ID: 935102782

View in Genome Browser
Species Human (GRCh38)
Location 2:100012477-100012499
Sequence GACACTTAGGGAGATACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 406}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935102782 Original CRISPR GACACTTAGGGAGATACAGG GGG (reversed) Intronic
900336622 1:2167267-2167289 AACACTTAGAGAGGTAGAGGCGG - Intronic
900802529 1:4746232-4746254 GACACATAGAGATATAGAGGAGG - Intronic
901158935 1:7160314-7160336 GACATTTGGGGAGGGACAGGGGG - Intronic
901788388 1:11639761-11639783 GACACTTTGGGAGGTCGAGGCGG + Intergenic
902320078 1:15656086-15656108 AACACTTTGGGAGGTCCAGGAGG - Intronic
903724112 1:25428367-25428389 TTCACTGAGGAAGATACAGGTGG - Intronic
903933818 1:26880711-26880733 AACACTTTGGGAGTTAAAGGTGG - Intronic
905054334 1:35079862-35079884 GACACTTTGGGAGGCCCAGGCGG + Intronic
905520082 1:38590854-38590876 AGCACTTAGGGAGGTAGAGGTGG + Intergenic
906122164 1:43401170-43401192 AACACTTTGGGAGATTGAGGTGG - Intronic
906150038 1:43582420-43582442 GTCACTCAGGGAGAGTCAGGTGG - Intronic
907201797 1:52733424-52733446 AACACTTTGGGAGACAAAGGTGG + Intronic
907424090 1:54368052-54368074 AACACTTTGGGAGACCCAGGAGG + Intronic
908438253 1:64128205-64128227 AGCACTTAGGGAGATCAAGGTGG + Intronic
909627053 1:77729283-77729305 AACACTTCGGGAGATCAAGGAGG + Intronic
910626890 1:89316700-89316722 GACACTGAGCTAGATGCAGGAGG + Intergenic
911014066 1:93313195-93313217 GACACTTGGGGAGACCGAGGTGG - Intergenic
911262521 1:95702571-95702593 AACACTTTGGGAGACAGAGGAGG - Intergenic
911634593 1:100219895-100219917 AACACTTTGGGAGGTAAAGGCGG + Intronic
912416864 1:109514722-109514744 AACACTTTGGGAGGTCCAGGAGG - Intergenic
914724312 1:150314673-150314695 AACACTTTGGGAGACAGAGGTGG - Intergenic
914878510 1:151529971-151529993 GACGCTTCGGGAGACCCAGGAGG + Exonic
915040798 1:152966871-152966893 GGCACTTTGGGAGATCCAGGCGG - Intergenic
915154017 1:153859420-153859442 GGCACTTTGGGAGACCCAGGTGG + Intronic
915863423 1:159472229-159472251 TACATTTAGGGACATCCAGGAGG - Intergenic
916073571 1:161186749-161186771 AACACTTTGGGAGATCGAGGTGG + Exonic
916659698 1:166911007-166911029 AACAGTTAGGGAGACAAAGGTGG - Exonic
917331484 1:173884984-173885006 GGCACTTTGGGAGATCGAGGTGG + Intronic
917850360 1:179057925-179057947 GTCTCTTAGGTAGATACAGTGGG + Intronic
919018271 1:192069239-192069261 GACTTTTAGGGAGAGACGGGTGG + Intergenic
920208449 1:204310853-204310875 GACATTTAGGGAGAGAAAAGAGG + Intronic
920771328 1:208889015-208889037 GGCACTTTGGGAGACCCAGGTGG - Intergenic
921031821 1:211340881-211340903 GACAGTTTGAGAGATAAAGGTGG - Intronic
921376453 1:214479096-214479118 GGCACTTTGGGAGATCGAGGTGG + Intronic
922101484 1:222480977-222480999 AGCACTTAGGGAGACCCAGGCGG - Intergenic
922488621 1:225997676-225997698 AACACTTAGGGAGGTCGAGGCGG - Intronic
922665539 1:227465661-227465683 GGCACTTTGGGACATACAAGAGG - Intergenic
923604653 1:235432357-235432379 GCCACTCAGTGAGAGACAGGTGG + Intronic
1063001892 10:1932456-1932478 GACACATAGGGAGAGAGAGAAGG + Intergenic
1063078061 10:2736219-2736241 AACACTTTGGGAGATCGAGGTGG + Intergenic
1063384844 10:5609716-5609738 CACTCTTAGGAAGATGCAGGTGG - Intergenic
1064744137 10:18462500-18462522 AACACTTTGGGAGGTCCAGGTGG - Intronic
1064822145 10:19349206-19349228 GACACTTTGGGAGGTCAAGGTGG - Intronic
1065272890 10:24054378-24054400 AACACCTAGGGAGATGGAGGGGG + Intronic
1065402787 10:25325089-25325111 AACACTTTGGGAGATCAAGGTGG - Intronic
1065459815 10:25947638-25947660 AACACTTTGGGAGGTAGAGGTGG - Intronic
1065875557 10:29994539-29994561 AGCACTTAGGGAGGTCCAGGTGG - Intergenic
1065952276 10:30662957-30662979 GATAATTAAGGAGATACATGGGG + Intergenic
1066455878 10:35571591-35571613 GACACATAGGTAGATACTTGAGG + Exonic
1067270096 10:44784209-44784231 GGAACTAAGGGAGCTACAGGAGG - Intergenic
1068508770 10:57937153-57937175 AACACTTTGGGAGACCCAGGTGG - Intergenic
1068611456 10:59064945-59064967 GACACTTTGGGAGATACTGGAGG + Intergenic
1069011878 10:63383449-63383471 ACCACTTTGGGAGACACAGGTGG + Intronic
1069202204 10:65634275-65634297 AACACTTTGGGAGATTGAGGTGG + Intergenic
1070102041 10:73397703-73397725 GACACTTTGGGAGGTTGAGGTGG - Intronic
1070137750 10:73709368-73709390 AACACTTTGGGAGATCGAGGTGG - Intergenic
1072052290 10:91717790-91717812 AACACTTTGGGAGATTGAGGTGG + Intergenic
1073131864 10:101194568-101194590 AACACTTAGGGAGGTTGAGGCGG + Intergenic
1073240464 10:102054746-102054768 AACACTTTGGGAGATCGAGGTGG + Intronic
1074048150 10:109858068-109858090 AGCACTTAGGGAGACAGAGGCGG + Intergenic
1075786201 10:125051886-125051908 GACACTTAGACACAGACAGGGGG + Intronic
1076046030 10:127294887-127294909 GACACTTTGGGAGACTGAGGCGG - Intronic
1077663434 11:4088854-4088876 GAAGCCTAGGGAGATATAGGAGG - Intronic
1078199152 11:9164298-9164320 GGCACTTTGGGAGATTGAGGTGG - Intronic
1078494607 11:11803226-11803248 AGCACTTTGGGAGATCCAGGTGG - Intergenic
1078522999 11:12078244-12078266 AACACTTTGGGAGACAGAGGCGG + Intergenic
1079607825 11:22392023-22392045 AACACTTTGGGAGATTGAGGAGG - Intergenic
1081500462 11:43661563-43661585 AACACTTAGGGAGGCAGAGGTGG + Intronic
1081711811 11:45221690-45221712 GAGACATATGAAGATACAGGAGG + Intronic
1081895919 11:46586157-46586179 AGCACTTAGGGAGATCGAGGTGG + Intronic
1086079535 11:82889106-82889128 AACACTTTGTGAGGTACAGGTGG + Intronic
1086748136 11:90455835-90455857 GACAGTTTGAGAGATAAAGGTGG - Intergenic
1086853531 11:91839428-91839450 GACACTTTGGGAGACTGAGGTGG - Intergenic
1088216539 11:107516769-107516791 AACACTTTGGGAGACAAAGGTGG + Intronic
1088378993 11:109172786-109172808 GACTGTGAGGGAGATACAGGGGG - Intergenic
1088429771 11:109746060-109746082 AACACTTAAGGAGTTAAAGGAGG + Intergenic
1088713490 11:112528709-112528731 GACAATTAGGGAGGAAAAGGGGG - Intergenic
1088931680 11:114357672-114357694 GACAGTTCGAGAGAGACAGGTGG - Intergenic
1089483255 11:118824368-118824390 AACACTTTGGGAGACCCAGGTGG - Intergenic
1089549905 11:119265773-119265795 AACACTTTGGGAGGTCCAGGCGG + Intronic
1091644667 12:2264598-2264620 GAGGGTTAGGGAGAAACAGGAGG - Intronic
1092451590 12:8607399-8607421 GACACTTAGGTAAAGACTGGAGG - Intronic
1093018799 12:14183677-14183699 AACACTTAGGGAGGTAGGGGTGG + Intergenic
1094190301 12:27691014-27691036 GATACTCAGGCAGATAGAGGGGG - Intronic
1094613633 12:32016979-32017001 AACACTTTGGGAGGTCCAGGTGG - Intergenic
1096630399 12:52922865-52922887 GACAGTCTGGGAGATGCAGGAGG + Intronic
1097815362 12:64068029-64068051 GTCACTTTGGGAGATCAAGGCGG + Intronic
1098543658 12:71687110-71687132 AGCACTTTGGGAGACACAGGTGG - Intronic
1099658116 12:85521556-85521578 GAGGCTGAGGGAGAAACAGGTGG - Intergenic
1099710456 12:86217421-86217443 GACACTTTGGGAGGTCGAGGCGG - Intronic
1099853498 12:88135028-88135050 GATACTTAGGGAGATACATAAGG - Intronic
1101004644 12:100390066-100390088 AGCACTTTGGGAGATAGAGGTGG - Intronic
1101938711 12:109082833-109082855 GACACTGAGGGAGCTGCGGGTGG - Exonic
1102113750 12:110385014-110385036 AACACTTAGGGAGACTGAGGCGG + Intronic
1103245592 12:119454393-119454415 GGCACTTAGAGAGAAACAGGAGG - Intronic
1103349131 12:120271146-120271168 AACACTTTGGGAGGTAGAGGTGG - Intergenic
1103787075 12:123440659-123440681 AACACTTTGGGAGATGGAGGTGG + Intergenic
1103805370 12:123568444-123568466 AACACTTTGGGAGATGGAGGCGG + Intergenic
1104053623 12:125212729-125212751 AACACTTTGGGAGATCGAGGTGG - Intronic
1105388031 13:19950023-19950045 AACACTTTGGGAGATTTAGGTGG + Intergenic
1105489134 13:20870501-20870523 AACACTTTGGGAGATCAAGGCGG + Intronic
1107069639 13:36256199-36256221 GTCACTTAGGGAAGTTCAGGAGG + Intronic
1108622476 13:52197324-52197346 GGCACTTTGGGAGATCAAGGCGG - Intergenic
1109025260 13:57146788-57146810 GAGACTCAGGGAGGTAGAGGAGG - Intronic
1109026250 13:57153361-57153383 GAGACTCAGGGAGGTAGAGGAGG - Intronic
1109027242 13:57159932-57159954 GAGACTCAGGGAGGTAGAGGAGG - Intergenic
1109028228 13:57166497-57166519 GAGACTCAGGGAGGTAGAGGAGG - Intergenic
1109029215 13:57173068-57173090 GAGACTCAGGGAGGTAGAGGAGG - Intergenic
1112168963 13:96949394-96949416 TGCACTTAGGGAGGGACAGGAGG + Intergenic
1112622517 13:101066618-101066640 GACAGTTACAGAGAGACAGGTGG + Intronic
1113185383 13:107681419-107681441 GGCAATTAGGGAGCGACAGGGGG - Intronic
1113426867 13:110215310-110215332 AGCACTTTGGGAGATAGAGGCGG + Intronic
1114294026 14:21313252-21313274 AACACTTAGGGAGGCAGAGGTGG + Intronic
1114486196 14:23063483-23063505 GACACCTGGGGAGGTACAGGAGG + Exonic
1114561001 14:23590403-23590425 CACACTTTGGGAGATGAAGGTGG + Intergenic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1115892950 14:38052875-38052897 GAAACTTATGGAGAGAGAGGTGG - Intergenic
1116329648 14:43579150-43579172 GACTCTTTGGGAAAAACAGGAGG + Intergenic
1117906878 14:60598558-60598580 AACACTTTGGGAGATCGAGGCGG - Intergenic
1118129447 14:62946064-62946086 GAAAATTAGGAAGATATAGGAGG + Intronic
1119180296 14:72600752-72600774 GACACCAAGGGAGTCACAGGAGG + Intergenic
1119854878 14:77892006-77892028 GAAACTTAGGGACAGAGAGGAGG + Intronic
1120333062 14:83118245-83118267 AGCACTTTGGGAGACACAGGTGG + Intergenic
1121203131 14:92137454-92137476 AACACTTTGGGAGACAGAGGTGG - Intronic
1121758321 14:96421850-96421872 AACACTTTGGGAGTTCCAGGCGG - Intronic
1122668602 14:103352754-103352776 GACACTTTGGGAGACCGAGGTGG + Intergenic
1202845941 14_GL000009v2_random:175407-175429 GACACTTAGGCAGTTACATTTGG + Intergenic
1124889810 15:33722444-33722466 GACACTGATGGAGAAAAAGGTGG - Intronic
1126577043 15:50207540-50207562 AACACTTTGGGAGGTAGAGGCGG + Intronic
1129434513 15:75527603-75527625 CACACTTTGGGAGGTAGAGGTGG + Intronic
1129830929 15:78669573-78669595 GGCACTTTGGGAGATTGAGGTGG + Intronic
1131297622 15:91165087-91165109 AACACTTTGGGAGAGAGAGGTGG + Intronic
1133142169 16:3754008-3754030 GACACTGAGGGAGGCACTGGTGG + Intronic
1133757219 16:8771046-8771068 GACACTTTGGGAGGTTGAGGCGG + Intronic
1134233063 16:12444390-12444412 GATGCTGAGGGAGATGCAGGTGG + Intronic
1134446811 16:14337318-14337340 AACACTTTGGGAGGTAAAGGCGG - Intergenic
1134568644 16:15273009-15273031 AACACTTCGGGAGATCAAGGTGG + Intergenic
1134733789 16:16483353-16483375 AACACTTCGGGAGATCAAGGTGG - Intergenic
1134933711 16:18228929-18228951 AACACTTCGGGAGATCAAGGTGG + Intergenic
1135039143 16:19104558-19104580 AACACTTTGGGAGACAGAGGCGG - Intergenic
1136298293 16:29316306-29316328 GACACAGAGGGAGACACGGGGGG - Intergenic
1136585428 16:31181160-31181182 GACACTTCGGGAGGCCCAGGCGG - Intronic
1137946434 16:52737189-52737211 CACACTTTGGGAGATCAAGGTGG - Intergenic
1138015503 16:53424813-53424835 GACACCTTGGGAAAAACAGGAGG - Intergenic
1138501911 16:57451417-57451439 AACACTTTGGGAGATCTAGGCGG - Intronic
1140324383 16:73987540-73987562 AACACTTTGGGAGATCAAGGTGG + Intergenic
1140709063 16:77659468-77659490 AACACTTTGGGAGGTCCAGGCGG - Intergenic
1140996429 16:80264238-80264260 AACACTTATGGAGGTAGAGGTGG - Intergenic
1141354315 16:83329482-83329504 GGCACTTTGGGAGATCGAGGTGG - Intronic
1141847913 16:86623440-86623462 GAAACTTGGGGAGAGACAGTGGG + Intergenic
1142378641 16:89719963-89719985 GACACTTTGGGAGGCCCAGGCGG - Intronic
1143036582 17:4003154-4003176 AACACTTAGGGAGGTCGAGGTGG - Intergenic
1143048116 17:4099467-4099489 GACACTTTGGGAGGCAGAGGTGG - Intronic
1144333470 17:14247427-14247449 GCCACTGAGGGAGTTACATGAGG - Intergenic
1144922694 17:18777788-18777810 CACACTTTGGGAGACCCAGGAGG - Intronic
1145181097 17:20753117-20753139 AACACTTTGGGAGACCCAGGCGG - Intergenic
1146294843 17:31641397-31641419 AACACTTTGGGAGGTCCAGGCGG - Intergenic
1146406967 17:32547152-32547174 AACACTTTGGGAGGTAGAGGTGG - Intronic
1147699749 17:42386032-42386054 AGCACTTTGGGAGATAGAGGTGG + Intronic
1148144691 17:45355745-45355767 AACACTTTGGGAGGCACAGGCGG - Intergenic
1148181005 17:45604792-45604814 CACACTTCGGGAGAAAGAGGTGG - Intergenic
1148267904 17:46241127-46241149 CACACTTCGGGAGAAAGAGGTGG + Intergenic
1149057078 17:52379447-52379469 GAAATTTAGGGAGACAGAGGTGG + Intergenic
1149165057 17:53741561-53741583 GACATTTTGGTAGATACTGGAGG + Intergenic
1149381101 17:56094765-56094787 GACACTTTGGGAGGTCAAGGTGG - Intergenic
1149799026 17:59549178-59549200 AGCACTTTGGGAGGTACAGGCGG - Intergenic
1150096945 17:62385194-62385216 AACACTTTGGGAGGTAGAGGTGG + Intronic
1150171594 17:63001793-63001815 AACACTTTGGGAGGTAGAGGCGG - Intergenic
1150579480 17:66459123-66459145 AACACTTTGGGAGATTGAGGTGG + Intronic
1150912666 17:69405207-69405229 AACACTTTGGGAGATCGAGGTGG - Intergenic
1152457870 17:80426399-80426421 AACACTTTGGGAGACAGAGGTGG + Intronic
1153553854 18:6290161-6290183 GGCACTTTGGGAGATCCAGGTGG - Intronic
1153672079 18:7420998-7421020 GACACTTAGGGAGAAACAGGGGG + Intergenic
1154965740 18:21354338-21354360 AACACTTAGGGAGGCAGAGGTGG + Intronic
1155050409 18:22142242-22142264 AACACTTTGGGAGGTCCAGGTGG + Intergenic
1156054195 18:32978787-32978809 AGCACTTAGGGAGGTCCAGGCGG + Intronic
1157086456 18:44585377-44585399 AACACTTTGGGAGACAAAGGTGG + Intergenic
1157264503 18:46206331-46206353 GGCACTTTGGGAGGTAGAGGTGG - Intronic
1158368689 18:56771632-56771654 GGCACTTTGGGAGATTGAGGTGG + Intronic
1158467127 18:57700673-57700695 AACACTTTGGGAGATCAAGGAGG + Intronic
1158506967 18:58055207-58055229 ACCACTTTGGGAGATAGAGGTGG + Intronic
1159021300 18:63145334-63145356 GAGACCCAGGGGGATACAGGGGG + Intronic
1159029089 18:63212627-63212649 AGCACTTTGGGAGATCCAGGCGG + Intronic
1159088037 18:63816867-63816889 GGCACTTTGGGAGACAGAGGTGG - Intergenic
1159944802 18:74436512-74436534 CACACTGAGGGAGCTGCAGGAGG - Exonic
1159947463 18:74454994-74455016 GACACCTAGGGAGATGGATGTGG + Intronic
1160741822 19:689804-689826 GACACTTTGGGAGACCAAGGTGG + Intronic
1161267342 19:3370337-3370359 GACCCAGAGGGAGATACAGCGGG - Intronic
1162825747 19:13250641-13250663 AACACTTTGGGAGACAGAGGTGG - Intronic
1163418260 19:17200118-17200140 AGCACTTTGGGAGATCCAGGCGG - Intronic
1163751436 19:19080532-19080554 AACACTTTGGGAGGTTCAGGTGG + Intronic
1164236506 19:23341294-23341316 AACACTTTGGGAGGTAGAGGCGG - Intronic
1164942647 19:32263584-32263606 AGCACTTTGGGAGGTACAGGTGG - Intergenic
1165910819 19:39225737-39225759 AACACTTTGGGAGATCAAGGTGG - Intergenic
1165982718 19:39738181-39738203 GACAGTGAGGGAGGTACTGGAGG + Intergenic
1166302686 19:41921346-41921368 GACACGGAGGGAGATGGAGGGGG + Intronic
1166692785 19:44833746-44833768 GGCACTTTGGGAGACAGAGGTGG + Intergenic
1168272424 19:55257685-55257707 GTGACTTAGGGAGCTGCAGGGGG - Intronic
1168544329 19:57238079-57238101 AACACTTTGGGAGGTAAAGGCGG - Intergenic
1168668614 19:58224132-58224154 TACATTTAGGGATATACTGGGGG - Intergenic
925797653 2:7564326-7564348 GACACTTTGGGAGGTCAAGGTGG + Intergenic
925800046 2:7590056-7590078 GACACTTGGGCAGATTCAGCAGG + Intergenic
926909389 2:17836485-17836507 AGCACTTAGGGAGACAGAGGCGG - Intergenic
927330824 2:21861505-21861527 AACACTTTGGGAGGTAGAGGTGG + Intergenic
928958075 2:36892213-36892235 GGCACTTAGGGACATAAAGATGG + Intronic
930113116 2:47695860-47695882 AACACTTTGGGAGGCACAGGCGG - Intronic
930776864 2:55181374-55181396 AACACTTTGGGAGGTAGAGGTGG - Intronic
932537811 2:72618119-72618141 AGCACTTTGGGAGATAGAGGGGG + Intronic
934959948 2:98663958-98663980 AGCACTTTGGGAGGTACAGGTGG + Intronic
935102782 2:100012477-100012499 GACACTTAGGGAGATACAGGGGG - Intronic
935233550 2:101119395-101119417 GACACTTAGGGTGGAAGAGGAGG - Intronic
935574432 2:104694142-104694164 GACACTTTGGGAGGCAGAGGTGG - Intergenic
935583538 2:104780590-104780612 AGCACTTTGGGAGACACAGGTGG + Intergenic
935814683 2:106836678-106836700 AACACTTTGGGAGGAACAGGTGG + Intronic
935965354 2:108467542-108467564 AACACTTTGGGAGATGCAAGTGG - Intronic
936993033 2:118386269-118386291 GAGACTTCAGGAGAGACAGGTGG + Intergenic
937190033 2:120086380-120086402 TACAAGTAGGGAGATACAGTTGG + Intronic
939501973 2:142998759-142998781 GACACTTTGGGAGGTTGAGGAGG + Intronic
939503561 2:143015545-143015567 GACATTTAAGGACATACAGATGG - Intronic
940515941 2:154684131-154684153 GCCACTCAGGGAGAAATAGGTGG + Intergenic
941737610 2:168996450-168996472 GAAACTTAGGAGGATACAAGTGG - Intronic
942396069 2:175551039-175551061 AACACTTTGGGAGACCCAGGCGG - Intergenic
943974815 2:194460831-194460853 AGCACTTTGGGAGACACAGGCGG + Intergenic
944137032 2:196411250-196411272 AACACTTTGGGAGATGGAGGTGG - Intronic
944826785 2:203491753-203491775 AACACTTAGGGAGATGGAGGTGG - Intronic
945074789 2:206027449-206027471 AACACTTTGGGAGGTAAAGGTGG + Intronic
946588022 2:221212292-221212314 GAGACTTAGGGAGTTATAGCAGG - Intergenic
948176605 2:235948430-235948452 GAGACTTTGGGAGATGGAGGTGG - Intronic
948882284 2:240865827-240865849 AACACTTTGGGAGGTAGAGGTGG + Intergenic
1168841264 20:911451-911473 GACACTCGGGGAGGTAGAGGTGG + Intronic
1168886414 20:1262052-1262074 GGCACTTTGGGAGGTAGAGGTGG - Intronic
1169240558 20:3975739-3975761 CACACAGAGAGAGATACAGGAGG + Intronic
1171043178 20:21785713-21785735 GACACTTTGGGAGGCCCAGGCGG - Intergenic
1171492063 20:25526916-25526938 AACACTTTGGGAGAAAAAGGCGG + Intronic
1172077931 20:32313953-32313975 GACACTTTGGGAGACTAAGGTGG - Intronic
1172756792 20:37290854-37290876 AACACTTTGGGAGGTCCAGGAGG - Intronic
1173095871 20:40027656-40027678 AACAGTTTGGGGGATACAGGTGG + Intergenic
1173455638 20:43199198-43199220 GACAGATAGGGAGAGAGAGGAGG - Intergenic
1173851293 20:46220068-46220090 GAAACCTAGTGAGAGACAGGAGG + Intronic
1174009369 20:47437197-47437219 AGCACTTAGGGAGATCAAGGTGG + Intergenic
1175905854 20:62378965-62378987 GACACATAGGCAGACAGAGGTGG + Intergenic
1176157427 20:63628599-63628621 AACACTTTGGGAGACAAAGGTGG + Intergenic
1177064540 21:16413205-16413227 AACACTTTGGGAGAGAGAGGTGG + Intergenic
1177305652 21:19311801-19311823 AACACTTTGGGAGACAGAGGCGG - Intergenic
1177371545 21:20210506-20210528 GGCACTTAGGGAGGTTGAGGCGG - Intergenic
1178077659 21:29026627-29026649 AACACTTTGGGAGATCGAGGTGG - Intronic
1178874053 21:36399281-36399303 GACACTTTGGGAGGCAGAGGCGG - Intronic
1183043119 22:35198235-35198257 CACACATGGGGAGATGCAGGTGG - Intergenic
1183157655 22:36087464-36087486 AACACTTTGGGAGATGGAGGTGG + Intergenic
1183312974 22:37121421-37121443 AGCACTTAGGGAGGTCCAGGTGG - Intergenic
1183366785 22:37411133-37411155 GACACTGAGGCACACACAGGCGG + Intronic
1183435683 22:37793297-37793319 AGCACTTTGGGAGATAGAGGCGG + Intergenic
1183598690 22:38827479-38827501 GACACTTTGGGAGGTTGAGGTGG - Intronic
1184135345 22:42545672-42545694 AACACTTAGGGAGGTGGAGGCGG + Intergenic
1184764726 22:46565891-46565913 AACACTTAGGGAGGCCCAGGCGG - Intergenic
1185412378 22:50690477-50690499 AACACTTTGGGAGACAGAGGCGG - Intergenic
950608175 3:14103315-14103337 GGCACTTAGGGACATAAAGATGG + Intergenic
951207027 3:19935762-19935784 GGCACTTTGGGAGGTAGAGGCGG + Intronic
951234232 3:20216017-20216039 GACACTTTGGGAGGTTGAGGAGG + Intergenic
952979824 3:38725737-38725759 GGCTCTTAGGGAGCTCCAGGTGG - Intronic
953328916 3:42035614-42035636 GACAATTAGGGAGATCTGGGAGG - Intronic
954018070 3:47713073-47713095 AACACTTTGGGAGGTCCAGGCGG + Intronic
955318380 3:57957487-57957509 GACACTTTGGGAGACTGAGGTGG + Intergenic
955847365 3:63179993-63180015 GGCACTTAGGGAGGCAGAGGAGG - Intergenic
957824692 3:85425758-85425780 GACAGTTTGAGAGATAAAGGTGG + Intronic
958628477 3:96657320-96657342 AACACTTTGGGAGATGGAGGCGG + Intergenic
961632935 3:128314589-128314611 AACACTTTGGGAGGCACAGGTGG - Intronic
961814808 3:129543979-129544001 GACACCTAGGGAGATAGGGAGGG + Intronic
964362320 3:155911587-155911609 AGCACTTAGGGAGATCAAGGTGG + Intronic
964775431 3:160270741-160270763 GAGCCTTAGGGATATACATGGGG - Intronic
965608416 3:170519527-170519549 AACACTTAGGGAGGTCAAGGCGG + Intronic
966130264 3:176629583-176629605 AACACTTCGGGAGATCAAGGTGG + Intergenic
966690582 3:182737592-182737614 GACACTTTGGGAGACCAAGGTGG + Intergenic
968134951 3:196214599-196214621 GACACTTATTGAGACAGAGGAGG - Intronic
968784123 4:2606295-2606317 AACACTTTGGGAGACAGAGGTGG - Intronic
969370951 4:6731334-6731356 GACCCTTTGGGAGAGACAAGGGG + Intergenic
971031977 4:22648152-22648174 AACACTTTGGGAGGCACAGGCGG - Intergenic
972352724 4:38251872-38251894 GACACTCAGGAAGATGAAGGAGG + Intergenic
974405059 4:61456061-61456083 GCCACTTTGGGAGATCAAGGCGG - Intronic
974435782 4:61856118-61856140 GGCACTTAGGGAGGTTGAGGTGG + Intronic
974456598 4:62136855-62136877 CACACTTAGGAAGATAAAAGGGG - Intergenic
974844534 4:67335342-67335364 GACTCTTAGGGAGATTCAATGGG + Intergenic
975080658 4:70276092-70276114 GGCACTTAGGGAGACTGAGGGGG + Intergenic
975575186 4:75855558-75855580 CACACTTTGGGAGACAAAGGAGG + Intergenic
978892112 4:113842153-113842175 GACACTTATGAATTTACAGGTGG - Intergenic
979258313 4:118626596-118626618 AGCACTTAGGGAGACCCAGGCGG + Intergenic
979290269 4:118972191-118972213 TACACTTTGGGAGACAGAGGTGG + Intronic
981776554 4:148374839-148374861 GTCTTTTTGGGAGATACAGGGGG - Intronic
981998259 4:150998600-150998622 GACACTTTGGGAGGCTCAGGTGG - Intronic
982312691 4:154002400-154002422 GACACTTAGTGCTCTACAGGAGG - Intergenic
982748769 4:159133964-159133986 GGCACTTTGGGAGGTCCAGGCGG - Intronic
983597840 4:169490535-169490557 GAAACTCAGGGATATACAAGAGG + Intronic
984040712 4:174730074-174730096 GTCACTTTGGAAGATACATGGGG - Intronic
984677184 4:182563165-182563187 AACACTTAGGGAGGTTGAGGCGG + Intronic
984873818 4:184350013-184350035 GAGACTCAGAGAGAAACAGGGGG + Intergenic
985080270 4:186258012-186258034 GTGACTCAGGGAGATTCAGGTGG + Exonic
985181944 4:187274041-187274063 GACACAGAGGGAGTTAAAGGAGG + Intergenic
985246210 4:187982245-187982267 GACACTTAGGGAGGAAGTGGAGG + Intergenic
985657938 5:1141790-1141812 GACACTCAGGCAGAGACAAGAGG + Intergenic
986568689 5:9142717-9142739 AACACTTTGGGAGCTAAAGGTGG + Intronic
987732051 5:21786397-21786419 AGCACTTTGGGAGGTACAGGTGG - Intronic
990229315 5:53694143-53694165 GAAACTTAGCAAGATACAGGAGG + Intergenic
991070571 5:62475152-62475174 AACACTTTGGGAGACAAAGGTGG - Intronic
992041065 5:72833331-72833353 AGCACTTAGGGAGGTAGAGGTGG - Intronic
992636720 5:78731628-78731650 GACACTCAGAGACACACAGGAGG - Intronic
994438104 5:99763851-99763873 GACACTTAGCTAGCTGCAGGAGG - Intergenic
994669986 5:102753940-102753962 GACACTGAGGAAGATAAAGAAGG - Intergenic
995021725 5:107374153-107374175 GATACTTAGAGAGAAAGAGGGGG + Intergenic
996811684 5:127522637-127522659 TACACTTTGGGAGGTAGAGGTGG - Intronic
997341955 5:133152003-133152025 AACACTTTGGGAGAGGCAGGAGG + Intergenic
997654996 5:135547966-135547988 GACACTGAGGGAGAGAGAAGTGG + Intergenic
997986099 5:138502680-138502702 AACACTTTGGGAGACAGAGGCGG + Intergenic
998193738 5:140048158-140048180 AACTCTTAGGGAGACAGAGGTGG + Intergenic
999299809 5:150484442-150484464 AACACTTTGGGAGGTTCAGGCGG - Intergenic
999760992 5:154701054-154701076 AACACTTTGGGAGATTGAGGAGG - Intergenic
1000879187 5:166677502-166677524 GACACTGTGGAAGATACGGGGGG - Intergenic
1001298489 5:170516207-170516229 GACACTTAGGGGGACAAGGGTGG - Intronic
1001458625 5:171888248-171888270 GAGACTTAGGGAAATCCAAGAGG + Intronic
1002045493 5:176539440-176539462 AGCACTTTGGGAGATCCAGGCGG + Intergenic
1002405499 5:179027108-179027130 TTCACTGAGGGAGATATAGGTGG - Intronic
1004723005 6:18284786-18284808 GCCACTTAGGGAGGCAGAGGCGG + Intergenic
1005481900 6:26262854-26262876 AACACTTTGGGAGAGAGAGGTGG + Intergenic
1005620085 6:27612047-27612069 AGCACTTTGGGAGATCCAGGCGG - Intergenic
1005631654 6:27713754-27713776 AGCACTTAGGGAGACATAGGTGG + Intergenic
1005867657 6:29948322-29948344 GACACTCTGGGTGATATAGGAGG + Intergenic
1005925109 6:30437919-30437941 AGCACTTTGGGAGATAGAGGAGG + Intergenic
1006538790 6:34722374-34722396 AACACTTAGGGAGTTCGAGGTGG - Intergenic
1008548711 6:52606256-52606278 AACACTTTGGGAGATCGAGGCGG - Intergenic
1008672886 6:53791561-53791583 AACACTTAGGGAGGCCCAGGCGG - Intergenic
1010236042 6:73575489-73575511 AACACTTAGGGAGGCAGAGGTGG - Intergenic
1010248786 6:73686937-73686959 AACACTTTGGGAGACCCAGGCGG - Intergenic
1010421274 6:75679164-75679186 GACACTTTGGGAGGTCAAGGTGG + Intronic
1010715270 6:79221733-79221755 GACACTGAGGGAGAGGCAGGAGG + Intronic
1010851226 6:80780878-80780900 GACACTCCATGAGATACAGGAGG - Intergenic
1011281533 6:85682663-85682685 AACACTTTGGGAGGTCCAGGTGG - Intergenic
1011389422 6:86835762-86835784 GACACTCAGGTGGGTACAGGAGG - Intergenic
1013081232 6:106815232-106815254 GACTCCTTGGGAGAAACAGGAGG + Intergenic
1014312561 6:119822482-119822504 GAGACCTAGGCAGAAACAGGTGG + Intergenic
1014549055 6:122767661-122767683 CCCACTTAGGGAGACAGAGGTGG + Intergenic
1015534327 6:134252002-134252024 AACACTTTGGGAGACAGAGGTGG - Intronic
1015732413 6:136362171-136362193 AACACTTTGGGAGGTTCAGGTGG + Intronic
1015928706 6:138335136-138335158 GACACTGAGGGAGCTCCCGGTGG - Exonic
1016934612 6:149440491-149440513 AACACTTTGGGAGGTAGAGGCGG - Intergenic
1018394117 6:163364205-163364227 GACACTTTGGGAGGTCGAGGTGG - Intergenic
1018611920 6:165655151-165655173 GACTCTGAGGGAAATACAGACGG - Intronic
1019426988 7:982610-982632 CACCCTCAGGGAGATGCAGGTGG + Intergenic
1020265874 7:6559736-6559758 AACACTTAGGGAGGCAGAGGTGG - Intergenic
1020433593 7:8138266-8138288 GACCCTTAGGTAGATGCAGAGGG - Intronic
1022442449 7:30445509-30445531 GACACTTTGGGAGACCGAGGTGG + Intronic
1022547107 7:31199983-31200005 GGCACTTAGGGAGTAAAAGGAGG - Intergenic
1023400295 7:39787901-39787923 AGCACTTAGGGAGACCCAGGCGG + Intergenic
1023614343 7:42004722-42004744 AACACTTTGGGAGACCCAGGTGG - Intronic
1023647034 7:42328415-42328437 GAAATCTAGGGAGGTACAGGAGG + Intergenic
1023910630 7:44553232-44553254 GACAGTTTGAGAGATAAAGGTGG - Intergenic
1024073229 7:45803653-45803675 AGCACTTAGGGAGACCCAGGCGG + Intergenic
1024650102 7:51396537-51396559 AGCACTTAGGGAGACCCAGGCGG - Intergenic
1025132299 7:56382336-56382358 AGCACTTAGGGAGACCCAGGTGG - Intergenic
1025911734 7:65834014-65834036 GGCACTTTGGGAGAGCCAGGCGG + Intergenic
1026272747 7:68850732-68850754 AGCACTTTGGGAGATCCAGGAGG - Intergenic
1026401720 7:70020916-70020938 AACACTTTGGGAGATCAAGGTGG - Intronic
1027412770 7:77939356-77939378 AACACTTTGGGAGCTAGAGGAGG + Intronic
1028134253 7:87209921-87209943 GACAGTGAGAGAGAAACAGGAGG + Intronic
1028372561 7:90110661-90110683 GACACTTAAAGATATACAGATGG + Intergenic
1028949436 7:96618408-96618430 GAGAGTTAGCTAGATACAGGAGG - Intronic
1029115625 7:98235585-98235607 AACACTTTGGGAGACAGAGGTGG + Intronic
1029503319 7:100947389-100947411 AACACTTTGGGAGATCAAGGCGG - Intergenic
1029627270 7:101727809-101727831 GACACTGAGGCAGAAACAAGGGG + Intergenic
1031666126 7:124484320-124484342 AACACTTTGGGAGACAGAGGCGG - Intergenic
1032050617 7:128647344-128647366 AGCACTTAGGGAGACCCAGGCGG + Intergenic
1034053714 7:148012163-148012185 GACACTTTGGGAGACTGAGGGGG - Intronic
1034778058 7:153849858-153849880 GACACTTAAAATGATACAGGAGG - Intergenic
1035239523 7:157520763-157520785 AGCACTTTGGGAGGTACAGGTGG - Intergenic
1035514967 8:224970-224992 GACACTTTGGGAGGCAGAGGCGG + Intergenic
1035990028 8:4479646-4479668 AGCACTTTGGGAGATCCAGGTGG + Intronic
1036129290 8:6093502-6093524 GACATTTAGGGAAACAGAGGAGG - Intergenic
1036279958 8:7392340-7392362 GACACTGAGAGAAATACAAGAGG + Intergenic
1036341566 8:7919543-7919565 GACACTGAGAGAAATACAAGAGG - Intergenic
1036454960 8:8898432-8898454 AACACTTTGGGAGGTAGAGGTGG + Intergenic
1036556781 8:9867108-9867130 GCCTCTGAGGGAGTTACAGGAGG - Intergenic
1036944099 8:13078485-13078507 AACACTTTGGGAGATGGAGGAGG - Intergenic
1037186673 8:16072740-16072762 GACAATTGGGGAGATTTAGGAGG + Intergenic
1038277592 8:26134825-26134847 GACACTTTGGGAGGTCAAGGTGG - Intergenic
1039756858 8:40532748-40532770 AACACTTTGGGAGGTAGAGGTGG + Intronic
1039773175 8:40709356-40709378 GACATTTAGGGGTATACATGAGG - Intronic
1042926635 8:73974133-73974155 GACACTTTGGGAGGCCCAGGCGG + Intronic
1043937708 8:86160834-86160856 AACACTTTGGGAGGTTCAGGCGG - Intergenic
1047740651 8:127803639-127803661 ATCACTTTGGGAGATAGAGGTGG + Intergenic
1047929485 8:129712675-129712697 GAGACTAAGGGAGAGATAGGTGG + Intergenic
1049082457 8:140454039-140454061 AACACTTTGGGAGACAGAGGCGG + Intronic
1049085476 8:140475058-140475080 GACACTTAAAGATATACATGTGG - Intergenic
1050511928 9:6405501-6405523 AGCACTTTGGGAGATAGAGGTGG - Intergenic
1056783633 9:89571911-89571933 AACACTTTGGGAGATCAAGGTGG + Intergenic
1057250184 9:93494707-93494729 GTCACTTGGGGAAATTCAGGAGG + Intronic
1058033760 9:100228236-100228258 GGCACTTTGGGAGATCGAGGCGG - Intronic
1058920329 9:109608348-109608370 GAGAATTAGGGAGATATAGGAGG + Intergenic
1059694160 9:116715156-116715178 GCCACTTTGGGAGATACCAGGGG - Intronic
1060088604 9:120722951-120722973 GACACTTTGGGAGGCCCAGGCGG + Intergenic
1060092921 9:120760381-120760403 GGCACTTTGGGAGGTAGAGGCGG + Exonic
1060129311 9:121079418-121079440 AACACTTTGGGAGGTAGAGGTGG + Intronic
1061575782 9:131505021-131505043 AACACTTTGGGAGACCCAGGTGG - Intronic
1062648087 9:137560342-137560364 GAGACTTAGGAAAAAACAGGTGG + Intronic
1185817972 X:3173887-3173909 AACACTTTGGGAGATCAAGGTGG - Intergenic
1186852870 X:13597534-13597556 GGCACTTAGGGAGGTCGAGGTGG + Intronic
1187011347 X:15283582-15283604 GACACTTCCGGACACACAGGCGG + Exonic
1189458995 X:41221848-41221870 GGCAGTGAGGGAGATACAAGTGG + Intronic
1189852705 X:45193024-45193046 AACACTTTGGGAGGTAGAGGCGG - Intronic
1190124861 X:47695184-47695206 AACACTTTGGGAGATTGAGGTGG - Intergenic
1190419060 X:50209601-50209623 GACACTTTGGGAGACCAAGGCGG - Intronic
1190785719 X:53646403-53646425 GACACTTTGGGAGGTTGAGGCGG - Intronic
1192537051 X:71937130-71937152 GACAGTTGAGGAGTTACAGGTGG + Intergenic
1193715400 X:84930155-84930177 AACACTTAGGGAGGCAGAGGCGG + Intergenic
1196287966 X:113904557-113904579 GACACTTAGGAAACTAGAGGTGG + Intergenic
1198104943 X:133453338-133453360 AACACTTTGGGAGACGCAGGTGG - Intergenic
1198324613 X:135555934-135555956 GACACTTTGGGAGACTGAGGTGG - Intronic
1198498309 X:137215998-137216020 GACACCTTGGGAAAAACAGGAGG + Intergenic
1198866162 X:141125316-141125338 AACACTTAGGGAGACTGAGGCGG + Intergenic
1200254269 X:154571323-154571345 AACACTTAGGGAGGCACAGGTGG - Intergenic
1200263500 X:154633085-154633107 AACACTTAGGGAGGCACAGGTGG + Intergenic
1201448515 Y:14084134-14084156 CACCCTTAGGTAGAGACAGGAGG + Intergenic
1202305857 Y:23469725-23469747 GACACTTTGGGAGGTCGAGGTGG - Intergenic
1202564952 Y:26200864-26200886 GACACTTTGGGAGGTCGAGGTGG + Intergenic