ID: 935100418

View in Genome Browser
Species Human (GRCh38)
Location 2:99989393-99989415
Sequence TTGTATGTCCATAAAGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935100418 Original CRISPR TTGTATGTCCATAAAGCTGA TGG (reversed) Intronic
900646685 1:3712177-3712199 TTATATGTGCGTAAAGCTGAGGG + Intronic
904506877 1:30964250-30964272 TTATATGTACATATAGCAGAGGG + Intronic
907735490 1:57107675-57107697 ATGTAGGTCCAGAAAGCTGAAGG + Intronic
907824599 1:58003353-58003375 TTGGATTTCCATAAAATTGAGGG - Intronic
909502422 1:76349868-76349890 TTGTCTGTCCAGCAAGATGAGGG + Intronic
910077972 1:83302805-83302827 TTGTATGTCGATTTTGCTGAGGG - Intergenic
910809341 1:91220094-91220116 TTACATTTCCATAAAACTGAAGG - Intergenic
911879161 1:103212047-103212069 GTGTATGTCCAAAAAAATGAAGG + Intergenic
912005407 1:104893505-104893527 TTCTATGCCCATAAATTTGATGG + Intergenic
913148259 1:116013701-116013723 TGACATGTCCATAAAGCTTAAGG + Intronic
916258703 1:162818705-162818727 TTGTTTTTCCCTGAAGCTGAAGG + Intergenic
916442127 1:164837750-164837772 TTGTATGTCCATTTAGCCTAAGG + Intronic
917156774 1:172010341-172010363 TTGTAAGTTCTTCAAGCTGAAGG - Intronic
918482956 1:184999054-184999076 TTATATCTCAATAAAGCTGGAGG - Intergenic
919402214 1:197133261-197133283 TTATATGTCAATAAAGCCGGGGG + Intronic
921721805 1:218480819-218480841 TTGTATGTTTATAAAGCTGTTGG + Intergenic
922212022 1:223493759-223493781 TTGTACCTCCATAAAGCTAAGGG + Intergenic
1064891255 10:20176249-20176271 TCATATCTCCATAAAGCTGGAGG - Intronic
1065602167 10:27380153-27380175 TTATATCTCAATAAAGCTGATGG + Intergenic
1065639472 10:27767203-27767225 TTTTATTTCCATGAATCTGAAGG - Intergenic
1065686209 10:28287673-28287695 TTATATCTCAATAAAGCTGGAGG + Intronic
1066667048 10:37793360-37793382 TTTTATTTCAATAAAGCAGATGG + Intronic
1066725148 10:38384378-38384400 TTGTTTTTCCCTGAAGCTGAAGG + Intergenic
1068280881 10:54868102-54868124 TTATATCTTAATAAAGCTGAGGG + Intronic
1068287528 10:54960390-54960412 TTATATATCCATACACCTGAGGG - Intronic
1070185266 10:74056326-74056348 TTATATCTCAATAAAGCTAAGGG - Intronic
1070485899 10:76931300-76931322 TTGTATTTCAATAAACCTGGAGG + Intronic
1071037941 10:81269865-81269887 ATATATGTACATAAATCTGATGG - Intergenic
1072569962 10:96649969-96649991 ATGTATGTCTATAAAGTTGTTGG - Intronic
1074515191 10:114160658-114160680 TTATATTTCAATAAAGCTGGGGG + Intronic
1077820601 11:5735762-5735784 TTATTTGTCCATAATGTTGAAGG - Intronic
1080799419 11:35596181-35596203 TTGTATGTCGATGTTGCTGAGGG + Intergenic
1082115115 11:48319901-48319923 TCCTTTTTCCATAAAGCTGAAGG + Intergenic
1082258549 11:50059389-50059411 TCCTTTTTCCATAAAGCTGAAGG - Intergenic
1082698007 11:56394484-56394506 CTGTAGGTACATAAAACTGAGGG - Intergenic
1082733625 11:56830749-56830771 TTGTATGTCGTTAAAGATGGGGG - Intergenic
1085590519 11:77755458-77755480 TTGTTTGTACATAAAGATGATGG + Intronic
1085902404 11:80717100-80717122 TTATATGAGCATAAAGCTGAAGG + Intergenic
1086204390 11:84240421-84240443 TTGTCTCTCCTTACAGCTGAGGG + Intronic
1086212618 11:84339164-84339186 TTGTACTTCTATCAAGCTGAAGG + Intronic
1090531699 11:127597503-127597525 TTGAATGTCCAAATAGCTCATGG - Intergenic
1090993276 11:131840050-131840072 TGCGATGTCCTTAAAGCTGAAGG - Intronic
1091313548 11:134594546-134594568 TTGAATCTCCACAAAGCTGGTGG - Intergenic
1091676108 12:2491378-2491400 TTATAAGTCAATAAAGCTGATGG + Intronic
1091676138 12:2491577-2491599 TTATAAGTCAATAAAGCTGATGG + Intronic
1092576192 12:9785123-9785145 ATGTATGTACACAAAGCTAATGG + Intergenic
1095286270 12:40414560-40414582 TTGGAAGTCAGTAAAGCTGATGG + Intronic
1100854688 12:98748584-98748606 CTGTATCTCCATAAAGCTGTGGG + Intronic
1101865724 12:108518108-108518130 TTCTATGTCCAGAAAGCAGGAGG + Intronic
1102221234 12:111195847-111195869 TTATATCTCAATAAAGCTGCTGG - Intronic
1102581285 12:113889868-113889890 TTGCATTTCAATCAAGCTGAGGG + Intronic
1104214439 12:126722408-126722430 TTTTACCTCAATAAAGCTGAGGG + Intergenic
1106986068 13:35352888-35352910 TTGTATGTCCACAAAACTTTAGG - Intronic
1110654168 13:77976847-77976869 CTGTACCTCAATAAAGCTGAGGG - Intergenic
1111982431 13:95030836-95030858 TTTCAGGTACATAAAGCTGAAGG - Intronic
1115084252 14:29494383-29494405 ATGTATGTCTTTAAAGGTGAAGG + Intergenic
1116253654 14:42520486-42520508 ATGTATGTCCTTAAAACTGGAGG - Intergenic
1118149933 14:63178734-63178756 TTGTATCTCCATTATGATGAGGG - Intergenic
1120870772 14:89335236-89335258 TTATATTTCAATAAAGCTGGGGG + Intronic
1121471323 14:94156639-94156661 TTATATCTCAATAAAGCTGGAGG + Intronic
1124630727 15:31335561-31335583 TTGTTTGTCCAGAAAGATGTTGG - Intronic
1125346680 15:38725625-38725647 TAGTATGTCCATGAAGTTGTGGG - Intergenic
1125466978 15:39963011-39963033 TTGTATCTCCTTAAAGAGGAAGG - Intronic
1126647467 15:50889464-50889486 TTGTATTTTCATAAATCTTAAGG - Intergenic
1127126260 15:55814985-55815007 TAGTAAATGCATAAAGCTGAGGG - Intergenic
1128638362 15:69317587-69317609 TTGTAAATCTATAAAGCTGTAGG - Intronic
1133772161 16:8873303-8873325 TTATATCTCAATAAAGCTGTTGG - Intergenic
1133984496 16:10657917-10657939 TTGTATCTCAATAAAGATGTTGG - Intronic
1143711276 17:8736847-8736869 TTGTATGTTCAGGATGCTGAAGG + Intronic
1146100391 17:29975095-29975117 TTGTATGGCTCAAAAGCTGAGGG - Intronic
1147174182 17:38642481-38642503 TTGTATTTCCATATAAATGATGG - Intergenic
1149625444 17:58077125-58077147 TTATATCTCAATTAAGCTGAGGG + Intergenic
1150032249 17:61751731-61751753 TTGTATCCCCCTAAAGCTAAAGG - Intronic
1152114517 17:78377329-78377351 TTCTATGCCCAAAAAGCTGACGG - Intergenic
1155107682 18:22683782-22683804 AAGTATGTGCATATAGCTGATGG + Intergenic
1155194734 18:23462712-23462734 AGGTATATCCTTAAAGCTGAGGG - Intronic
1157570316 18:48708051-48708073 TTATATGGCCATAAAGAGGAAGG - Intronic
1157793430 18:50554036-50554058 TTTTATGTCCATAAAGATATGGG + Intergenic
1157805740 18:50656290-50656312 TGGGATGTCCATCAAGCTGTTGG + Intronic
1159874499 18:73795366-73795388 TTATATTTCAGTAAAGCTGAAGG + Intergenic
1165170450 19:33888290-33888312 TGGTATGTCCAGACAGCTCAAGG - Intergenic
1165638470 19:37363938-37363960 TTGTATCTCCATCCACCTGAAGG + Exonic
927299178 2:21491380-21491402 TTGTACCTCAATAAAGCTGGGGG - Intergenic
927527794 2:23763342-23763364 TTGTATCTCAGTAAAGCTGTTGG - Intronic
927693155 2:25222518-25222540 GTGTATGTGCATAAAACAGATGG + Intergenic
929026598 2:37610471-37610493 TTATACCTCAATAAAGCTGAGGG + Intergenic
929858899 2:45658366-45658388 TTGACTGTCCATGAAGTTGAAGG - Intronic
931126250 2:59280765-59280787 TTTCATGTCCATAACGCTGCAGG - Intergenic
934791352 2:97064670-97064692 TTGTAAGTGCATAAAACTGAAGG + Intergenic
934815081 2:97317873-97317895 TTGTAAGTGCATAAAACTGAAGG - Intergenic
934822614 2:97390610-97390632 TTGTAAGTGCATAAAACTGAAGG + Intergenic
935100418 2:99989393-99989415 TTGTATGTCCATAAAGCTGATGG - Intronic
936552412 2:113457630-113457652 TTGTACCTCAATAAAGCTGGGGG - Intronic
937788398 2:125929876-125929898 TTTAATGCCCACAAAGCTGACGG + Intergenic
943133038 2:183879472-183879494 TTGTATGTCAATTTTGCTGAGGG + Intergenic
944323425 2:198375910-198375932 TTCTATGTCAATCAAGATGAGGG - Intronic
945018676 2:205548577-205548599 TTGTAAGAGCATAAACCTGAGGG - Intronic
1170260933 20:14407337-14407359 TTGTGTCACCCTAAAGCTGATGG + Intronic
1170994052 20:21334896-21334918 TTGAATGTGTATAAAGCTCAGGG + Intronic
1172552937 20:35815918-35815940 TTATATCTCAATAAAGCTGGAGG - Intronic
1174234546 20:49078569-49078591 TTTCCTGTCCTTAAAGCTGACGG + Exonic
1174428567 20:50450922-50450944 TTATATCTCAATAAAGCTGGGGG - Intergenic
1175254008 20:57627872-57627894 TTGTATGACCACAGAGCTGGAGG + Intergenic
1175399202 20:58691309-58691331 TTTTATGTCGGGAAAGCTGAGGG + Intronic
1175528953 20:59660950-59660972 TTGTTTTTCCATAATTCTGAGGG + Intronic
1177653961 21:23992803-23992825 TTGTCTCTCCAAAGAGCTGAAGG + Intergenic
1182867055 22:33612995-33613017 TAGTATTGCCATAAAGGTGAGGG - Intronic
1185134461 22:49061641-49061663 TTGAATTTCAGTAAAGCTGAAGG + Intergenic
949342029 3:3040628-3040650 TTGTATTTTCATAAAGCATATGG + Intronic
949745550 3:7288160-7288182 TTGTATATCCTTAAAGGAGAAGG - Intronic
950349867 3:12339037-12339059 TTGTCTATCCATTCAGCTGATGG - Intronic
951315386 3:21183583-21183605 TTGTAATTCAATAAAGCTGCAGG + Intergenic
955037665 3:55284633-55284655 TTGTCTGTCCATGAAGGAGAAGG - Intergenic
956195070 3:66646210-66646232 TTATTTGTCAATAAAGCTGTCGG + Intergenic
957284575 3:78201934-78201956 TTGTATCTCAATAAAGCTGGGGG + Intergenic
957932980 3:86906717-86906739 TTGTAACTCAATAAAGCTGATGG + Intergenic
958061848 3:88493781-88493803 TTATACCTCAATAAAGCTGATGG - Intergenic
958500002 3:94893341-94893363 TTTTAAGGCTATAAAGCTGATGG - Intergenic
958815996 3:98916227-98916249 TTTTATGTCCCTGAAGATGATGG - Intergenic
959277446 3:104294546-104294568 TTGTTTCTCCATAAAACTGAAGG + Intergenic
959539255 3:107522304-107522326 TTGCATGTCCACACAGGTGATGG + Intergenic
960578420 3:119250614-119250636 TTGTATGCCCATTTTGCTGAGGG - Intergenic
962263522 3:133929494-133929516 TTGTGGGTCCCTGAAGCTGAGGG - Exonic
962501092 3:135993641-135993663 TGGTATATTCATACAGCTGATGG - Intronic
962834487 3:139175448-139175470 TTATACCTCAATAAAGCTGAGGG - Intronic
962922392 3:139962779-139962801 TTGTTTCTCCATTCAGCTGATGG + Intronic
963863012 3:150330286-150330308 TCATATCTCAATAAAGCTGAAGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
971581463 4:28346760-28346782 TTTCATGAGCATAAAGCTGATGG + Intergenic
971951258 4:33350107-33350129 TTGCATCTCCTAAAAGCTGAGGG - Intergenic
973605674 4:52585146-52585168 TCGTACCTCAATAAAGCTGAGGG + Intergenic
976821615 4:89213406-89213428 TTGTATTTCCCCAAAGCTGTCGG + Intergenic
977826399 4:101537306-101537328 TTGTATGTCGATTTTGCTGAGGG - Intronic
978354046 4:107851458-107851480 TTGGATGGCTAGAAAGCTGAAGG + Intronic
978678783 4:111352756-111352778 TTTTATGTCCCTAGAGATGAGGG - Intergenic
979496887 4:121393464-121393486 TTGGGTGTCAAGAAAGCTGAGGG + Intergenic
979590300 4:122471315-122471337 AGGTACTTCCATAAAGCTGAGGG - Intergenic
980208854 4:129758668-129758690 TTATATCTCAATAAAGCTCAGGG - Intergenic
981008506 4:139900185-139900207 TTGGAAGTACATAAGGCTGATGG + Intronic
991239153 5:64437578-64437600 TTATTTTTCCATGAAGCTGAAGG + Intergenic
992389080 5:76313775-76313797 TTGTATGTTCATTAGGCTAAGGG + Intronic
992536511 5:77710166-77710188 TTATATCTCAATAAAGCTGTTGG + Intronic
997762822 5:136466355-136466377 TTATACTTCAATAAAGCTGAGGG - Intergenic
998752469 5:145337973-145337995 TTATATTTCAATAAAGCTGGAGG + Intergenic
999057101 5:148589697-148589719 GTATATCTCCATAAAGCTGGGGG - Intronic
999207253 5:149858245-149858267 TTATACCTCCATAAAGCTGGTGG + Exonic
1005234957 6:23749443-23749465 TTGTATGTCAATAAAGCTGGGGG - Intergenic
1005369461 6:25115791-25115813 TTATACCTCAATAAAGCTGAGGG + Intergenic
1010921051 6:81681154-81681176 TTGTATGTCCATTATCCTGTTGG - Intronic
1011490354 6:87885171-87885193 TTATCTGTCCATAAAGATAATGG + Intergenic
1012230023 6:96750317-96750339 TTGTGGGTTCATTAAGCTGAAGG - Intergenic
1017193432 6:151677021-151677043 ATATATATCCATAAAGATGAGGG + Intronic
1020393824 7:7690241-7690263 ATGTATTTCCAAAACGCTGAAGG + Intronic
1024105014 7:46074614-46074636 TTGTATCTCAATAAACCTGGAGG + Intergenic
1024214642 7:47238232-47238254 TTATATCTCAATAAAGCTGGTGG + Intergenic
1024357452 7:48428779-48428801 TTATATCTCAATAAAGCTGTGGG - Intronic
1024782243 7:52864930-52864952 GTGGATGTCAATAAAGCTGCAGG - Intergenic
1027295746 7:76768001-76768023 TTGTATGTCGATTTTGCTGAGGG - Intergenic
1027372078 7:77516982-77517004 TTATATCTCTATAAAGCTGGGGG - Intergenic
1027649355 7:80846228-80846250 TTGTAGGTGCATAAAGATCAAGG - Intronic
1027972890 7:85108881-85108903 TTGTATGAAAAAAAAGCTGAGGG - Intronic
1030578997 7:111328666-111328688 TGGGATGTTCATAATGCTGAAGG + Intronic
1035073219 7:156159772-156159794 CTGTATGTCCATACAGGTGTTGG - Intergenic
1036176548 8:6543614-6543636 TTTTGTGTTCATAAAGCTGTAGG + Intronic
1036495332 8:9265295-9265317 TTGCATTTCCATTAAGCTGAGGG + Intergenic
1037010923 8:13841477-13841499 TTTTTTGTCCATAAAACTGATGG + Intergenic
1037308762 8:17532980-17533002 TTGAAGGTCCTTAAAACTGAAGG - Intronic
1037441069 8:18916860-18916882 TTATATCTTAATAAAGCTGAAGG + Intronic
1040396328 8:47003893-47003915 TGGTATGTCCAAAAAGCAGAAGG - Intergenic
1040453378 8:47571418-47571440 TTTTATTTCAATAAAGCTCAGGG + Intronic
1041644100 8:60233913-60233935 TTGTGTGTTTAAAAAGCTGAGGG + Intronic
1042377232 8:68065899-68065921 TTATACCTCCATAAAGCTGGAGG - Intronic
1044939299 8:97324348-97324370 TTATATGTCAATAAAATTGAGGG - Intergenic
1045753781 8:105517383-105517405 TTATATCTCGATAAAGCTAAAGG - Intronic
1047844356 8:128789834-128789856 TTGTAAGTCCTTGAAGATGATGG - Intergenic
1048459303 8:134606893-134606915 TTGGAAGTCCAGAAAACTGAGGG - Intronic
1051511445 9:17882682-17882704 TTATATTTCAATAAAGCTGCTGG - Intergenic
1052036685 9:23689770-23689792 TTATCTGTGCAAAAAGCTGAAGG + Intergenic
1055710016 9:79050392-79050414 TTGTATCTCAATTAAGCTGTAGG + Intergenic
1057559153 9:96113838-96113860 TTGGAGATCCATAAAGCTGGAGG - Intronic
1057940676 9:99280528-99280550 TTTTGTGTCCATCAACCTGAAGG - Intergenic
1058999497 9:110333751-110333773 TTATATATCAATAAAGCTGTAGG + Intronic
1186237742 X:7531700-7531722 ATGTAGGGCCATAAAGCTGGGGG + Intergenic
1188347845 X:29089230-29089252 TCATATCTCAATAAAGCTGAAGG - Intronic
1189063311 X:37778003-37778025 GTGTATTTACATAAACCTGATGG + Intronic
1189370991 X:40429115-40429137 TCGTATCTCAATAAAGCTGGGGG + Intergenic
1190531088 X:51377232-51377254 TTGTTTGTCCATAAAAATAAGGG - Intergenic
1190983816 X:55482696-55482718 TTGTATGGCTAAAGAGCTGATGG + Intergenic
1193101907 X:77623869-77623891 TTGTATGTCGATTTTGCTGAGGG - Intronic
1193878374 X:86892251-86892273 TTTTTTTTCCATAAATCTGAAGG + Intergenic
1197552699 X:127913604-127913626 TTATACGTCAATAAAGCTGGAGG + Intergenic
1198502883 X:137270321-137270343 TTCTAGGTCCATAAACCTGAGGG + Intergenic
1201366915 Y:13216969-13216991 TTTTATGACTATAAAGTTGATGG + Intergenic
1202603824 Y:26621714-26621736 TTGTTTGTTCATGAAGATGAAGG - Intergenic