ID: 935112413

View in Genome Browser
Species Human (GRCh38)
Location 2:100105123-100105145
Sequence CCCGGCCCTGTCGCATCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935112409_935112413 4 Left 935112409 2:100105096-100105118 CCGAGTGCGGGGGGATGCGGAGC 0: 1
1: 0
2: 2
3: 5
4: 87
Right 935112413 2:100105123-100105145 CCCGGCCCTGTCGCATCCCTCGG 0: 1
1: 0
2: 0
3: 17
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935112413 Original CRISPR CCCGGCCCTGTCGCATCCCT CGG Intronic
902385454 1:16073297-16073319 CACGGCCCCGCCGCACCCCTGGG - Intronic
904640629 1:31925108-31925130 CCTGGCCCTGCCCCAACCCTAGG - Intronic
905628997 1:39508432-39508454 CCCTGCCCTTTCACAGCCCTGGG + Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
912416169 1:109509537-109509559 CCCGGCACCGTCGCCTCCCGGGG + Exonic
919761996 1:201103880-201103902 CAGGCCCCTGTCGCATTCCTGGG - Intronic
920528498 1:206685304-206685326 CCCTGCCCTGCCGCACCCCCCGG + Exonic
920552072 1:206870510-206870532 CCTTGCCATGTAGCATCCCTTGG - Intergenic
1067030538 10:42876637-42876659 CCTGGGGCTGGCGCATCCCTTGG + Intergenic
1068755332 10:60646586-60646608 TCAGGGCCTGTGGCATCCCTGGG + Intronic
1069902241 10:71712970-71712992 CCAGGCCCTCTCCCATCCCAGGG + Exonic
1075633682 10:124016293-124016315 CCCAGCCCTGCCACAGCCCTGGG - Intronic
1075805606 10:125186724-125186746 CCAGGCCCTGACAAATCCCTCGG - Intergenic
1077168146 11:1152929-1152951 CCCGGCACTGTCCCCGCCCTGGG + Intergenic
1077234358 11:1472733-1472755 CGTGGCCCTGTCTCAGCCCTTGG - Intronic
1079136094 11:17776728-17776750 CCCGCCCCTGCCCCATCCTTTGG - Intronic
1081645303 11:44786102-44786124 CGGGGCCCTGTGGCATCACTTGG - Intronic
1091784334 12:3233379-3233401 TCCGTCCCTGTCCCATCCCCTGG + Intronic
1092039002 12:5367010-5367032 TCCGGCCCTGACGCAGCCTTGGG - Intergenic
1092229055 12:6766773-6766795 CCCGGACCTCGCGCAGCCCTGGG + Intronic
1094536147 12:31324411-31324433 CCGGGCACTGCCGCCTCCCTCGG + Intronic
1095985363 12:47995676-47995698 CACGGCCCTGTCCCTTCTCTGGG - Intronic
1097264069 12:57736053-57736075 CCCGGGCCTGTGGCTTCTCTCGG - Intronic
1103935571 12:124474804-124474826 CCCCGCCCTGTGCCATCCTTGGG + Intronic
1105050128 12:133042057-133042079 CCAGGACCTGCCTCATCCCTTGG + Intronic
1113956331 13:114101526-114101548 CCCGGCCCTGACCCATGCCAGGG + Intronic
1119566306 14:75632023-75632045 CCCAACCTTGTAGCATCCCTGGG + Intronic
1122548724 14:102538864-102538886 CACGACCCAGTCCCATCCCTGGG - Intergenic
1122593202 14:102870472-102870494 CCCGGCCCCTTCTCAGCCCTCGG + Intronic
1129867149 15:78917929-78917951 CCAGGCTCTGTAGCATCCTTAGG + Intergenic
1130516768 15:84631662-84631684 CCCAGCCCTGTTGCATGCCCTGG - Intergenic
1131526746 15:93158773-93158795 CCCCGCCCTGCCCCAGCCCTGGG - Intergenic
1132666425 16:1083161-1083183 CCCGGCCCGCGCGCATCACTGGG + Intergenic
1135417592 16:22280397-22280419 CCCAGCCCTGTTGCAGCCCAGGG - Intronic
1137289489 16:47042167-47042189 CCCGGCCCTGTGGCCTCCACAGG + Intergenic
1137707976 16:50548484-50548506 CGCGGGCCTGGCGCCTCCCTTGG - Exonic
1138421111 16:56899777-56899799 CCGGGGCCTGTCCCCTCCCTGGG + Intronic
1139465210 16:67150640-67150662 CCCGGCCGTGTCGCACCGCCGGG + Exonic
1141087798 16:81109096-81109118 CCCCGCCCCGTGCCATCCCTTGG - Intergenic
1141303527 16:82839538-82839560 CCCAGCCCTGTCTCCTCCCTTGG + Intronic
1141673447 16:85505122-85505144 CCTGGCCCTGTCGTGTGCCTAGG + Intergenic
1142636346 17:1260124-1260146 CCCGCTCCTGGCGCTTCCCTCGG - Intergenic
1151517559 17:74606229-74606251 CCCGGCCCCTTCGCTGCCCTTGG - Intergenic
1152846367 17:82602240-82602262 CCCGGCACTGGCTCGTCCCTGGG - Exonic
1155300639 18:24426427-24426449 CCCCGCCCCGGCGCATTCCTAGG + Intergenic
1157544510 18:48538799-48538821 CACGGCGCTGGCGCAGCCCTGGG - Intergenic
1159927104 18:74279230-74279252 CCCGGCCTTGTCTCATCTTTTGG - Intronic
1160910297 19:1470913-1470935 CCCCTGCCTGTCGCACCCCTTGG + Exonic
1161346433 19:3770821-3770843 CCCGGCCATGTCGCTGCCCCTGG - Exonic
1162558560 19:11402510-11402532 CCAGGCCCTGTCCCCTACCTTGG - Exonic
1163124621 19:15238265-15238287 CCAGGCCCTGAGGCATCCCCTGG + Exonic
1163127661 19:15253031-15253053 CACGGGCCTGTCCCATCCCTGGG - Intronic
1163400376 19:17088523-17088545 CCCTGCTCTGTCCCACCCCTAGG + Intronic
1164210460 19:23093570-23093592 CCCAGCCCTGTCCCAGCCCGGGG - Intronic
1165273666 19:34731479-34731501 CCCAGCCCTGTCTCAGCCCCAGG + Intergenic
1165393792 19:35553004-35553026 CCCCGCCCCATCCCATCCCTGGG - Intronic
1167314761 19:48756825-48756847 TCCGGCTCTGTCCCAGCCCTGGG - Intronic
1167645640 19:50703627-50703649 CCAGGGCCAGTCGCAGCCCTCGG - Exonic
1168010071 19:53522795-53522817 CACCGCCCTGTCACATCCCTTGG - Intronic
1168354466 19:55692735-55692757 CCCGGCCTTCTCAGATCCCTGGG + Exonic
927818918 2:26245075-26245097 CCCGGCCCCCTCCCCTCCCTGGG + Intronic
928823569 2:35391931-35391953 CACGGGCCTGTGGCACCCCTCGG - Intergenic
933990891 2:87633173-87633195 CCTGGGCCTGCCCCATCCCTTGG - Intergenic
934515439 2:94983432-94983454 CCCGCCACCGTGGCATCCCTCGG - Intergenic
935112413 2:100105123-100105145 CCCGGCCCTGTCGCATCCCTCGG + Intronic
936302951 2:111317650-111317672 CCTGGGCCTGCCCCATCCCTTGG + Intergenic
937307770 2:120882615-120882637 CCCTCCTCTGTCGGATCCCTGGG + Intronic
938214949 2:129503650-129503672 CCCTGCCATGTGGCCTCCCTGGG + Intergenic
941464857 2:165813932-165813954 CCAGGTCCTCTAGCATCCCTGGG + Intergenic
942233014 2:173877267-173877289 CAGGGCCCTGTGGCTTCCCTTGG + Intergenic
947399246 2:229715001-229715023 CCCGGCCTTGCCTCATCCCCCGG + Intergenic
1168757453 20:326743-326765 CCCGGACCTGCAGCCTCCCTCGG + Exonic
1168760562 20:347289-347311 CCCGCCCCTGCTGCTTCCCTGGG - Intronic
1169065625 20:2692960-2692982 CCCGGCCCTGCCGTAGCCCCGGG - Exonic
1169264619 20:4160369-4160391 CTCGGGCCTGCCGCACCCCTGGG + Intronic
1170411343 20:16095720-16095742 GCTGGCTCTGTCCCATCCCTCGG + Intergenic
1172485001 20:35292540-35292562 CCTGGCACTGCCGCTTCCCTGGG - Intergenic
1174386208 20:50190032-50190054 CCCGCCCCTGCCCCATCCCAGGG + Intergenic
1175950553 20:62581110-62581132 CCCTGCCTGGACGCATCCCTAGG + Intergenic
1176228322 20:64016727-64016749 CCCAGCCCTGTCACATTCCTCGG - Exonic
1180042360 21:45287261-45287283 CCCGCCCCCATCCCATCCCTCGG + Intronic
1180144289 21:45910690-45910712 CCCGGCCCTGTGCCTTCCCTCGG - Intronic
1182099470 22:27647690-27647712 CCAGGCCCTGCCTCGTCCCTGGG + Intergenic
1183604433 22:38860349-38860371 CCCTGCCCTGTCTCCTCCCTCGG - Intergenic
1183622486 22:38982553-38982575 CCCGCCCCTGCCCCAGCCCTGGG + Intronic
1184516223 22:44964427-44964449 CCCGGCCATTTGGCAACCCTGGG + Intronic
1184550634 22:45202606-45202628 CCCGGCCCTGGCGCCTGCCTGGG - Intronic
1185295154 22:50049548-50049570 CCAAGCCCTGTCACAGCCCTGGG - Intronic
949946631 3:9194847-9194869 CCAGGCCATGTACCATCCCTTGG + Intronic
950154161 3:10709255-10709277 CGCGGCCCTGTCCTCTCCCTGGG + Intergenic
950770895 3:15310083-15310105 CCAGGCCCTGTCACATCACTAGG - Intronic
953352064 3:42223142-42223164 GCCGGCCCTGTCCCAGCTCTGGG - Exonic
961672441 3:128543151-128543173 CCTGGCCCTGTGTCAACCCTAGG - Intergenic
966883225 3:184361487-184361509 CACTGCCCTCTCGCCTCCCTCGG + Exonic
968730055 4:2265257-2265279 GCAGGCCCTGTCCCTTCCCTGGG - Intergenic
968926640 4:3551841-3551863 CCCTGCCCAGTCGCATCCCATGG + Intergenic
969516627 4:7651785-7651807 ACAGGCCCTGGCCCATCCCTTGG - Intronic
976385590 4:84454061-84454083 CATGGCCCTGTGGCATCCCTGGG - Intergenic
984200423 4:176713950-176713972 CCCTGCCCTGCCACAGCCCTTGG - Intronic
985723211 5:1501506-1501528 CTCGCACTTGTCGCATCCCTGGG - Exonic
986466334 5:8028639-8028661 CCCGGCTCTGACGCATCTCTAGG + Intergenic
986781174 5:11067042-11067064 CCAGGCCCTGTCCCTTCCCCAGG - Intronic
993029910 5:82694246-82694268 CCCAGCCCTGTCACCTTCCTGGG - Intergenic
997529689 5:134574181-134574203 CCAGGTCCTGTCACATCTCTGGG - Intronic
1000021678 5:157323708-157323730 CCGGGCCCCGTGGCATCCCTGGG - Intronic
1002535684 5:179874224-179874246 CCTGGCCCTGCCCCTTCCCTGGG - Intronic
1002784853 6:392911-392933 GCCGGCCCGGGCGCATCCCCTGG - Intronic
1003503051 6:6718172-6718194 CCAGGGCCTATTGCATCCCTGGG - Intergenic
1004183070 6:13397473-13397495 CCAGGCCCTCTGGCATCTCTGGG + Intronic
1006110194 6:31739900-31739922 CCTCGCCCTGTCGGATCTCTAGG + Intergenic
1017000020 6:149990161-149990183 TCTGCCCCTGTCGCGTCCCTGGG - Intergenic
1018728062 6:166628237-166628259 CTCGGCCCTGCTGCAGCCCTTGG - Intronic
1019047362 6:169159399-169159421 GCAGGCCCTGCCGCATCTCTGGG + Intergenic
1019315416 7:381874-381896 CCCGGCCATGTGGCAGCTCTAGG - Intergenic
1019390469 7:783904-783926 CCCGGCCCTCTCGCCTCCCCAGG + Intronic
1020830959 7:13095075-13095097 CCCCTCCCTATCACATCCCTCGG - Intergenic
1028161960 7:87496260-87496282 CCTGGCCCTGCCCCATTCCTTGG + Intergenic
1029114779 7:98231493-98231515 CCCAGCCCTGCCCCCTCCCTTGG + Intronic
1034691517 7:153017960-153017982 CCCAGTCCTGTCGCCTCCCCTGG - Intergenic
1034911919 7:155003769-155003791 CCCGGCCCCGTCGCTGCCCGAGG + Intergenic
1035752641 8:2007374-2007396 CCCTGCCCTGTATCACCCCTGGG - Intergenic
1036766950 8:11555378-11555400 CCCGGCCCCGCAGAATCCCTGGG + Exonic
1037955119 8:23050163-23050185 GCCAGCCCTGTTGCTTCCCTTGG - Intronic
1042591430 8:70402598-70402620 CCCGGCCCTCTCGGGCCCCTGGG - Intronic
1043927005 8:86048662-86048684 CCAGGCCCTGGACCATCCCTGGG - Exonic
1048965375 8:139610922-139610944 CCCTGTGCTGTCGCACCCCTGGG + Intronic
1049256533 8:141617017-141617039 GCCGGCCTTGTCGCACCCGTGGG - Intergenic
1049379618 8:142305468-142305490 CCCAGCCCTGCCGCCTTCCTGGG - Intronic
1049759230 8:144324438-144324460 CCGAGCCCTGCTGCATCCCTAGG + Intronic
1053279155 9:36806128-36806150 CCCGGCCCTGTGGCCTCCTGTGG - Intergenic
1053801560 9:41767223-41767245 CCCTGCCCAGTCGCATCCCATGG + Intergenic
1054143640 9:61547603-61547625 CCCTGCCCAGTCGCATCTCATGG - Intergenic
1054189991 9:61979377-61979399 CCCTGCCCAGTCGCATCCCATGG + Intergenic
1054463415 9:65478938-65478960 CCCTGCCCAGTCACATCCCATGG - Intergenic
1054648523 9:67609214-67609236 CCCTGCCCAGTCGCATCCCATGG - Intergenic
1060185805 9:121563377-121563399 CCCGGCCCTGTAGAAGGCCTGGG - Intergenic
1061290202 9:129646443-129646465 CCCCGCCCTCTCACAGCCCTGGG + Intergenic
1061502701 9:131012990-131013012 CCCAGCCCCGTGGCCTCCCTGGG - Intronic
1062344467 9:136108548-136108570 CCCAGGCCTGTCCCATCCCGAGG + Intergenic
1062578058 9:137217736-137217758 GCCGCCCCTGTCGCCGCCCTGGG + Intergenic
1189331369 X:40146697-40146719 CCCGCCCCCGTGGCCTCCCTAGG + Intronic
1190385641 X:49879967-49879989 CCCGGCCCCGGCGCGGCCCTGGG + Exonic
1198398880 X:136251109-136251131 CCCGCCCCTGTCCCATCCCAGGG + Intronic
1200279346 X:154763198-154763220 CTCGGCCCTCTCACCTCCCTGGG + Intronic