1166532874 19:43553023-43553045 AGGAGGCAGCACTAGAAGCCTGG + Exonic
1166591153 19:44000483-44000505 AGGCAAAAGCAGTAGGAGGAGGG + Intergenic
1166652145 19:44582693-44582715 AGGAGGAAGAAGGAGAAGGAGGG + Intergenic
1166895460 19:46019424-46019446 AGGAGGCAGAGGTAGGAGTCAGG + Intronic
1166959407 19:46488726-46488748 AGGCTGGAGCAGGAGGAGGCTGG - Intronic
1167214211 19:48153711-48153733 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214224 19:48153793-48153815 AAGAGGAAGGAGGAGGAGGAAGG - Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167431875 19:49459816-49459838 AGGAGGAGGCACTGGCAGGCTGG + Exonic
1167608171 19:50492805-50492827 AAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1167608204 19:50492919-50492941 AGGAGGAGGGAGTAAGAGGAAGG + Intergenic
1167665529 19:50821110-50821132 GGGAGGAGGAAGGAGGAGGCGGG - Intronic
1167671719 19:50857348-50857370 AGGAGGAAGGAGAAGGGGGAAGG + Intronic
1168063262 19:53906025-53906047 AGGAGGGAGGAGGAGGAGGAGGG - Intronic
1168071113 19:53952383-53952405 GGGAGGAAGAAGTGGGAGGATGG + Intergenic
1168284348 19:55322983-55323005 AGGAGGAAGGAGTTGGAGCTTGG - Intronic
1168510196 19:56967510-56967532 AGGAGGGAGGAGAAGGAGGAAGG - Intergenic
1202715289 1_KI270714v1_random:38972-38994 AGGAGGAAGACCTGGGAGGCTGG - Intergenic
926194684 2:10755629-10755651 AGGGGCAAACAGTAGGAGCCGGG - Intronic
926266793 2:11330743-11330765 AGGAGGGAGGAGGAGGAGGGAGG + Intronic
926266797 2:11330753-11330775 AGGAGGAGGGAGGAGGAGGAGGG + Intronic
926266798 2:11330756-11330778 AGGAGGGAGGAGGAGGAGGGAGG + Intronic
926266890 2:11331025-11331047 AGGAGGAGGGAGGAGGAGGGAGG + Intronic
927341659 2:21990381-21990403 AGGAGGAACCAGCATGAGGTTGG - Intergenic
927459939 2:23289815-23289837 GAGAGGAAGCAGTGGGAAGCTGG - Intergenic
928299280 2:30111256-30111278 AGGAGGGAGCTGTTGGAGGCAGG + Intergenic
928317742 2:30258926-30258948 TGCAGGAAGCAGTGGGAGGTGGG - Exonic
929092093 2:38228932-38228954 AGGAGGGAGAAGAAGGAGGGAGG + Intergenic
929762376 2:44816754-44816776 AGGAGGAAGCAGCCCGAAGCAGG + Intergenic
929778265 2:44941960-44941982 AGGGGGGAGCAGGAGGAGGAGGG - Exonic
929936461 2:46297522-46297544 AGTCGGAAGGAGTCGGAGGCCGG - Exonic
930004292 2:46883550-46883572 AGGAGGATGCAGGAAGAGGCAGG + Intergenic
930145372 2:47996960-47996982 AGGTGGAAGCAGTGGTATGCTGG + Intergenic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930584390 2:53252396-53252418 TGGAGGAAGCTGTAGGGGGTGGG + Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931441574 2:62294002-62294024 AGGAGGAGCTGGTAGGAGGCGGG - Intergenic
931671717 2:64653829-64653851 CGGAGGAGGAAGCAGGAGGCGGG + Exonic
931671718 2:64653832-64653854 AGGAGGAAGCAGGAGGCGGGCGG + Exonic
932208156 2:69902268-69902290 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
932208162 2:69902288-69902310 AGGAGGAAGAAGGAGGAGGAAGG - Intronic
932217492 2:69976291-69976313 AGGAGGAGGCAGTGTGGGGCTGG - Intergenic
932221132 2:69999877-69999899 GGGAGGAAGGAGGAGGAGCCCGG - Intergenic
932271365 2:70413069-70413091 AGGAGGATGGAGGAGGAGGTGGG + Intergenic
932331800 2:70901927-70901949 AAGAGGCAGCAGGAGGAAGCCGG - Intronic
932406395 2:71515588-71515610 AGGAGGAAAGAGCAGGAGGAAGG - Intronic
932562072 2:72881978-72882000 AGAAGACAGCAGTAGGAGGTGGG - Intergenic
932610241 2:73193599-73193621 AGGAGGCAGAGGTAGGAGGATGG + Intergenic
932637133 2:73400040-73400062 AGGAGGGTGAAGTAGGAGGACGG - Intronic
932696524 2:73961479-73961501 AGGAGGCTGAAGTAGGAGGATGG - Intergenic
933661725 2:84933056-84933078 AAGAAGAAGAAGTAGGGGGCAGG + Intergenic
933727675 2:85435823-85435845 AGGTGGGAGCTGGAGGAGGCAGG + Exonic
934535342 2:95128707-95128729 AGGAGAAAGAAGGAGGAGGGAGG + Intronic
934572125 2:95379430-95379452 AGGATGGAGCTGTGGGAGGCTGG - Intronic
935099107 2:99975592-99975614 AGGAGGAAGCAGTAGGAGGCAGG + Intronic
935442853 2:103122583-103122605 GGGAGGAAGCAGGAAGAAGCTGG + Intergenic
935444920 2:103146182-103146204 AGGAGGCTGAAGTAGGAGGGTGG - Intergenic
935942629 2:108256953-108256975 AGGAGGAAGCAGAGGAAGACAGG + Intronic
936379385 2:111970685-111970707 AGGTGGAAGGAGGAGGAGGGAGG - Intronic
936379415 2:111970770-111970792 AGGAGGGAGGAGGAGGAGGAGGG - Intronic
936379429 2:111970802-111970824 AGGAGGGAGGAGGAGGAGGAGGG - Intronic
936379434 2:111970815-111970837 AGGAGGAGGGAGGAGGAGGGAGG - Intronic
936395561 2:112125630-112125652 AGGAGGAAGAGGAAGGAGGGAGG + Intergenic
937217299 2:120321072-120321094 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217303 2:120321085-120321107 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217307 2:120321098-120321120 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217311 2:120321111-120321133 AGGAGGGAGAAGGAGGAGGAGGG - Intergenic
937217316 2:120321127-120321149 AGGAGGAGGGAGAAGGAGGAGGG - Intergenic
937217320 2:120321140-120321162 AGGAGGGAGAAGGAGGAGGAGGG - Intergenic
937217325 2:120321156-120321178 AGGAGGGAGGAGGAGGAGGAGGG - Intergenic
937217331 2:120321172-120321194 AGGAGGGAGGAGGAGGAGGAGGG - Intergenic
937217337 2:120321188-120321210 AGGAGGGAGGAGGAGGAGGAGGG - Intergenic
937217343 2:120321204-120321226 AGGAGGGAGGAGGAGGAGGAGGG - Intergenic
937217348 2:120321217-120321239 AGGAGGGAGGAGGAGGAGGGAGG - Intergenic
937217349 2:120321220-120321242 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
937217354 2:120321233-120321255 AGGAGGGAGGAGGAGGAGGAGGG - Intergenic
937217360 2:120321249-120321271 AGGAGGGAGGAGGAGGAGGAGGG - Intergenic
937217366 2:120321265-120321287 AGGAGGGAGGAGGAGGAGGAGGG - Intergenic
937217372 2:120321281-120321303 AGGAGGGAGGAGGAGGAGGAGGG - Intergenic
937217378 2:120321297-120321319 AGGAGGGAGAAGGAGGAGGAGGG - Intergenic
937217383 2:120321313-120321335 AGGAGGGAGAAGGAGGAGGAGGG - Intergenic
937217388 2:120321329-120321351 AGGAGGGAGAAGGAGGAGGAGGG - Intergenic
938531774 2:132194665-132194687 AGGAGGAAGCAGGAGAAGGTGGG - Intronic
939373847 2:141338305-141338327 AAGAGGAAGCAGAAGAAAGCAGG + Intronic
939878796 2:147606795-147606817 AGGAGGTAGCAGGAGGAGATAGG + Intergenic
940126377 2:150330532-150330554 AGGAAGAAGAAGAAGAAGGCTGG + Intergenic
940852212 2:158699169-158699191 AGGAGGAAGGAGGGGGAGGAGGG + Intergenic
940878566 2:158922781-158922803 TGGTGATAGCAGTAGGAGGCAGG - Intergenic
941704537 2:168643955-168643977 AGGAGACACCAGTAGGAGACCGG - Intronic
942007039 2:171713858-171713880 ATAAGGAAGCAATGGGAGGCAGG - Intronic
942147067 2:173037444-173037466 AGGAGTAAGGACTAGGAGGAGGG - Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942524791 2:176841746-176841768 AGGAGGGAGAAGGAGGAGGAGGG - Intergenic
942524805 2:176841795-176841817 AGGAGGAAGGAGGAGGAAGGTGG - Intergenic
942524806 2:176841798-176841820 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
942866345 2:180680015-180680037 AGGAGGAAGCAGGTCTAGGCAGG - Intergenic
943746321 2:191465970-191465992 AGGAGGGAGAAGTTGGAGGGGGG - Intergenic
944718593 2:202400244-202400266 AGGAGGCTGAAGTAGGAGGATGG - Intronic
944770809 2:202912475-202912497 AGGAGGAGGCAGGAGGAAGACGG - Intronic
944849895 2:203707738-203707760 AGGTGGCAGCTATAGGAGGCAGG + Intronic
945243021 2:207693737-207693759 AGGTGGAAACAGTAAGAGCCTGG + Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945694280 2:213083241-213083263 AGTAGGAACCAGTAGGAAACTGG + Intronic
946148550 2:217748920-217748942 AGGAGGAGGCAGCAGGAAGGGGG - Intronic
946177128 2:217928757-217928779 AAGAGGAAGCAGTGGGCAGCTGG - Intronic
946202190 2:218076807-218076829 GGGAGGCAGCAGAGGGAGGCAGG - Intronic
946226604 2:218267204-218267226 AGGGGGAAGGCATAGGAGGCTGG - Intronic
947536287 2:230942273-230942295 AGGAGGCAGAAGAAGGAGGCAGG - Intronic
947574058 2:231258475-231258497 AAGAGTAAGCAGTCGGGGGCCGG - Intronic
947765047 2:232632728-232632750 AGGAGGCTGAAGTAGGAGGATGG - Intronic
947817458 2:233047798-233047820 AGGAGGAGGCGGGAGGAGGATGG + Intergenic
948091759 2:235301652-235301674 AGGAGGGAGGAGAAGGAGGGAGG - Intergenic
948091951 2:235302225-235302247 AGGAGGAAGAGGGAGGAGGAGGG - Intergenic
948137030 2:235644088-235644110 AGCAGGGAGCAGTGGGAGCCCGG + Intronic
948342745 2:237268434-237268456 AAGAGGACACAGTAGGAGGCAGG - Intergenic
948588740 2:239036568-239036590 GGCAGGAAGCAGGAGGGGGCGGG - Intergenic
948674603 2:239589492-239589514 AGGAGGAAGGAGAAGGAAGTGGG + Intergenic
948709806 2:239818681-239818703 TGGGGGAAGCTGTAGGAGGGAGG - Intergenic
1168833685 20:862157-862179 AGGATGAAGCAACATGAGGCTGG + Intergenic
1168846673 20:949884-949906 AGGAGGAAGCAGGAGCCGCCAGG - Intergenic
1168846960 20:951897-951919 ACCAGGAAGCAGAAGGAGCCAGG - Intergenic
1169070923 20:2729860-2729882 TGAAGGAAGCAGGAGGAGGCAGG + Intronic
1169210868 20:3765707-3765729 AGGGGGAGGCAGGAGGAGGGAGG - Intronic
1169220258 20:3818494-3818516 AGGAGACAGCTGTGGGAGGCTGG - Intergenic
1169752327 20:9007008-9007030 AGGAGGTAGTATTAGGAGGTGGG + Intergenic
1170034312 20:11973855-11973877 AGGAGGAAGAAGGAGGAAGGAGG + Intergenic
1170434840 20:16315666-16315688 AGCAGGAAGCAGGATGGGGCTGG + Intronic
1170823238 20:19771865-19771887 AAGAGGAGGCAGGAGGAGGCAGG - Intergenic
1170836938 20:19892671-19892693 AGAAGGAAGAGGAAGGAGGCTGG - Intronic
1170902323 20:20477086-20477108 ACGAGCAAGAATTAGGAGGCTGG + Intronic
1171147986 20:22802510-22802532 AGGAGGGGGCAGTAGCAGGAGGG + Intergenic
1171958284 20:31475859-31475881 AGGAGGAAGAGGCAGGAGGGCGG - Intronic
1172664158 20:36587523-36587545 AGGAGGCAGCTGTGGGAGGGAGG + Intronic
1172834478 20:37864114-37864136 AGGTGGAAGGGGTGGGAGGCTGG + Intronic
1172853511 20:37983589-37983611 AGGAGGAACCAGGTGGAGTCTGG + Exonic
1172974030 20:38893568-38893590 GGGAGGAAGTGGGAGGAGGCGGG + Intronic
1172974034 20:38893578-38893600 GGGAGGAGGCGGGAGGAGGCGGG + Intronic
1173107856 20:40154648-40154670 GGGAAGAAGCAGTTGGAGGTTGG + Intergenic
1173183820 20:40824079-40824101 GGGAGAAAGCTGGAGGAGGCTGG - Intergenic
1173239951 20:41286214-41286236 AGAAGGAAGGATTAGGAGTCAGG - Intronic
1173615633 20:44401284-44401306 GGGAGGAGGCAGTGGGAGGGCGG + Exonic
1173848588 20:46203279-46203301 GGGAGGAAGCAGTGTGTGGCAGG + Intronic
1173946993 20:46959551-46959573 AGGAGGATGCCGTGGGAGGCGGG - Intronic
1173958235 20:47051333-47051355 GGGAGGAAGAAGTAGGGGGGCGG + Intronic
1174230374 20:49041164-49041186 AGGAGGGAGCAGCTGGAGGAGGG + Intergenic
1174301352 20:49584824-49584846 AGGAGGCAGCAGTGGGACTCCGG + Intergenic
1174311973 20:49663597-49663619 GGGAGGCTGAAGTAGGAGGCTGG + Intronic
1174405324 20:50299067-50299089 AGGAGGAAAAAGCAGGAGGAGGG + Intergenic
1174639363 20:52029899-52029921 AGGAGGATGAGGTAGGAGGATGG - Intergenic
1174641771 20:52050472-52050494 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1175069682 20:56322726-56322748 AGGAGAAACGAGAAGGAGGCAGG + Intergenic
1175419602 20:58822998-58823020 ATGAGGAAACAGTAGGCGCCAGG - Intergenic
1175605906 20:60312011-60312033 AAGGGGAGGCAGCAGGAGGCAGG + Intergenic
1175745204 20:61451706-61451728 AGGAGGAGGGGGTAGGAGGCTGG + Intronic
1175867083 20:62184625-62184647 TGGAGGCAGGAGCAGGAGGCCGG - Intronic
1175879310 20:62247582-62247604 AGGAGGAGGCAGGAGGAGGCAGG + Intronic
1176025198 20:62982119-62982141 AGGAGGCAGCAGGAACAGGCTGG + Intergenic
1176057102 20:63154725-63154747 AGCAGGAAGGAGGAGGAGGGAGG - Intergenic
1176214416 20:63941502-63941524 AAGAGGAAGCAGAAGTGGGCCGG + Intronic
1176257294 20:64158936-64158958 AGGAGGAAGCAGGTGGGTGCAGG - Intronic
1176293271 21:5057456-5057478 AGGAGGACGGAGTCGGAGACTGG - Intergenic
1176385508 21:6137080-6137102 AGGAGGAGGCAGAAGTGGGCAGG - Intergenic
1178691511 21:34754124-34754146 TGGGGGCAGCAGTAGGAGGTGGG - Intergenic
1178796559 21:35750303-35750325 AGGAGGTTGAGGTAGGAGGCTGG - Intronic
1178824598 21:36004898-36004920 AGGGGGAGGCAGGGGGAGGCAGG + Intergenic
1179088802 21:38244613-38244635 CGGAGGAGGCAGTTGGAGACTGG - Intronic
1179157414 21:38862581-38862603 AAGAGGACCCAGGAGGAGGCTGG + Intergenic
1179290603 21:40014714-40014736 AGAAGGAAGCAAAAGGAAGCAGG - Intronic
1179488587 21:41726499-41726521 AGGAGGAAGGAGGAGCAGGAAGG - Intergenic
1179737965 21:43401172-43401194 AGGAGGAGGCAGAAGTGGGCAGG + Intergenic
1179863989 21:44206194-44206216 AGGAGGACGGAGTCGGAGACTGG + Intergenic
1180106621 21:45622978-45623000 AGAAGGAAGCCGTGGGATGCAGG - Intergenic
1180429265 22:15231220-15231242 AGGAGGAAGCAGGAGAAGGTGGG + Intergenic
1180511878 22:16099577-16099599 AGGAGGAAGTAGGAGAAGGTGGG + Intergenic
1181690769 22:24558633-24558655 GCAAGGAAGCAGTAGTAGGCAGG + Intronic
1181757304 22:25033084-25033106 AGAAGGAAGAAGTAGGTGGCTGG + Intronic
1181844741 22:25698124-25698146 AGGAGGAAGGAGAGGGAGGAAGG + Intronic
1181860334 22:25813133-25813155 AGGAAGAAGGAGGAGGAGGAGGG - Intronic
1181886082 22:26023501-26023523 AGGAGGAGGGAGGAGGAGGGAGG - Intronic
1181906341 22:26200133-26200155 AGGAGGAAGTTGTTTGAGGCAGG - Intronic
1182018863 22:27064042-27064064 AGAAGAAAGAAGGAGGAGGCTGG + Intergenic
1182377023 22:29856136-29856158 AGGAGGACACAGTAGGTGGCTGG - Intergenic
1182445352 22:30386715-30386737 AGGAGGCACCAGTGGAAGGCTGG - Exonic
1182547780 22:31085654-31085676 AGGAGGGAGCTGTGGGAGGGAGG - Intronic
1182931381 22:34177464-34177486 AGGAGGGAGGAGAAGGAGGGAGG - Intergenic
1182931463 22:34178272-34178294 AGGAGGGAGGAGAAGGAGGGAGG - Intergenic
1183313591 22:37124925-37124947 AAGAGGAAGCAGCTGGCGGCAGG - Intergenic
1183491852 22:38120994-38121016 AGGAGGTGGCAGGAGGAAGCGGG + Intronic
1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG + Intergenic
1183971922 22:41483766-41483788 AGGAGGCTGCAGTGGGAGGATGG + Intronic
1183977954 22:41524002-41524024 AGGAGGAGGCAGAAGGAGATGGG + Intronic
1184227305 22:43136469-43136491 AGGAGGCAGCAGCTGGAGGACGG - Intronic
1184272007 22:43389688-43389710 AGGAGGGAGAAGGAGGAGGAGGG - Intergenic
1184296102 22:43526545-43526567 AGGAGGAGCCAGCAGGAGCCAGG + Intergenic
1184444870 22:44541174-44541196 GGGAGGAAGGAGTAGGAGTGAGG - Intergenic
1184453654 22:44597283-44597305 AGGAGGATGAGGTAGGAGTCAGG + Intergenic
1184459293 22:44628073-44628095 AGGAGGAGGCAGATGGAGGGGGG - Intergenic
1184509344 22:44924041-44924063 AGGAGGAAGAAGAGGGAGGGAGG + Intronic
1184686503 22:46098763-46098785 AGGGGCAAGGAGCAGGAGGCCGG - Intronic
1184762875 22:46554863-46554885 AGGAGTAAGCAGCAGGGGCCAGG + Intergenic
1184959365 22:47917906-47917928 GGGAGGAAGGAGAAGGAGGAAGG - Intergenic
1185021631 22:48380015-48380037 AGGAGGTACCAGAAGGAGGGTGG + Intergenic
1185036957 22:48484486-48484508 AGAAGGAAGGAGAAGGAGGGAGG - Intergenic
949142539 3:652316-652338 AGGATGAGGCAGTAGGAGGAAGG - Intergenic
949965587 3:9353342-9353364 AGGAGGAACCACTAGGTGGCAGG + Intronic
950357211 3:12421772-12421794 AGGAGGGCACAGGAGGAGGCTGG - Intronic
950469367 3:13174934-13174956 AGGAGGGACCAGCAGGAGCCAGG - Intergenic
950507986 3:13407563-13407585 GGGAGGGAGGAGTGGGAGGCAGG - Intronic
950753908 3:15156064-15156086 AGGAGGAAAGGGAAGGAGGCAGG + Intergenic
950895820 3:16449934-16449956 ACCAGGAAGCAGCAGGAGGAGGG + Intronic
951194148 3:19804731-19804753 AGGAGGAGGGAGGAGGAGGGAGG + Intergenic
951412343 3:22380215-22380237 AGGAGAAATCAGTAGGAGAGTGG + Intergenic
951425103 3:22535495-22535517 AGGAGGAAGGGGCAGGAAGCAGG + Intergenic
951578480 3:24137641-24137663 ATGAGGAAGCAGAGGTAGGCAGG + Intronic
951824999 3:26859056-26859078 AGGAAGAATCACTAGGAGGAAGG + Intergenic
951884713 3:27513120-27513142 AGAAGGAAGAAGCAGGAGGCAGG + Intergenic
951964993 3:28372048-28372070 AGGAGGAAGAAGGAGGAGGAGGG - Intronic
952241201 3:31532886-31532908 AGGAGGAAGAAAAAGGAGGAGGG - Exonic
952311355 3:32193312-32193334 AGGAGGCTGAAGTAGGAGGGTGG - Intergenic
952952047 3:38533187-38533209 AGGAGCCAGAAGTAGAAGGCAGG - Intronic
952978601 3:38717329-38717351 AGGAAGAATCAGTAGGAAGATGG + Intronic
953230263 3:41058369-41058391 AGGAGGAAGAGGAAGGAGGGAGG + Intergenic
953457128 3:43052337-43052359 AGCAGGGAGCAGCAGGAGGCTGG - Intronic
953544934 3:43857514-43857536 AGGAGCAGGCAGCAGGAGGTGGG - Intergenic
953628121 3:44587636-44587658 AGGAGGAAGCAGGACCAGACAGG - Intronic
953850772 3:46464208-46464230 AGAAGGAAGGAGTAGAAGGAAGG - Intronic
953996375 3:47523058-47523080 AGGCGGAAGCAGGATGGGGCAGG - Intergenic
954121849 3:48504242-48504264 AGGAGGAGGGAGGAGGAGGGAGG + Exonic
954372441 3:50175951-50175973 AGGAGGTGGCAGCAGGTGGCAGG - Intronic
954656608 3:52197948-52197970 AGGAGGAAGCGCTAGGCGGTGGG - Intergenic
955075398 3:55608595-55608617 AGAAGGAAGCCAGAGGAGGCTGG - Intronic
955307439 3:57848483-57848505 AGAAGGAAGTAGGAGGAGGGAGG - Intronic
955307457 3:57848584-57848606 AGGAGGAAGGAGGAAGAGGAGGG - Intronic
955314644 3:57926320-57926342 AGGAGGAAGGGGAAGAAGGCTGG - Intronic
955379060 3:58422230-58422252 AGGTGGAAACTGGAGGAGGCAGG - Intronic
955617811 3:60827324-60827346 AGGAGGCACCAGTAGAATGCTGG + Intronic
955808404 3:62760585-62760607 AGGAGGAGGCAGGAGGTGGCAGG - Intronic
955915133 3:63899977-63899999 AGGAGGCTGCAGCAGGAGGATGG + Intronic
955941489 3:64150532-64150554 AGGAGGAGGAAGAAGGAGGGTGG - Intronic
956292019 3:67670473-67670495 AGGAAGAAGTAGTTGGGGGCTGG + Intergenic
956737619 3:72250195-72250217 GGGGAGAAGCAGGAGGAGGCTGG + Intergenic
956922494 3:73944629-73944651 AGGAGGTAGCCTTTGGAGGCCGG - Intergenic
956976511 3:74587172-74587194 AGGTGGGGGCAGAAGGAGGCAGG + Intergenic
959034672 3:101346992-101347014 AGGAGGAAGAAAGAGGAGGAAGG + Intronic
959502618 3:107124043-107124065 AGGAGGAAGGAGGCTGAGGCTGG - Intergenic
960051360 3:113241915-113241937 AGAAGGGAGGAGGAGGAGGCTGG + Intronic
960951653 3:123002603-123002625 TGGAGGGAGCCGTGGGAGGCAGG + Intronic
961182168 3:124886328-124886350 AGGAGGAAGCAGGCGGGGGGCGG + Intronic
961381732 3:126500025-126500047 AGGAGGAGGGAGGAGGAGGGAGG - Intronic
961485481 3:127212909-127212931 ATGAGGATGCTGTAGGGGGCTGG - Intergenic
961616937 3:128189845-128189867 AAAAGGAAGTAGAAGGAGGCTGG - Intronic
962345179 3:134613418-134613440 AGGAGGAAGAAGCAAGGGGCAGG + Intronic
962349266 3:134644814-134644836 AGGAGAAGGCTGGAGGAGGCAGG - Intronic
962707744 3:138061749-138061771 AGAAGGAAGCTGGAGGAGCCAGG - Intergenic
962842822 3:139251371-139251393 AGGAGGAGGAAGAAGGAGGGAGG - Intronic
963107606 3:141660236-141660258 AGGAGGAGGCAGGTGGCGGCGGG - Intergenic
963863934 3:150340267-150340289 AGGAGGAAGCAGGAGTGGACAGG + Intergenic
963868234 3:150385699-150385721 TGGAGGCAGGAGTGGGAGGCAGG + Intergenic
964374432 3:156035591-156035613 AGGAGGAAGCAGGAGGGGGGAGG - Intergenic
964374433 3:156035594-156035616 AGGAGGAGGAAGCAGGAGGGGGG - Intergenic
964716526 3:159728361-159728383 AGGAGGATGGAGAATGAGGCAGG + Intronic
965119350 3:164531620-164531642 TTGGGGAGGCAGTAGGAGGCAGG - Intergenic
965382269 3:168004691-168004713 AGGAGGAGACAGGAGAAGGCAGG - Intergenic
965836843 3:172862374-172862396 TGGTGGAAGCAGGAGGAAGCGGG - Intergenic
965858450 3:173117704-173117726 TGCAGGAAGCAGTAGGAGTTTGG - Exonic
966931233 3:184677136-184677158 AAGAGGAAACGGTAAGAGGCAGG + Intronic
966975629 3:185080798-185080820 AGGAGAGGGCAGTTGGAGGCAGG - Exonic
966981357 3:185139138-185139160 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
967214735 3:187200367-187200389 AGGAGGTAGGAGTTGGAGGATGG - Exonic
967813987 3:193783639-193783661 GGGAGGAAGGAGTAGGAGGGAGG - Intergenic
967987687 3:195107517-195107539 AGGAGGAGGAAGGAGGAGGAGGG + Intronic
968384114 4:121513-121535 GAGAGGAAGCAGTCAGAGGCTGG + Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968814973 4:2817570-2817592 AGGTGGAAGATGGAGGAGGCAGG + Intronic
968991632 4:3917301-3917323 AGGAGGAAGGAGAAGAAGGAAGG + Intergenic
969066032 4:4482019-4482041 AGGAGGAGGCAGGAGCAGGGAGG - Intronic
969506462 4:7591232-7591254 AGGAGGCAGCAGCAGGTGGAGGG - Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
970053236 4:11940154-11940176 AGGAGGCACCAGTAGGGGGATGG - Intergenic
970324079 4:14904941-14904963 AGGAGGAAGTAGAAGGAAGCAGG - Intergenic
970422098 4:15914890-15914912 ATGGGGAAGCACCAGGAGGCAGG + Intergenic
970429201 4:15973102-15973124 AGGAGGAAGCAGGTGGATCCCGG - Intronic
970444166 4:16110169-16110191 AGGAGGAAGAAGGAGGAAGGAGG + Intergenic
970444171 4:16110186-16110208 AGGAGGAAGGAGGAGGAAGGAGG + Intergenic
970444176 4:16110203-16110225 AGGAGGAAGGAGGAGGAAGGAGG + Intergenic
970444202 4:16110271-16110293 AGGAGGAAGGAGGAGGAAGGAGG + Intergenic
970444207 4:16110288-16110310 AGGAGGAAGGAGGAGGAAGGAGG + Intergenic
970444209 4:16110295-16110317 AGGAGGAGGAAGGAGGAGGAAGG + Intergenic
970444210 4:16110298-16110320 AGGAGGAAGGAGGAGGAAGGAGG + Intergenic
971267102 4:25105499-25105521 AGGGGGAGGCTGAAGGAGGCAGG - Intergenic
971380787 4:26095654-26095676 AGGAAGAAGAAGGAGGAGGAAGG + Intergenic
971574524 4:28256551-28256573 AGGAGGGAGGAGGAGGAGGGAGG - Intergenic
971574525 4:28256554-28256576 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
971574529 4:28256564-28256586 AGGAGGGAGGAGGAGGAGGGAGG - Intergenic
971574530 4:28256567-28256589 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
971574534 4:28256577-28256599 AGGAGGGAGGAGGAGGAGGGAGG - Intergenic
971574535 4:28256580-28256602 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
971574546 4:28256609-28256631 AGGAGGGAGGAGGAGGAGGGAGG - Intergenic
971574547 4:28256612-28256634 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
971574551 4:28256622-28256644 AGGAGGGAGGAGGAGGAGGGAGG - Intergenic
971574552 4:28256625-28256647 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
972217817 4:36916709-36916731 GAGAAGGAGCAGTAGGAGGCAGG - Intergenic
972374808 4:38460299-38460321 CAGAGGAAGAAGTAGGTGGCTGG - Intergenic
972567821 4:40285013-40285035 TGGACGCAGCAGGAGGAGGCAGG + Intergenic
973218706 4:47700795-47700817 AGGAGGAAGCAGGGGGATGTAGG - Intronic
973554473 4:52068538-52068560 AGGAGGAAGCAGGTGGGGGATGG + Intronic
973712909 4:53646951-53646973 TGGAGGAAGCTGTAAAAGGCAGG + Intronic
973849600 4:54948053-54948075 AGGAAGAAGCAGTAGGAGATAGG + Intergenic
974166843 4:58214905-58214927 AGGACGATGGAGTAGGAGGGTGG + Intergenic
974528965 4:63082083-63082105 AGGAGGAGTTAGTAAGAGGCTGG + Intergenic
975171923 4:71241880-71241902 AGGAGAAAGGAGCAGGAAGCTGG - Intronic
975510841 4:75192761-75192783 TGGAGGGAGCAGAAGGAGGAAGG - Intergenic
975736081 4:77382546-77382568 AGGAGGGAGCTGGAGGAGTCTGG + Intronic
975747003 4:77484646-77484668 AGGAAGGAGCAGTTGCAGGCAGG + Intergenic
976390449 4:84499559-84499581 AGGAGAAAGAAGTAGGGAGCGGG - Intergenic
976398689 4:84583647-84583669 AGGAGGAAGCAGTGCCAGGCAGG - Intronic
976666794 4:87603436-87603458 AGGGGGAAGGAGTGGGAGGAAGG - Intergenic
976796803 4:88942703-88942725 AGAAGGGAGCAGTAGGAGTCAGG - Intronic
976965388 4:91033424-91033446 AGGAGGCAACAGCAGGAGACTGG - Intronic
977349754 4:95867518-95867540 AAGAGGCAGCACTAGGAGGATGG - Intergenic
977560712 4:98530844-98530866 AGGAGGATGAAGCAGGAGGATGG - Intronic
977710121 4:100115071-100115093 AAGAGGAAGCATTAGGAGTAAGG - Intergenic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
979288259 4:118951026-118951048 GGGAGGAGGCAGATGGAGGCAGG + Intronic
980315377 4:131192635-131192657 GAGAGGAAGCAGTTAGAGGCTGG - Intergenic
980805385 4:137806169-137806191 AGTAGGAAGGAGTAGAAGGAAGG + Intergenic
982046761 4:151455427-151455449 ACCAGCAAACAGTAGGAGGCAGG - Intronic
982068890 4:151677931-151677953 AGGAAGAAGGAGGAGGAGGGAGG - Intronic
982203733 4:152981685-152981707 AGGAGGTAGGATTAGGAGGTGGG + Intergenic
982287912 4:153754063-153754085 AGGAGGATGCGGTAGGAGAATGG + Intronic
982304802 4:153919680-153919702 TGGGGCAAGCAGTACGAGGCAGG - Intergenic
985011632 4:185588590-185588612 AGGAGGGAGGAGGAGGAGGGAGG - Intronic
985011633 4:185588593-185588615 AGGAGGAGGGAGGAGGAGGAGGG - Intronic
985159385 4:187028524-187028546 AGGAGGCAGCACTAGGTGACTGG + Intergenic
985631334 5:1015620-1015642 ATCAGGAAGCAGGAGGAAGCAGG + Intronic
985648187 5:1095013-1095035 AGGTGGGGGCGGTAGGAGGCGGG + Intronic
985673408 5:1218034-1218056 GGGAGGAGGCGGGAGGAGGCAGG - Intronic
985718261 5:1475120-1475142 AGGATGAAGCAGAGTGAGGCGGG + Intronic
985747642 5:1656114-1656136 AGGAGGCAGGAGAAGGCGGCCGG + Intergenic
985793346 5:1944551-1944573 AGGAGGCTGCAGGAGGAGGCTGG + Intergenic
986002880 5:3643778-3643800 AGGAGGAAACAGCAGCAGGAGGG + Intergenic
986068497 5:4259413-4259435 AGGAGGAGGTAAGAGGAGGCAGG - Intergenic
986118252 5:4802280-4802302 AGCAGGAGGCTGGAGGAGGCTGG - Intergenic
986251236 5:6060304-6060326 AATAGGAAGCAGGAGGAGCCTGG + Intergenic
986286072 5:6360085-6360107 AGGAGGAGGCAGGATGTGGCAGG + Intergenic
986476217 5:8136472-8136494 AGAAGGAAGGAGCAGGATGCAGG - Intergenic
986748121 5:10761457-10761479 AGAAGGAAGGAGAGGGAGGCGGG + Intergenic
987034567 5:14006889-14006911 TGGAGGCAGCAGCAGGAGGCAGG - Intergenic
987867863 5:23569570-23569592 AGGCTGAAGCAGGAGAAGGCAGG + Intergenic
989104850 5:37852412-37852434 AGAAGGAAGCAGAAGAAGGGAGG + Intergenic
989144380 5:38234336-38234358 AGGAGGACTCAGAAGAAGGCAGG + Intergenic
989159057 5:38372453-38372475 AAAAAGAAGCAGTATGAGGCCGG - Intronic
989383817 5:40835334-40835356 AGGAGGATGCGGTACCAGGCAGG + Exonic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989756216 5:44958768-44958790 AGGAGGAAGGAGAAGGAAGGAGG - Intergenic
990616713 5:57516203-57516225 AGGAGGAAGCAGGAGGCGGAAGG + Intergenic
991118507 5:62982684-62982706 AGCAGGGAGCAGTAGGAGCCTGG - Intergenic
992157654 5:73970954-73970976 GGGAGGAAGGATTAGTAGGCTGG + Intergenic
992229047 5:74645304-74645326 AGGAGGAAGAGGCAGGAGGATGG - Intronic
993457270 5:88141325-88141347 AGGAGGCGGCAGGAGGGGGCAGG + Intergenic
993967424 5:94374805-94374827 AGGAGGAAGTAGGAATAGGCAGG - Intronic
994414525 5:99451654-99451676 AGGGGGTAGCACAAGGAGGCGGG - Intergenic
994863735 5:105235240-105235262 AGGAGCAGGCAGTGGGAGGAAGG + Intergenic
995847090 5:116505137-116505159 AGGAGGTAGCAGTAGGTAACGGG - Intronic
996281042 5:121729243-121729265 AGGAGAAGACAGAAGGAGGCGGG - Intergenic
996699590 5:126437007-126437029 AGGCAGAAGCAGTAGGATGGAGG + Intronic
997197865 5:131991659-131991681 GGGAGGAGGCAGGAGAAGGCTGG - Intronic
997383187 5:133451958-133451980 ACAGGGAAGCATTAGGAGGCAGG - Intronic
997518531 5:134507230-134507252 GGGAGGAAGCTGAAGGGGGCAGG + Intergenic
997737665 5:136225983-136226005 AGAAGGCAGCAGGAGGGGGCAGG - Intronic
997986307 5:138504157-138504179 AGGAGAGTGCAGTAGGAAGCAGG - Intergenic
997990884 5:138543457-138543479 AGGAGGAAGCGGGCGGAAGCCGG + Intergenic
998458526 5:142292403-142292425 AGTAGGAATGAATAGGAGGCAGG + Intergenic
999088404 5:148913315-148913337 AGGATGAAGCAGCATGAGGCAGG - Intergenic
999150335 5:149422446-149422468 AGGAGAAGGGAGGAGGAGGCCGG + Intergenic
999235365 5:150087836-150087858 AGGAGGATGAGGTAGGAGGATGG - Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999439573 5:151591035-151591057 AGAAGGAAGCAGGAGATGGCTGG - Intergenic
999452243 5:151687009-151687031 AGGAGGAGACAGGAGGAGGAGGG - Exonic
999777594 5:154823441-154823463 AGGAGGAACCAGTGGAAGGTGGG + Exonic
1000409840 5:160926685-160926707 AGGAGGAAGCATCACTAGGCTGG + Intergenic
1000644398 5:163743247-163743269 GGGAGGAAACAAAAGGAGGCAGG + Intergenic
1001132903 5:169079536-169079558 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1001132907 5:169079549-169079571 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1001132922 5:169079594-169079616 AGGAGGGAGGAGGAGGAGGAAGG + Intronic
1001132989 5:169079816-169079838 AGGAGGAGGGAGGAGGAGGAGGG + Intronic
1001132990 5:169079819-169079841 AGGAGGGAGGAGGAGGAGGGAGG + Intronic
1001424509 5:171614672-171614694 CAGAGGCAGCAGTGGGAGGCTGG + Intergenic
1001536861 5:172504200-172504222 AGGAGGAAGAAGTGGGCGGTAGG - Intergenic
1001738010 5:174022875-174022897 AGGAGGAAGAAGGAGTTGGCAGG + Intergenic
1003034163 6:2628524-2628546 AGGAGGAAGAGGTGGGAGCCGGG + Intronic
1003125955 6:3356081-3356103 GGGAGGAGGCGGGAGGAGGCGGG + Intronic
1003347264 6:5282293-5282315 AGAAGGAAGCAGCAGCAAGCAGG + Intronic
1003364538 6:5459788-5459810 AGGAGGAAGAAATAGGAAGGTGG - Intronic
1003894234 6:10591652-10591674 AGGAGGAGGGAGTGGGTGGCAGG - Intronic
1004000516 6:11592931-11592953 AGTGGGAAGCAGTGGGAGGCAGG + Intergenic
1004504939 6:16239641-16239663 AGGAGTAAACACGAGGAGGCTGG + Intronic
1004757946 6:18633618-18633640 AGGAGGAGGGAGTAGGAGAAGGG + Intergenic
1004998023 6:21213042-21213064 AGGAGGAAGCCCTGGGAGCCAGG - Intronic
1005083459 6:21980622-21980644 AGCAGGAAGGAGGAGAAGGCAGG - Intergenic
1005339658 6:24831368-24831390 GGGAGGTAGCAGCAGGTGGCTGG + Intronic
1006278674 6:33028757-33028779 AAGAGGAAGCAGTAAAAGGTGGG + Intergenic
1006904760 6:37525805-37525827 AGGAGGGAGCAGGGAGAGGCAGG + Intergenic
1007226780 6:40320798-40320820 AGGAAGAAGCAGCATGAGTCTGG + Intergenic
1008863244 6:56176929-56176951 AGGAGGAAGGAGGAGGAGGGAGG + Intronic
1008950945 6:57158611-57158633 TAGAGGAAGCAATGGGAGGCAGG - Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010037559 6:71343930-71343952 AGGAGGGAGCAGGAAGTGGCAGG + Intergenic
1010871704 6:81050112-81050134 AGCAGGAAGCAGTAAGTGACAGG + Intergenic
1011003718 6:82620585-82620607 GGGAGGAAGGAGCAGGAGACAGG + Intergenic
1011093485 6:83633404-83633426 GGGAGGAAGAGGTGGGAGGCAGG + Intronic
1011412033 6:87075758-87075780 AGGAGGCTGAAGTAGGAGGACGG + Intergenic
1012393874 6:98773261-98773283 AGAAGGAAGCTGTAGAAAGCAGG - Intergenic
1012402593 6:98855539-98855561 AGTAGGAAGAAGTAGGATGTGGG + Intergenic
1012660773 6:101887793-101887815 AGGAGACAGCAGTAGAAGACTGG + Intronic
1012817392 6:104041345-104041367 ATGAGATAGCAGTAGGAGGATGG + Intergenic
1012989241 6:105908169-105908191 ATGAGGAAGCAGGAATAGGCGGG - Intergenic
1013056587 6:106589180-106589202 AGGAGGAGGGAGGAGGAGGAGGG + Intronic
1013056588 6:106589183-106589205 AGGAGGGAGGAGGAGGAGGGAGG + Intronic
1013056603 6:106589216-106589238 AGGAGGAGGGAGGAGGAGGGAGG + Intronic
1013657588 6:112261504-112261526 CTGAGAGAGCAGTAGGAGGCTGG - Intergenic
1014007889 6:116442343-116442365 AGGAATAAGTAGTAGGAAGCGGG + Intergenic
1014019503 6:116571386-116571408 AGTAGGGAGCAGGCGGAGGCCGG + Exonic
1014207569 6:118672789-118672811 AGGAGGAGGAAGGAGGAGGAAGG + Intronic
1014215997 6:118753378-118753400 TCCAGGAAGCAGTGGGAGGCTGG - Intergenic
1014258113 6:119184562-119184584 AGGATGAAGCCTGAGGAGGCAGG + Intronic
1014258117 6:119184575-119184597 AGGAGGCAGGAGTAGGAAGGAGG + Intronic
1014804864 6:125818085-125818107 AGGAGGAGGAAGGAGGAGGTGGG - Intronic
1015872886 6:137794800-137794822 AGGAGGAAGGTGGGGGAGGCAGG + Intergenic
1015937883 6:138420769-138420791 AAGAGGAAGCAGGACGAGGCAGG - Exonic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016805494 6:148208063-148208085 ATGAGGAAGCAGGAAGAGGTGGG - Intergenic
1016985097 6:149889153-149889175 AGGAAGAAACAGTGGGAGGTGGG + Intronic
1017295159 6:152785288-152785310 AGGAGAAAGCAGAATAAGGCAGG - Intergenic
1017780787 6:157713725-157713747 AGGAGGAAGCAGATGGAAGGTGG + Intronic
1018038041 6:159898532-159898554 AGGAGGAGGGAGGAGGAGGGAGG - Intergenic
1018038045 6:159898542-159898564 AGGAAGAGGCAGGAGGAGGGAGG - Intergenic
1018038046 6:159898545-159898567 AGGAGGAAGAGGCAGGAGGAGGG - Intergenic
1018038077 6:159898658-159898680 AGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1018162932 6:161065108-161065130 AGGAGGAAGTTGTATAAGGCAGG + Intronic
1018376706 6:163219732-163219754 GGGAGGCAGCAGGAGGAGGCAGG - Intronic
1018434951 6:163751406-163751428 AGGAGGGAGGAGGAGGAGGTGGG - Intergenic
1018623884 6:165758688-165758710 AGAAGGAAGGAGAAGGAGGAGGG + Intronic
1018745453 6:166758153-166758175 AGGAGGCAGGCGTAGGAGGAAGG + Intronic
1019200361 6:170308779-170308801 AAGAGGAAGAAGTAGGAGGTAGG - Intronic
1019206343 6:170365125-170365147 AGGAGGGAGCTGTAGGAGACAGG - Intronic
1019260019 7:76778-76800 AGGAGGGAGTAGGAGGAGGAGGG - Intergenic
1019394967 7:813095-813117 AGAAGGAACCAGAAGCAGGCAGG + Intergenic
1019404631 7:877072-877094 AGGAGGGAACAGGTGGAGGCTGG - Intronic
1019404715 7:877382-877404 CGGAGGGAGCAGGGGGAGGCTGG - Intronic
1019465964 7:1189138-1189160 AGGAAGAAGAAGAAGAAGGCGGG + Intergenic
1019484077 7:1280492-1280514 AGGAGGAAGAAGAAGGAAGAAGG + Intergenic
1019484085 7:1280526-1280548 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1019484093 7:1280563-1280585 AGGAGGAAGAAGGAGGAAGGAGG + Intergenic
1019484141 7:1280823-1280845 AGAAGGAAGAAGAAGGAGGAAGG + Intergenic
1019484146 7:1280843-1280865 AGGAGGAAGAAGGAGGAAGGAGG + Intergenic
1019484170 7:1280976-1280998 AGAAGGAAGAAGAAGGAGGAAGG + Intergenic
1019484175 7:1280996-1281018 AGGAGGAAGAAGGAGGAAGGAGG + Intergenic
1019889729 7:3936840-3936862 AGGAGGCAGCAGTAGGGGTGGGG + Intronic
1019969034 7:4525336-4525358 AGGAAGAAGCCCTTGGAGGCAGG + Intergenic
1020254166 7:6492776-6492798 AGGAGGAAGGAGGAGGAGGGAGG + Intergenic
1021467339 7:20959997-20960019 AGGAAGAAACAGAAGGAGGGAGG - Intergenic
1021975487 7:26007813-26007835 GGGAGGGAGCAGTAGGAGCCAGG + Intergenic
1022020855 7:26398500-26398522 AGGAGGAAGGGGTGGGCGGCCGG - Intergenic
1022037814 7:26550591-26550613 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1022473332 7:30694863-30694885 AGGAGGAAGGAGGAGCAGGGAGG + Intronic
1022480544 7:30740593-30740615 AGGAAGCAGCAGGCGGAGGCTGG - Intronic
1022812763 7:33885764-33885786 TGGAGGAAGAAATAGGAGGGAGG + Intergenic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1022972553 7:35530911-35530933 AGGAGTAAGGAGGAGGAAGCAGG - Intergenic
1023044417 7:36198834-36198856 AGGTGGTAGCAGGAGAAGGCGGG - Intronic
1023295874 7:38714737-38714759 AGGAGGAAGAGGGAGCAGGCAGG - Intergenic
1023479300 7:40615809-40615831 AGGATGAAGCAGAAGAAGGTGGG - Intronic
1023491459 7:40747047-40747069 AGGAGGAAGCTGTGCGGGGCGGG + Intronic
1023567813 7:41540940-41540962 AGGAAGAAACAGGAGGAGGCTGG + Intergenic
1023601571 7:41886280-41886302 AGGAGGAAGCCAGAAGAGGCTGG - Intergenic
1023934908 7:44732798-44732820 AGGAGGAGGCAGGAGGAGGCAGG + Intergenic
1024311613 7:47974671-47974693 AGGAGGGAGCAGGGGGAGGAGGG + Intronic
1024323105 7:48089065-48089087 AGGAGGAAGGCGGGGGAGGCGGG + Intronic
1024326298 7:48111855-48111877 AGGAGGCAGCAGGAGGAGCGTGG - Intergenic
1024610939 7:51063575-51063597 TGCAGACAGCAGTAGGAGGCAGG + Intronic
1025252300 7:57359773-57359795 AGGAGGAAGGAGTTTGAGGTGGG + Intergenic
1025673277 7:63627603-63627625 AGGAGGAGGAAGGAGGAGGGCGG + Intergenic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1026217652 7:68363986-68364008 AGGAGGGAGGAGGAGGAGGGAGG - Intergenic
1026217653 7:68363989-68364011 AGGAGGAGGGAGGAGGAGGAGGG - Intergenic
1026828139 7:73596566-73596588 AGGAGGAAGAAGAAGGGGACTGG - Intronic
1026917452 7:74129504-74129526 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1027425280 7:78055774-78055796 AGGAGCAATCAGTAGGAGCCAGG - Intronic
1027645317 7:80790324-80790346 AGGAGAAAGGAGGAGGAGGAAGG + Intronic
1027864907 7:83633151-83633173 AGGAGGAAGGAAAAGGAGGAAGG - Intronic
1028921376 7:96314108-96314130 AGGAGGAGGAAGAAGGAGGAAGG + Intronic
1028979304 7:96949638-96949660 ATGAGGGAGTAGGAGGAGGCTGG - Intergenic
1029049572 7:97670364-97670386 AGGAGGGAGCAGGAGGAGAGAGG + Intergenic
1029449240 7:100631757-100631779 AGGAGGAAGCAGAGAGAGGAAGG - Intronic
1029493461 7:100884620-100884642 AGGAGCTAGAAGTAGGGGGCTGG + Intronic
1029536849 7:101162404-101162426 GGCAGGAAGCAGGAGGAGACGGG + Intergenic
1029538459 7:101169399-101169421 AGGTGGAAGTTGAAGGAGGCTGG - Intergenic
1029632929 7:101764398-101764420 TGGAGGAAGCTGTAGGAGCTGGG - Intergenic
1029978100 7:104852824-104852846 AGGAGGAGGCAGCAGGAAGCTGG - Intronic
1030130323 7:106194159-106194181 AGGAGGGAGCTGGAGGAGGCTGG + Intergenic
1030139393 7:106289451-106289473 AGGATGAAGCTGAAGGAGGTGGG + Intergenic
1030614314 7:111722419-111722441 AGGAGGAAGCCGTATGAGACAGG + Intergenic
1031431509 7:121676411-121676433 AAGAGGAATCAGGAGCAGGCAGG + Intergenic
1031810098 7:126357048-126357070 GGGAGGCACCAGTAGGAGACAGG + Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1032071396 7:128809558-128809580 AGGAGGATGCAGGAGGAGCAGGG + Exonic
1032283370 7:130523847-130523869 GGGAGGAGGCAGGAGGAGGGTGG + Intronic
1032284111 7:130528072-130528094 GGGAGGAGGCAGGAGGAGGGTGG + Intronic
1032284887 7:130532449-130532471 GGGAGGAGGCAGGAGGAGGGTGG + Intronic
1032398417 7:131607239-131607261 AGGAGGCTGCAGTGGGAGGATGG - Intergenic
1032460738 7:132108474-132108496 GGGAGGTACCAGTAGGAGACTGG + Intergenic
1032473074 7:132192394-132192416 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1032953147 7:136939137-136939159 ATGAGGAAGCAGTAGCAGAAGGG + Intronic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033658514 7:143388741-143388763 AGGAGGCAGCAGGAGGAGGTTGG - Intronic
1033832604 7:145271580-145271602 AGAAGGAAGAAGGAGGAGGAGGG + Intergenic
1033863098 7:145653691-145653713 AGGAAAAAGAAGTAGGAGGAAGG - Intergenic
1033981582 7:147171242-147171264 AGGCTGAAGCAAGAGGAGGCTGG - Intronic
1034474950 7:151276620-151276642 AGGAGGAAGAGGTACGAGGTTGG + Intronic
1034563310 7:151895067-151895089 AGGAGGACGCAGGAGCAGGGAGG - Intergenic
1034711745 7:153198745-153198767 AGGAGGAAGGAAAAGGAGGAAGG - Intergenic
1035138942 7:156737894-156737916 AGACTGAAGCAGTAGGAGGGCGG + Intronic
1035245903 7:157561817-157561839 AGGAAGATGCAGCAGGAGGATGG + Intronic
1035287317 7:157814576-157814598 AGGAGGGGGCAGGAGGGGGCAGG + Intronic
1035639855 8:1176628-1176650 ACGGGGAAGAAGTTGGAGGCTGG + Intergenic
1035856764 8:2984278-2984300 AGGAGGGAGAGGTAGGATGCTGG + Intronic
1035893801 8:3374743-3374765 AGTAGGAAGCCGTAGGATCCTGG - Intronic
1036220339 8:6915911-6915933 AGGAGGCAGCAGCAGGAAGAGGG - Intergenic
1036224945 8:6949711-6949733 GGGAGGCTGCAGTTGGAGGCAGG + Intergenic
1036234547 8:7026904-7026926 GGGAGGCTGCAGTTGGAGGCAGG + Intergenic
1036815583 8:11900295-11900317 AGGTGGAAGGAGCAGGAGGGAGG - Intergenic
1036851045 8:12201711-12201733 AGGAGGATGAAGTGGGAGGATGG + Intergenic
1036872409 8:12443992-12444014 AGGAGGATGAAGTGGGAGGATGG + Intergenic
1036949317 8:13125891-13125913 AGGAGGAAACACTGGGAGACAGG + Intronic
1037636772 8:20707211-20707233 AGGAGAAAGAAGTAACAGGCTGG + Intergenic
1038150926 8:24942052-24942074 AGGAGGAGGGGCTAGGAGGCTGG - Intergenic
1038150939 8:24942088-24942110 AGGAGGAAGAAGGAGGGGGTAGG - Intergenic
1038150950 8:24942118-24942140 AGGAGGGAGGAGGAGGAGGGAGG - Intergenic
1038284965 8:26198493-26198515 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1038308314 8:26424523-26424545 AGGAGGAAGCAGAAGTAGATGGG + Intronic
1038412475 8:27368894-27368916 AGGAGGAAGCAGGGGTGGGCAGG + Intronic
1039075694 8:33688979-33689001 AGGAGGATGAAGTGGGAGGACGG - Intergenic
1039377766 8:37053709-37053731 AGGAGGAAGTGGGAGAAGGCAGG + Intergenic
1040627864 8:49172579-49172601 AAAAGGAAGCAGAAGGAAGCTGG - Intergenic
1040702660 8:50086311-50086333 CAGAGGAAGAAGTTGGAGGCAGG + Intronic
1040848356 8:51870861-51870883 AGAATGAAGCAGCAGGGGGCGGG + Intronic
1041291164 8:56310114-56310136 AGAAGGAAGGAGGAGGAGGAGGG + Intronic
1041291175 8:56310146-56310168 AGGAGGAAGGAGGAGGAGGAGGG + Intronic
1041291185 8:56310178-56310200 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041291224 8:56310303-56310325 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041401341 8:57448674-57448696 AGGAGGAGGCAGTGGCAGGAAGG - Intergenic
1041860804 8:62510613-62510635 AGGAGGAAGAGGAAGGAGGAAGG + Intronic
1041916757 8:63146271-63146293 AGGTGGAATCAGGAGGAGGAGGG + Intergenic
1042112250 8:65392953-65392975 ATGAGGAAGCACTAGGAGTTGGG + Intergenic
1042190884 8:66186020-66186042 ATGAAGAGGCTGTAGGAGGCAGG - Intergenic
1042194963 8:66223921-66223943 GGGAGGGAGCAGGAAGAGGCAGG + Intergenic
1043384414 8:79733699-79733721 AGGAGGCTGAAGTAGGAGGATGG + Intergenic
1044167412 8:89003923-89003945 ATGAGGAAGCTGTGGGATGCAGG + Intergenic
1044613630 8:94118332-94118354 TGGAGGAAGCACTATGAGCCAGG + Intergenic
1044869832 8:96607823-96607845 AGGGGGAAGCATTAGGAGTAAGG + Intronic
1045475978 8:102553064-102553086 TGGAAAAAGCAATAGGAGGCCGG + Intronic
1045725799 8:105171692-105171714 AGGGGGAAAGAGTGGGAGGCGGG - Intronic
1046710250 8:117503293-117503315 AGGAAGAAGAAGGAGGAGGAGGG + Intergenic
1047204037 8:122789136-122789158 TGGAGGAAGCAGGCGGAGGGAGG + Intronic
1048206223 8:132417386-132417408 AGGAGGAACCAGCAGGAGATGGG - Intronic
1048250963 8:132866605-132866627 AGGAGGAAGGAGAAGGAGAAAGG + Intergenic
1048990174 8:139756251-139756273 AGCAGGTCGCAGTAGGAGCCAGG + Intronic
1049070357 8:140350927-140350949 AGAATGAAGCAATGGGAGGCTGG + Intronic
1049303282 8:141883162-141883184 AGAAGGAAGAAGCAGGAGGGAGG + Intergenic
1049353803 8:142177925-142177947 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1049372026 8:142272507-142272529 AGGAGGAAGCTGTAGACGGGTGG - Intronic
1049672576 8:143876512-143876534 AGGAGGAAGCAGGTGGACGAAGG - Intronic
1049706599 8:144046024-144046046 AGGAGGACGCAGATGGAGACAGG + Intronic
1049850217 8:144826827-144826849 AGAAGGAACCCGAAGGAGGCGGG + Intergenic
1050025250 9:1327452-1327474 AGGAGGAAACAGCAGCAGACAGG + Intergenic
1050151370 9:2622089-2622111 AGGAGGAAGAAGGTGGGGGCGGG - Exonic
1050452015 9:5791941-5791963 GGGAGGAAGAAGTGGGAGGATGG + Intronic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051544947 9:18263401-18263423 CGGAGGAAGCAACAGGAGCCAGG - Intergenic
1051565300 9:18490359-18490381 AGGAGGAAGACAGAGGAGGCTGG + Intronic
1051596038 9:18825162-18825184 AGGAGGATCCTATAGGAGGCTGG - Intronic
1053275809 9:36782453-36782475 AGAAGGAAGAGGCAGGAGGCTGG - Intergenic
1053284211 9:36839961-36839983 AGGAGGGATGAGCAGGAGGCTGG + Exonic
1053290259 9:36875107-36875129 ATGGGGAAGCAGTGGGAGGCTGG - Intronic
1053710384 9:40801157-40801179 AGGAGGAAGCAGGAGAAGGTGGG - Intergenic
1053728992 9:41033466-41033488 AGGAGGCACCAGCAGGAGGTTGG + Intergenic
1054420292 9:64921946-64921968 AGGAGGAAGCAGGAGAAGGTGGG - Intergenic
1054699520 9:68398617-68398639 AGGAGGCACCAGCAGGAGGTTGG - Intronic
1055080274 9:72261824-72261846 AGGAGGAAGAAGGAGGAGGAGGG - Intergenic
1055856525 9:80694541-80694563 AGGAGACAGGAGTAGGAGGAAGG + Intergenic
1055913303 9:81375090-81375112 AGGAAGAAGTGGGAGGAGGCAGG + Intergenic
1055928099 9:81531467-81531489 GGGAGGAAACAGGAGGAAGCTGG + Intergenic
1056161723 9:83902802-83902824 AGGAGGAAGCAATAGGAAAGGGG + Intronic
1056233059 9:84566699-84566721 AGGAGGCACCAGTGGGAGTCTGG - Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056470882 9:86903573-86903595 AGGAGGAAGGAGGAGGAGAAGGG - Intergenic
1056540227 9:87564609-87564631 AGGAGGAAGGAGCAAGAGGGAGG + Intronic
1056801559 9:89695568-89695590 AGCAGGAAGCAGCTGCAGGCCGG - Intergenic
1056827108 9:89884037-89884059 AGGAGGGTGCTGGAGGAGGCGGG + Intergenic
1056890658 9:90488791-90488813 GGGAGGAAACAGTAAGAGGAGGG + Intergenic
1057443605 9:95098849-95098871 AGGAGGAAGCAGGAGGACAAGGG - Intergenic
1057826147 9:98373482-98373504 AGGAGGCAGCAGCAGGATGTCGG - Intronic
1057865282 9:98675294-98675316 AGGAGGAACCAGAGGAAGGCAGG + Intronic
1057898665 9:98930495-98930517 AGGAGGAAGCAGTTGGAAAAAGG + Intergenic
1057917253 9:99066193-99066215 AGAGGGCAGTAGTAGGAGGCTGG + Intronic
1058510613 9:105713168-105713190 AGGAGTAGGCAGTAGAGGGCAGG + Intronic
1058561434 9:106233138-106233160 AGGAGAAAGGAGGAGGAGGAAGG - Intergenic
1058561442 9:106233174-106233196 AGGAGGAAGAAGGAGGAGAAAGG - Intergenic
1058720702 9:107760911-107760933 AGGATGAAGGGGTAGGAGGCTGG + Intergenic
1058727885 9:107820678-107820700 AGGAGGTAGGAGAGGGAGGCAGG + Intergenic
1058944772 9:109846127-109846149 AGGAGGAAGAAGTGGCAGCCGGG + Intronic
1059072446 9:111152901-111152923 AGGAGGGAGGAGGAGGAGGAAGG + Intergenic
1059072454 9:111152930-111152952 AGGAGGAAGGAGGAGGAAGCAGG + Intergenic
1059072467 9:111152972-111152994 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059072471 9:111152985-111153007 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059072479 9:111153014-111153036 AGGAGGAAGGAGGAGGAAGAAGG + Intergenic
1059248405 9:112867195-112867217 AGGAGGAATCCTGAGGAGGCAGG - Intronic
1059248422 9:112867269-112867291 AGGAGGAATCCTGAGGAGGCAGG - Intronic
1059759854 9:117327474-117327496 AGGAGGTAGCCATTGGAGGCAGG + Intronic
1059812028 9:117865967-117865989 GGGAGGAAGCAGGAGAAGGCAGG + Intergenic
1059823217 9:117997222-117997244 AGGAGGAAGGAGGAGGAAGGAGG - Intergenic
1059823218 9:117997225-117997247 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1060499028 9:124138893-124138915 GGGAGGCAGAAGTAGGAGGATGG + Intergenic
1060750478 9:126165331-126165353 AGGAGGCAGCGGTGGGGGGCGGG - Intergenic
1060794133 9:126503329-126503351 CGGAGGCGGCAGGAGGAGGCGGG - Exonic
1061188775 9:129070102-129070124 CAGAGGAAGCAGTGGGAGGGAGG + Intronic
1061450438 9:130664496-130664518 AGGAGGACGCAGGAGGGAGCGGG - Intergenic
1061763718 9:132868505-132868527 AGGGAGAAGGAGTGGGAGGCTGG - Intronic
1062145193 9:134985199-134985221 AGGAGGCAGCAGAGGAAGGCGGG - Intergenic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062580406 9:137226909-137226931 AGGATGAGGCAGGAGGAGGCTGG + Intergenic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638390 9:137503515-137503537 AGGAGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638401 9:137503550-137503572 AGGAGGGAGAAGGAGGAGGAAGG + Intronic
1062638417 9:137503611-137503633 AGGAGGAGGGAGAAGGAGGAGGG + Intronic
1062673824 9:137728067-137728089 AGGAGGAATGAGCAGGAGGGAGG - Intronic
1203774287 EBV:64052-64074 GGGAGGAAACAGGAGGAGGAGGG + Intergenic
1185449519 X:275092-275114 AGGAGGGAGGAGGAGGAGGGAGG + Intergenic
1185575564 X:1169279-1169301 AGGAGGAGGGAGGAGGAGGAGGG + Intergenic
1185575565 X:1169282-1169304 AGGAGGGAGGAGGAGGAGGGAGG + Intergenic
1185603665 X:1355172-1355194 AGGAGGAAGGAGGGGGAGGAGGG + Intronic
1185627593 X:1493399-1493421 AGGAGGAAGGAGGAGGAAGGAGG + Intronic
1185661926 X:1735195-1735217 AGGAGGAAGGAGGAGGAGGAGGG - Intergenic
1185721343 X:2384308-2384330 AGCAGGGAGGTGTAGGAGGCAGG + Intronic
1186034469 X:5406131-5406153 AGGAGGAAGATGAAGGAGGAAGG + Intergenic
1187025729 X:15433863-15433885 AGGAGAAAGAAGGAGGAGGAAGG + Intronic
1187025747 X:15433932-15433954 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1187025761 X:15433998-15434020 AGGAGAAAGAAGGAGGAGGAAGG + Intronic
1187025765 X:15434018-15434040 AGGAGAAAGAAGGAGGAGGAAGG + Intronic
1187025774 X:15434061-15434083 AGGAGAAAGAAGGAGGAGGAAGG + Intronic
1187025780 X:15434081-15434103 AGGAGAAAGGAGGAGGAGGGAGG + Intronic
1187025785 X:15434101-15434123 AGGAGAAAGAAGGAGGAGGAGGG + Intronic
1189136649 X:38557431-38557453 AGGGGGTAACAGTAGGAGGAGGG + Intronic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1189282062 X:39825879-39825901 AGGAGGGAGCAGGAGGAGGTGGG - Intergenic
1189364737 X:40379939-40379961 AGGAGGAAGAGGGAGGAGGAAGG - Intergenic
1189979929 X:46499265-46499287 AGGAGGTTGAAGTAGGAGGGTGG - Exonic
1190062835 X:47222032-47222054 AAGAGGAAGCAGAAGACGGCTGG + Intronic
1190236075 X:48616768-48616790 AGGAGGAAGCAGGATCGGGCAGG + Intergenic
1190720000 X:53139846-53139868 AGGAGGAGGCAGGAGGAAGGGGG + Intergenic
1190720003 X:53139856-53139878 AGGAGGAAGGGGGAGGAGGAAGG + Intergenic
1191108379 X:56786596-56786618 AGGAGAAAGAAGAAGGAGGAGGG - Intergenic
1191641789 X:63434361-63434383 AGGAGAAAGCGGTGGGAGGATGG + Intergenic
1192141064 X:68647604-68647626 AGGAGGAGGGACCAGGAGGCGGG - Intergenic
1192185181 X:68941831-68941853 AGGAGAAAGGAGGAGGAGGAAGG + Intergenic
1192795167 X:74420525-74420547 AGGAGGAACGAGTTGGAGTCGGG - Intergenic
1192847990 X:74925480-74925502 AGGAGGAAGGGGGAGGAGGGGGG - Intronic
1193103006 X:77636928-77636950 AGGAGGAAGGAGAAGGAAGAAGG + Intronic
1193103023 X:77637015-77637037 AGGAGGAAGAAGAAGGAAGGAGG + Intronic
1194407037 X:93509361-93509383 AGGAGGAACAAGGAGGAGGAAGG + Intergenic
1194767621 X:97860448-97860470 AGGAAGAAGCTGAGGGAGGCTGG + Intergenic
1195289215 X:103414964-103414986 GGGTGGAAGCAGGAGGAAGCTGG - Intergenic
1195321632 X:103725998-103726020 AGGAGGGAGCAGGAGGTGCCTGG - Intronic
1195923111 X:110002404-110002426 AGGAGGAGGGAGGAGGAGGAGGG + Intergenic
1196032200 X:111103096-111103118 ATGAGGGAGCAGTAGCAGGTGGG + Intronic
1196145453 X:112311740-112311762 AGGAGGATGAGTTAGGAGGCAGG - Intergenic
1196650261 X:118161298-118161320 AGGAGGAAGCAGTGTGATGATGG - Intergenic
1196731088 X:118942230-118942252 AGGAGGAAGGAGGAGGAAGGAGG + Intergenic
1196870635 X:120110031-120110053 AGGAGGGAGCAGGAGGCAGCTGG - Intronic
1196871857 X:120120235-120120257 AGGTGGAAGGAGGAGGAGGCAGG + Intergenic
1197433306 X:126393532-126393554 AGAAGGAGGAAGGAGGAGGCTGG + Intergenic
1198155451 X:133955413-133955435 AGGAGGGAGCTGAAGGAGGCCGG - Intronic
1198691981 X:139294369-139294391 AGGCAAAGGCAGTAGGAGGCAGG + Intergenic
1199297049 X:146171219-146171241 AGGAGAAAGGAGAAGGAGGAAGG - Intergenic
1199975268 X:152891493-152891515 TGGAGGAAGCAACAGCAGGCAGG + Intergenic
1200102297 X:153694175-153694197 AAACGGAAGTAGTAGGAGGCCGG - Exonic
1200125185 X:153810145-153810167 AGGAGGAGGCAGCTCGAGGCAGG + Intronic
1200425089 Y:3011646-3011668 AGGAGGAAGGAGCAGGAGAGAGG - Intergenic
1201300261 Y:12498784-12498806 ATGACGAAGAAGTAGGAGGAAGG - Intergenic
1201422824 Y:13818956-13818978 AGGAGGAAGGAGGAGGAAGAAGG - Intergenic
1201546993 Y:15176264-15176286 GAGAGGAAGCAGTAGGTGGCTGG - Intergenic
1202378777 Y:24259387-24259409 AGGAGGCTGCACTGGGAGGCAGG - Intergenic
1202492005 Y:25410734-25410756 AGGAGGCTGCACTGGGAGGCAGG + Intergenic