ID: 935112494

View in Genome Browser
Species Human (GRCh38)
Location 2:100105402-100105424
Sequence CCCGGACCTGCTCTCCGTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935112484_935112494 26 Left 935112484 2:100105353-100105375 CCCGCAAGTTCAGCGAAATAAAG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG 0: 1
1: 0
2: 0
3: 4
4: 55
935112485_935112494 25 Left 935112485 2:100105354-100105376 CCGCAAGTTCAGCGAAATAAAGC 0: 1
1: 0
2: 0
3: 10
4: 103
Right 935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935112494 Original CRISPR CCCGGACCTGCTCTCCGTTG CGG Intronic
900593210 1:3468897-3468919 CCTGGACCAGCTCTCCACTGAGG + Exonic
904308759 1:29611525-29611547 CCTGTACCTTCTCCCCGTTGTGG + Intergenic
904603062 1:31684135-31684157 CGGGGCCCTGCTCTCCTTTGGGG + Exonic
908780694 1:67686560-67686582 CCCGGACCTGCACTGCGTGCTGG + Exonic
920176905 1:204107711-204107733 CCCAGAGTTGCTCTCCATTGGGG + Intronic
1071561598 10:86650177-86650199 CCCTGCTCTGCTCTCTGTTGCGG + Intergenic
1075676594 10:124300135-124300157 CACGGACTTGCTCCCCTTTGGGG - Intergenic
1076703791 10:132290165-132290187 CCCAGCCCTGCTCTCCTTTCTGG - Intronic
1085513813 11:77100925-77100947 CCCGGAACTGCTCTCCCTGGAGG + Intronic
1102077686 12:110073162-110073184 CCCTGCCCTGCTCTCCCTGGCGG + Intronic
1103074952 12:117974561-117974583 CCTTCACCTGCTCTCCGTTGAGG - Intergenic
1104945705 12:132414095-132414117 CCTGGCCCTGCTCTCCGGAGTGG + Intergenic
1113898260 13:113779531-113779553 CCCGGAAGTGCTCTCTGTTTTGG + Intronic
1114418078 14:22557317-22557339 CCAGGCCCTCCTCTCCTTTGGGG - Intronic
1121502382 14:94448504-94448526 CCTGGCCCTGCTCTCTCTTGGGG - Exonic
1121504898 14:94469585-94469607 CCTGGCCATGCTCTCCCTTGGGG - Exonic
1122865414 14:104601808-104601830 CCCGGACCTGACCTCCAGTGGGG + Intronic
1136395833 16:29991943-29991965 CCCAGACCTGCTCTGCCCTGTGG - Intronic
1142358323 16:89614378-89614400 CCCGGACTTACTCTCTGTTCTGG + Intronic
1142637659 17:1268194-1268216 CCGGGACCCGCTCTCCGGAGGGG + Intergenic
1143519691 17:7438247-7438269 CCCGGGCCGGCTCTCCGAGGAGG + Intergenic
1147924112 17:43936126-43936148 CCCCCACCTTCTCTCCGTTCCGG + Intergenic
1150069592 17:62139762-62139784 CCCGGACCTGCTGTCCTATGCGG - Intergenic
1152901476 17:82943518-82943540 CCCTGGCCTGCTCTCAGGTGGGG + Intronic
1154005261 18:10521954-10521976 CCCATACCTGCTCTCCCTTCAGG - Intergenic
1160727785 19:625176-625198 TCCGGACCTGCTGTCCTATGCGG - Exonic
1162247523 19:9414690-9414712 CACTGACCTCCCCTCCGTTGTGG + Exonic
1163725625 19:18921675-18921697 CCCGGAACTGCTCTGCGATCTGG - Exonic
1167373855 19:49100992-49101014 CCCGGGCCTGCCCACCTTTGTGG + Intronic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
1169188885 20:3644479-3644501 CCGGGACCTCCTCACCGTTCTGG + Intronic
1173582091 20:44154637-44154659 CCCGGGCTTTCTCTCCATTGTGG - Intronic
1176178918 20:63740602-63740624 CCCTGACCTGGCCTCCGTCGGGG - Intronic
1178699361 21:34820157-34820179 CCCAGCCCTGCTCCCTGTTGGGG - Intronic
1178850008 21:36205223-36205245 CACTCACCTGCTCTCAGTTGTGG + Intronic
1181672824 22:24433729-24433751 CCCGGCCCTGCTCACCGGAGCGG - Exonic
1181719260 22:24761312-24761334 CCCCCACTTGCTCTCCTTTGTGG - Intronic
1185384918 22:50527182-50527204 CCCGGGCCTGCTCCTGGTTGGGG + Exonic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
959542813 3:107559326-107559348 CTGGGACCTGCTCTCAGCTGAGG + Intronic
962286653 3:134092104-134092126 CTCGGACCTGTTCTCTGTTCTGG + Intronic
964413279 3:156421741-156421763 CCAGGACCTGGTCTCAGATGAGG + Intronic
971265540 4:25093548-25093570 CCCTTCCCTGCTCTCCATTGAGG - Intergenic
978406044 4:108379873-108379895 CCCAGACTTGCTCTCCTTTGTGG + Intergenic
985896526 5:2752327-2752349 CCCGGACCTGCTCTGCCTCCTGG + Exonic
988480492 5:31626417-31626439 CCCAGACCTGCTCTAAATTGGGG + Intergenic
989565783 5:42899429-42899451 CCCAGACTTGCTCTCGGTTCAGG + Intergenic
1005606136 6:27479317-27479339 CCAATACCTGCGCTCCGTTGAGG - Intergenic
1013111847 6:107070521-107070543 GGTGGACCTGCTCTCCCTTGAGG - Exonic
1029288050 7:99479657-99479679 CCAGGAGCTGCTCTCGTTTGAGG + Exonic
1029347334 7:99987966-99987988 CCCGGACCCGCTGTCCCTTAGGG + Intergenic
1031947658 7:127858258-127858280 CCCGGACCGGCTCTCCGAATTGG - Intronic
1034509177 7:151520173-151520195 CCCCGCCCTGCGCTCCGTTCTGG - Intergenic
1038035584 8:23683248-23683270 CCAGGAGCTTCTCTCTGTTGCGG - Intergenic
1038611966 8:29066674-29066696 CCTGGCCCTGCTCTCTGATGAGG - Intergenic
1040067028 8:43154348-43154370 CCAGGACCTGCTGTGCGGTGGGG - Intronic
1045474749 8:102543297-102543319 CTGGGACCTGCTCTCCAATGAGG - Intergenic
1049812313 8:144580983-144581005 CCCGGGGCTGCTCTCCGCCGAGG + Exonic
1060828790 9:126701132-126701154 TCCGGACCTGCTGTCCCTGGTGG - Intergenic
1190456809 X:50635181-50635203 CCCTGCGCTGCTCTCCATTGAGG + Exonic