ID: 935105127

View in Genome Browser
Species Human (GRCh38)
Location 2:100035494-100035516
Sequence GGCTGATCAAAAAAGTTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935105127_935105129 -3 Left 935105127 2:100035494-100035516 CCTACTAACTTTTTTGATCAGCC 0: 1
1: 0
2: 0
3: 11
4: 115
Right 935105129 2:100035514-100035536 GCCTTAGCGAAGAAGCACATGGG 0: 1
1: 0
2: 0
3: 14
4: 76
935105127_935105128 -4 Left 935105127 2:100035494-100035516 CCTACTAACTTTTTTGATCAGCC 0: 1
1: 0
2: 0
3: 11
4: 115
Right 935105128 2:100035513-100035535 AGCCTTAGCGAAGAAGCACATGG 0: 1
1: 0
2: 0
3: 12
4: 145
935105127_935105131 18 Left 935105127 2:100035494-100035516 CCTACTAACTTTTTTGATCAGCC 0: 1
1: 0
2: 0
3: 11
4: 115
Right 935105131 2:100035535-100035557 GGAGCAGACACCACAAAGTATGG 0: 1
1: 0
2: 0
3: 13
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935105127 Original CRISPR GGCTGATCAAAAAAGTTAGT AGG (reversed) Intronic
902250140 1:15149096-15149118 GTCTGAAAAAAAAAGTCAGTGGG + Intergenic
903582422 1:24381703-24381725 GGCTGACCAAAAAACTCTGTGGG - Intronic
918659298 1:187070272-187070294 GACTTATCAGAGAAGTTAGTAGG - Intergenic
921561876 1:216668631-216668653 GGCTGATGAAAAAAGATCTTTGG - Intronic
922429269 1:225531856-225531878 AGGTGAGAAAAAAAGTTAGTAGG - Intronic
923616323 1:235541089-235541111 CTCTGATTAAAAAAGTCAGTAGG + Intergenic
1066128770 10:32369526-32369548 GGCAGACCAAAAAATTTACTTGG + Intronic
1067454451 10:46407762-46407784 GGCTGACCAAAACAGTTACAAGG - Intergenic
1067632753 10:47976870-47976892 GGCTGACCAAAACAGTTACAAGG + Intergenic
1067921963 10:50468218-50468240 GTCTGATGTAAACAGTTAGTGGG + Intronic
1072698938 10:97625927-97625949 GTCTCTACAAAAAAGTTAGTTGG - Intronic
1074958730 10:118419061-118419083 GCCTAATCAAAATAATTAGTAGG - Intergenic
1075939295 10:126375366-126375388 CTCTCATCAAAAAAGATAGTGGG - Intronic
1076897511 10:133320108-133320130 GGCTCAGAAAAAAAGGTAGTAGG + Intronic
1078153785 11:8780889-8780911 GGCTGAACAGAAAAATCAGTAGG + Intronic
1078669229 11:13350208-13350230 GGCTGGTCAAAAAAGGGAGTGGG + Intronic
1082008616 11:47435724-47435746 GGTTGATCAAACAAGTAAGTAGG - Intergenic
1082875223 11:57981037-57981059 GGCTGATCAACAACGTTTATTGG - Intergenic
1085042381 11:73334291-73334313 GGCAGAGCATAAAAGTTAGATGG + Intronic
1087781629 11:102306950-102306972 GGCTTATCAAAACAGGAAGTGGG + Intergenic
1088638208 11:111845133-111845155 GAGTGATAAAAAAACTTAGTTGG + Intronic
1093223745 12:16455235-16455257 GGCTGTTCTAAATAGTTTGTAGG + Intronic
1093274201 12:17103814-17103836 GGCAAATCAAAAAGCTTAGTAGG + Intergenic
1093790667 12:23245756-23245778 TGCTGATAAAATAAGTTAATTGG + Intergenic
1097332417 12:58345908-58345930 GGCTCATCAAAAAAGGTGCTTGG + Intergenic
1102733259 12:115133621-115133643 AACTGAAAAAAAAAGTTAGTTGG - Intergenic
1103354552 12:120310202-120310224 GGCAGATCACAAAAATTAGCTGG + Intronic
1110652020 13:77952647-77952669 GGCTGAAGAAAAAATTTAATGGG + Intergenic
1111876669 13:93905588-93905610 GGCTGATCAGAACAGTCAGGAGG + Intronic
1117335999 14:54757861-54757883 GTCTGATCAGAAAAGGTGGTAGG + Intronic
1118574231 14:67225576-67225598 GGCTGATCTAAAAAGCAGGTTGG - Intronic
1118874236 14:69769287-69769309 GGCTTTTTAAAAAAGTTAATGGG + Intronic
1125107332 15:35988018-35988040 GAATGATCAAAAGAGTGAGTTGG + Intergenic
1125137391 15:36359380-36359402 CACTGATCAAAAAAGGAAGTTGG - Intergenic
1126917321 15:53480272-53480294 GGCTGCTCAAGAAATTTTGTGGG + Intergenic
1127540410 15:59932538-59932560 GGCTGATTGCAAAAATTAGTGGG - Intergenic
1127990407 15:64110710-64110732 GGCTTTTGAAAAAAGTTAGGTGG + Intronic
1129684442 15:77677182-77677204 GGAAGAGCAAGAAAGTTAGTGGG + Intronic
1129981406 15:79874650-79874672 GGCTGACCAAAAAACTTAAAAGG + Intronic
1130429339 15:83831024-83831046 GGCTAATCAAAAGAGTTGATAGG + Intronic
1137416556 16:48287373-48287395 GGCTGACCAAAAAACTTAAATGG - Intronic
1137834823 16:51581992-51582014 GACTTTTCAAAAATGTTAGTTGG - Intergenic
1150471237 17:65439123-65439145 GGCTGATCAAAACAGTGGGCAGG + Intergenic
1153977676 18:10283671-10283693 TGCTGCTCAAATAAGTCAGTTGG + Intergenic
1155682016 18:28499838-28499860 GCCTGTTCTAGAAAGTTAGTAGG - Intergenic
1156287116 18:35707699-35707721 GGCACAACAAAAAATTTAGTTGG - Intronic
1156532886 18:37835219-37835241 GGCTGATCAAAATAATTTCTTGG - Intergenic
1166933662 19:46317735-46317757 GGCTGAACACACAAGTTAATAGG - Intronic
1167248564 19:48389318-48389340 GGCTGCTGAGAAAAGTAAGTAGG + Intronic
927772906 2:25878841-25878863 GGCTGATCTAAAGTGATAGTTGG - Intergenic
933124272 2:78584736-78584758 GGCTTATCAAAAATATTATTGGG + Intergenic
934704379 2:96466466-96466488 GGCTTATCCAAAAGGTTTGTAGG - Intergenic
935105127 2:100035494-100035516 GGCTGATCAAAAAAGTTAGTAGG - Intronic
936832814 2:116669678-116669700 GGCAGATCAAAAAACTTAAAAGG - Intergenic
940158288 2:150682557-150682579 GGGGGCTCAAAAAAGTTAGCAGG + Intergenic
942358885 2:175150549-175150571 TGCTGATCAGAAACGTTAATTGG - Intronic
944285425 2:197944149-197944171 GGAGGATCAAACAAGTTAGCCGG + Intronic
944680432 2:202072362-202072384 GGAAGATCAAAAAGGTAAGTGGG + Intergenic
945419422 2:209616305-209616327 TGATGATCCAAAAAGTTAGAAGG + Intronic
946176460 2:217924883-217924905 GACTGATCAAAAACCTCAGTGGG - Intronic
947101830 2:226629609-226629631 GGGTGATCAAAAGAGTGGGTTGG - Intergenic
948540257 2:238686248-238686270 GGCTGGTCACACAAGTTAGGGGG - Intergenic
1171302058 20:24071725-24071747 AGCTGATCAAAAAACTTAAAAGG - Intergenic
1172670066 20:36628954-36628976 GGAAGATGAAAAATGTTAGTTGG - Intronic
1181778544 22:25177132-25177154 GGCTGATGACAAAAGTCAGGTGG - Intronic
1181932607 22:26414798-26414820 AGCTAATAAAAAAAATTAGTAGG - Intergenic
1182540431 22:31037613-31037635 TGCAGATTTAAAAAGTTAGTTGG + Intergenic
1182722250 22:32412635-32412657 TTCTGACCAAAAAAGTTATTTGG - Intergenic
951941201 3:28080616-28080638 GTTTGATCAAAAACGTTAGCTGG - Intergenic
954636957 3:52076191-52076213 GGCTGATCTATAATGTTTGTGGG + Intronic
955332698 3:58060649-58060671 GGCTGACCCAAAAAATTAGCTGG + Intronic
955774486 3:62418771-62418793 GGCTAATCAAAAGAGATAGAGGG - Intronic
955919437 3:63940039-63940061 GGCTGACCAAAAAAGTAAATAGG + Intronic
956365316 3:68495656-68495678 AAATGATCAAGAAAGTTAGTTGG - Intronic
956900392 3:73709425-73709447 GGCAGAGCAAAAAAGATAGTGGG - Intergenic
958745796 3:98132559-98132581 GACTGATCAAAAAATTGAGAGGG + Intergenic
958748690 3:98168561-98168583 GACTGATCAAAAAATTGAGAGGG + Intergenic
960916143 3:122696835-122696857 GTGTGGTCAAAAAAGTTAGATGG - Intronic
961070967 3:123926016-123926038 GTCTGATCAAATTAATTAGTGGG - Intronic
961106545 3:124247656-124247678 GGCTGATGAAAAAGGTCAGGGGG - Intronic
961699860 3:128734654-128734676 GTCTGACCAAAAAAGAGAGTTGG - Intronic
964557977 3:157961964-157961986 GGATGATCTAAACTGTTAGTTGG - Intergenic
974846289 4:67354415-67354437 ATCTGATCAAAAAAGTTGTTTGG + Intergenic
978730144 4:112016303-112016325 TGCAATTCAAAAAAGTTAGTAGG - Intergenic
981036956 4:140180949-140180971 TGCTGAGCGAAAAAGTAAGTTGG + Intergenic
981692432 4:147524229-147524251 GGCAGAACAAAAAAGTGAGGAGG - Intronic
983375691 4:166924704-166924726 GGCTGAAGAAAAAGGTTAGTAGG + Intronic
984525111 4:180849217-180849239 GGATGATAAAATAACTTAGTAGG + Intergenic
988434954 5:31163479-31163501 GGCCAATCAAAAAAAATAGTAGG + Intergenic
989564994 5:42893218-42893240 GACTGATCAAAAAATTGAGGAGG - Intergenic
992586736 5:78248571-78248593 GGCTAAACATAAAAGCTAGTGGG - Intronic
995905678 5:117119670-117119692 GAATGATCTAAAAAGCTAGTTGG - Intergenic
996198900 5:120645462-120645484 AGCTGATCAAAAATAGTAGTTGG - Intronic
998249142 5:140538208-140538230 GGCTGATGAAAAATGTTAGAGGG - Exonic
1001395044 5:171412702-171412724 GTCTTGACAAAAAAGTTAGTTGG - Intergenic
1001437012 5:171707104-171707126 AGCTGATCAAAAAAGATAATAGG + Intergenic
1002507675 5:179691404-179691426 AGCTGAGTAAAAAAGTGAGTGGG + Intronic
1003222327 6:4171979-4172001 GGATGATCTAAAAACTTTGTTGG + Intergenic
1004001933 6:11604080-11604102 GGCTCATCCACAAAGTTAGTAGG + Intergenic
1004441013 6:15654330-15654352 GTTTGATCAAAATACTTAGTTGG + Intronic
1005749678 6:28871178-28871200 GGCTGTCCAAAACAGTTTGTAGG + Intergenic
1005818341 6:29575806-29575828 GGATGATCAGAAAACTTACTAGG - Intronic
1005890251 6:30131545-30131567 GGATGATCAAATAAGTGAGAGGG + Intergenic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1016353144 6:143189616-143189638 GACACATCAAAAAAGATAGTAGG - Intronic
1016979312 6:149839588-149839610 GCATGATCAAAAAAGTTTGGAGG - Intronic
1017986561 6:159447855-159447877 GGTTGATCAGAAAGGTAAGTGGG - Intergenic
1021007355 7:15415256-15415278 GCCTGTTCAAAAAAATTAGCCGG - Intronic
1024127777 7:46318350-46318372 AGATGATCAACAAAGTTAGGAGG - Intergenic
1026855756 7:73753363-73753385 GGCTGATCAACCAAGTTTATAGG - Intergenic
1028810625 7:95082212-95082234 GGCTAACCAAAAAACTTAATAGG + Intronic
1029862561 7:103589154-103589176 GGTTGATCAAAAACCTCAGTGGG - Intronic
1035792052 8:2315864-2315886 GGCAGATCATAAAAGTTACTTGG + Intergenic
1035800753 8:2405841-2405863 GGCAGATCATAAAAGTTACTTGG - Intergenic
1037228080 8:16619943-16619965 TGCTGATGAAAAAAGTTTATTGG - Intergenic
1042719738 8:71814434-71814456 TGCTTATCAAAGAAGTTATTGGG - Intergenic
1044797730 8:95921293-95921315 GGATGAAAAAAAAAGTTACTGGG + Intergenic
1050190326 9:3018448-3018470 GGCTGCCCAATTAAGTTAGTAGG + Intergenic
1050437394 9:5625513-5625535 AGCTTATGATAAAAGTTAGTAGG - Intergenic
1050601375 9:7255412-7255434 GGCTGATATAAAAAGTTAATTGG - Intergenic
1056858985 9:90162182-90162204 GCCTGATCAAAAACATTAATGGG + Intergenic
1188505501 X:30878560-30878582 AGCAGACCAAAAAAGTTGGTAGG + Intronic
1189078379 X:37942434-37942456 GACTGATGAGAAGAGTTAGTGGG + Intronic
1189554778 X:42130693-42130715 GGCTGATCAAAAAGGTGAAGAGG - Intergenic
1195593483 X:106660167-106660189 AGCTGAGAAAAAGAGTTAGTAGG - Intronic
1195964910 X:110421121-110421143 GGCTGTGCAAAAAAGTCAGAGGG - Intronic
1198070938 X:133147989-133148011 GGCTGACCAAGAAAGTTAAAAGG - Intergenic