ID: 935101840

View in Genome Browser
Species Human (GRCh38)
Location 2:100003371-100003393
Sequence TGTGCCCTAGAACATTCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935101840 Original CRISPR TGTGCCCTAGAACATTCTAG AGG Intronic
901846022 1:11982804-11982826 TGTGCCCTGGCACTTTTTAGGGG + Intronic
903376035 1:22866562-22866584 TGTTCCCTTCAACATTCTACTGG - Intronic
903380376 1:22892613-22892635 TGGCCACTGGAACATTCTAGTGG - Intronic
903477478 1:23629474-23629496 TGAGGACTACAACATTCTAGTGG - Exonic
907758815 1:57337805-57337827 GGTGTCCTGGAACTTTCTAGTGG - Intronic
911175565 1:94814183-94814205 TGGTCCCTAGAATTTTCTAGAGG + Intergenic
912057158 1:105616851-105616873 TGTGTCTTAGAACAGTCTAATGG + Intergenic
914870268 1:151467826-151467848 TCTGGCCCAGAACATTCTTGAGG - Intergenic
917901634 1:179548625-179548647 TCTGCCAAAGAACATTGTAGTGG + Intronic
918038863 1:180899939-180899961 TGTGCCCTCTCACACTCTAGGGG - Intergenic
920212143 1:204335940-204335962 TGTGCCCTGGAACACTTTAGAGG - Intronic
923501825 1:234571400-234571422 TGAACTCCAGAACATTCTAGTGG - Intergenic
924614045 1:245598139-245598161 TGTAGCCTAGAACCTTGTAGGGG + Intronic
1063773314 10:9229590-9229612 GCTGCTCTAGAACATTCCAGCGG + Intergenic
1073485054 10:103812019-103812041 GGTGCCCCAGAATCTTCTAGGGG - Intronic
1073603091 10:104865820-104865842 TGTGCCTTAGAACAGGCTTGGGG + Intronic
1073963601 10:108962519-108962541 TGTGCCTTAGAACATGCTCTTGG - Intergenic
1074945286 10:118275309-118275331 TATGCCCAAGAGCATGCTAGTGG - Intergenic
1083386929 11:62317996-62318018 TGTTCCATAGAACCTTCCAGTGG + Intergenic
1085719921 11:78903511-78903533 TGTGCCCTAGATCATCCGGGCGG - Exonic
1087086408 11:94223303-94223325 TGTACCCAATAACCTTCTAGTGG - Intergenic
1089719297 11:120397743-120397765 TGTGCTCTATAAAATTCTAGAGG - Intronic
1092794403 12:12095676-12095698 TGGCCCCTGGACCATTCTAGTGG - Intronic
1095314176 12:40739369-40739391 TGTGATCAAGAACATTTTAGAGG - Intronic
1096986815 12:55764984-55765006 TATCAACTAGAACATTCTAGAGG - Intronic
1098798847 12:74927154-74927176 TGTACCCTAGAACTTACTAGAGG + Intergenic
1102564110 12:113783428-113783450 CATGCCCCAGCACATTCTAGAGG + Intergenic
1118708768 14:68502890-68502912 TCTGCCAGGGAACATTCTAGGGG + Intronic
1124885232 15:33679107-33679129 TGTGCCCTAGAGCATCCTCTAGG - Intronic
1136361428 16:29782420-29782442 TGAGCCCTAGAAGATCCTACGGG - Exonic
1139088890 16:63619393-63619415 TGTGACCTAGATAATTCTTGGGG + Intergenic
1139705902 16:68740361-68740383 TGTGCTCTAGAGCTTTCTATTGG + Intronic
1140241304 16:73203332-73203354 TGGGCCATGGAACTTTCTAGAGG - Intergenic
1144300161 17:13916031-13916053 TGTGCCCTGGGGTATTCTAGGGG - Intergenic
1147863009 17:43534593-43534615 AGTGCCCTGGAAAATTCCAGGGG + Intronic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
927135973 2:20096789-20096811 TGTGCTCTAAAACATTCTCCTGG + Intergenic
927512194 2:23650826-23650848 TGAGCCCTAGAGTTTTCTAGAGG + Intronic
928061725 2:28120419-28120441 TGTGCCCAATAGCATCCTAGAGG + Intronic
931642924 2:64397178-64397200 TGGGCCCTAGAACATGGAAGGGG + Intergenic
932216793 2:69971473-69971495 TGCGCCTTAGAACATTTGAGAGG - Intergenic
935101840 2:100003371-100003393 TGTGCCCTAGAACATTCTAGAGG + Intronic
937077282 2:119116556-119116578 TGTGCCCTAGAACAGTCTTGTGG - Intergenic
938234157 2:129688522-129688544 TGTGGCCTATAACATTCCACTGG - Intergenic
943194519 2:184727915-184727937 TCTGCCCAAGAACATTCAACTGG + Intronic
944091038 2:195912277-195912299 TGTGCTCTAGAAAATCCAAGGGG - Intronic
944190261 2:196995559-196995581 TCTGCCTAAGAACATTCTATAGG + Intronic
1169297679 20:4414062-4414084 TTTTCCCCTGAACATTCTAGGGG + Intergenic
1169301986 20:4450855-4450877 TGTGCACTGCAAAATTCTAGGGG + Intergenic
1169431170 20:5537778-5537800 TATTCCCTGGAAAATTCTAGTGG + Intergenic
1170698544 20:18682634-18682656 TGTGCCTTAGAGCATACAAGAGG + Intronic
950436294 3:12982424-12982446 TGTGCTGTAGAATATTCTAGAGG - Intronic
950856479 3:16110236-16110258 TGTGGGGTAGAACATCCTAGGGG - Intergenic
954822158 3:53339389-53339411 TGTTAACTAGAACATTCTTGGGG - Intronic
959250559 3:103937677-103937699 TGTGCTTTGGAACATTCCAGTGG + Intergenic
961091580 3:124117329-124117351 TTTTCCCTTGAACATTCTGGGGG + Intronic
962663768 3:137632940-137632962 TGTGCCCAAGGACCTTCTTGGGG + Intergenic
966239035 3:177734638-177734660 TGTCCCCTAGAAGAGTCTTGAGG + Intergenic
970148744 4:13066827-13066849 TGTCCCATAGTAGATTCTAGAGG - Intergenic
970609348 4:17710875-17710897 TGTGCCCCTGGACATACTAGTGG + Intronic
971356824 4:25902612-25902634 TATGTCCTAGAAGGTTCTAGGGG - Intronic
971554230 4:27992610-27992632 TGTGACTTATAACATTCTACTGG + Intergenic
972348140 4:38210979-38211001 TGAGCCCTTGCACATTCTAACGG - Intergenic
973614694 4:52666542-52666564 AGTGCTCTAGAAGCTTCTAGAGG + Intergenic
978731141 4:112028169-112028191 TGTTCACTAGAACAGTATAGGGG + Intergenic
982179774 4:152739173-152739195 TCTGCCCCAGAACCTTCTTGGGG - Intronic
996206206 5:120739962-120739984 TTTGCCATAAAACATTTTAGTGG - Intergenic
997610972 5:135215552-135215574 TGTGCCCTATAACATCCTGAAGG + Intronic
1003469219 6:6413161-6413183 TGAGGACTAGAACATTCTAGAGG - Intergenic
1004222219 6:13756712-13756734 TGGGCCCTGGAATATTCCAGTGG - Intergenic
1007308863 6:40929102-40929124 TGTGCACTAGAAAAATCTGGTGG - Intergenic
1014655177 6:124094199-124094221 TGTGACCTATAACACTCTACTGG + Intronic
1018785900 6:167107883-167107905 CGGTCCCCAGAACATTCTAGCGG - Intergenic
1024680810 7:51685194-51685216 TGAGTCCTAAAATATTCTAGGGG + Intergenic
1032192792 7:129774135-129774157 TCTGCTCCAGAACCTTCTAGGGG + Intergenic
1038982292 8:32773185-32773207 TCTGCCCTAGAACTTTCTAAAGG - Intergenic
1041660226 8:60394073-60394095 TCTGCCCTAGTTCTTTCTAGTGG + Intergenic
1043147061 8:76672717-76672739 TGTGCCCTAGTAGGTTCTGGAGG - Intergenic
1051498038 9:17746745-17746767 TGTCCCTTAGAACTTTCAAGAGG + Intronic
1060004914 9:119991560-119991582 TCTCCCCTAGAACCTTCCAGAGG + Intergenic
1061286214 9:129624446-129624468 TGTGACCTAGAATAGTCTAGAGG + Intronic
1186634215 X:11384786-11384808 AGTTCCCCAGACCATTCTAGTGG + Intronic
1188606932 X:32042809-32042831 TGTGTCATAGTACATTCTAGAGG + Intronic
1188695566 X:33186075-33186097 TGTGCCATAGAGCACTCTTGGGG + Intronic
1191675030 X:63784828-63784850 TGTGCCCAGGAACATCCCAGGGG - Intronic
1197837347 X:130709730-130709752 TGAGTCCTAGTATATTCTAGAGG - Intronic