ID: 935113202

View in Genome Browser
Species Human (GRCh38)
Location 2:100110664-100110686
Sequence GGGACTTGGGGACCCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935113202_935113208 16 Left 935113202 2:100110664-100110686 CCTGCTGGGGGTCCCCAAGTCCC 0: 1
1: 0
2: 1
3: 24
4: 229
Right 935113208 2:100110703-100110725 AGAGCAGAGTTCACCTCTTCAGG 0: 1
1: 0
2: 1
3: 16
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935113202 Original CRISPR GGGACTTGGGGACCCCCAGC AGG (reversed) Intronic
900176688 1:1294269-1294291 CGGCCTTGGGCGCCCCCAGCCGG + Intronic
900514214 1:3073666-3073688 GGGCCTGGGGGACCCCGGGCCGG + Intronic
902333664 1:15742945-15742967 GGGGCACGGGGACCCCCACCAGG + Intronic
902822123 1:18949839-18949861 GGGACCCGGGGACCCGCATCCGG + Intronic
903832170 1:26182095-26182117 GGGGCCTGGGGTCCCCTAGCTGG + Intronic
904009154 1:27380180-27380202 GGGACTGGGGGGCTCCCTGCAGG + Exonic
904055941 1:27670034-27670056 TGAATTTGGGGACCCTCAGCTGG - Intronic
904416122 1:30362058-30362080 AGGGCTAGGAGACCCCCAGCAGG - Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
906951064 1:50334802-50334824 GGGACTTGAGGACTTCCAGGTGG - Intergenic
910759920 1:90723851-90723873 GTGACCTGTGGGCCCCCAGCAGG + Intergenic
912480719 1:109980524-109980546 GGCCCTTAGGGACCCCCAGAGGG - Intergenic
913538574 1:119797482-119797504 GGGACTTGGTCATCCCCAGCAGG - Intronic
916557413 1:165905233-165905255 GGGACTTTGGGAGGCCCAGGTGG + Intronic
920043367 1:203117989-203118011 GGGGCTCGGGGTCCCCCTGCTGG - Intronic
920048451 1:203148841-203148863 GGGCCTTGGGGAACGCCACCAGG - Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
922472816 1:225887430-225887452 CGGGCTTGGGGAGCCCCAGCTGG - Exonic
922480828 1:225939392-225939414 CGGGCTTGGGGAGCCCCAGCTGG - Exonic
922853800 1:228756701-228756723 AGGTCCTGGGGGCCCCCAGCAGG - Intergenic
923622829 1:235591891-235591913 GGGTCTGTGGGACCCCCAGCAGG + Intronic
924234306 1:241987807-241987829 GGCACTTTGGGAGGCCCAGCAGG + Intergenic
1063116698 10:3076727-3076749 GGCACTTGGGGCACCCGAGCTGG + Intronic
1066010317 10:31188504-31188526 GGGGCTTGGAAATCCCCAGCAGG + Intergenic
1066681236 10:37938396-37938418 GGGACCTGGGGTCCCCTGGCTGG - Intergenic
1067350961 10:45475049-45475071 GGGACTGTTGGGCCCCCAGCAGG - Intronic
1069413274 10:68174518-68174540 AGGAATTGGGGACACACAGCGGG - Exonic
1070778993 10:79126753-79126775 GGCACCTGGGGAGCCACAGCAGG + Intronic
1071246374 10:83769451-83769473 GGAATTTTGGGTCCCCCAGCTGG - Intergenic
1072741657 10:97913663-97913685 GGGCTTTGGGTACCCCTAGCAGG + Intronic
1072791264 10:98319797-98319819 GGGACTTGAGGACCCTTTGCAGG - Intergenic
1072992242 10:100208351-100208373 GGGACTTTGGGAACCCAAGGTGG - Intronic
1073459560 10:103658909-103658931 GGGACATGAAGCCCCCCAGCAGG + Intronic
1075708624 10:124518362-124518384 GGGACTGGGGGACCCCTGGCTGG - Intronic
1076197382 10:128529035-128529057 GGGACTTGGTGTCCCCAGGCAGG - Intergenic
1076599494 10:131647753-131647775 GGCCTTTGCGGACCCCCAGCAGG + Intergenic
1076918742 10:133440611-133440633 GTGTCATGGGGACCCACAGCTGG - Intergenic
1076998930 11:312559-312581 GCGATTTGGGGAGGCCCAGCAGG + Intronic
1077001324 11:324238-324260 GGGACCTTGGGATCCCCAGGAGG + Intronic
1078267617 11:9766683-9766705 GTGACTTGGGGAACCCCTCCCGG + Intergenic
1079351737 11:19697629-19697651 GGGTCTTGGGGACCCCGACTGGG + Intronic
1080642149 11:34164342-34164364 GGCACTGGAGGACCACCAGCAGG + Intronic
1081666024 11:44917561-44917583 GTGCCTTGGGGATCCCCAGCTGG - Intronic
1083933987 11:65860839-65860861 GGGACGAGGCGACCCGCAGCAGG + Exonic
1084267293 11:68011657-68011679 GGGCCTGGGGGACCCCCATCAGG - Intronic
1084564025 11:69919455-69919477 GGGACTTGGTCACCCCAAGGTGG - Intergenic
1084874958 11:72124336-72124358 GGGTCATGGGCACCCCCACCTGG - Intronic
1085485771 11:76861330-76861352 GGGAAGTGGGGAGCCCCTGCTGG + Intronic
1091566464 12:1652358-1652380 GGCTCTTGGGGGCACCCAGCAGG + Intergenic
1092029913 12:5275444-5275466 AGGACTTTGGGATCCACAGCCGG - Intergenic
1092184136 12:6466283-6466305 GGGCCAGGGGGACCCCCACCTGG + Exonic
1092260788 12:6952301-6952323 GGGACATTGAGAGCCCCAGCTGG - Intronic
1096498277 12:52051079-52051101 TGGACCTGGGGGCCCCCAGCTGG + Intronic
1096546700 12:52345106-52345128 GGGACATGAGGACCCACTGCTGG - Intergenic
1101381914 12:104221018-104221040 GGCACTTTGGGAGGCCCAGCTGG + Intronic
1101745906 12:107541343-107541365 GGGAATGGGGGAGCCCCAACAGG + Intronic
1101966741 12:109287253-109287275 GGGAGTGGGGAACCCCCAGGTGG - Intronic
1102492658 12:113298244-113298266 GGGAGTTGGGGTCCCCCCACAGG + Exonic
1102926967 12:116833716-116833738 GGGGCGGGGGGCCCCCCAGCTGG + Intronic
1103510105 12:121467786-121467808 GGGACCTGGGGACCCGCTCCTGG - Intronic
1103828995 12:123763446-123763468 AGGACTTGGGGATCCCTTGCAGG + Intronic
1103982721 12:124746927-124746949 GGGAGTTGGGGAACTGCAGCAGG + Intergenic
1105035710 12:132919316-132919338 AGGACTTTGGGAGGCCCAGCTGG - Intronic
1110601480 13:77379810-77379832 AGGAATTGGGGACCCTCAGCTGG - Intergenic
1113566606 13:111323155-111323177 TGGACATGGGGAAGCCCAGCAGG - Intronic
1114265439 14:21070447-21070469 AGGACTTGGGGGCCCGGAGCGGG - Intronic
1117005997 14:51421716-51421738 GGGCCATGGTGAACCCCAGCTGG + Intergenic
1119203538 14:72776999-72777021 GGGACTTGGGGCCACACAGGGGG - Intronic
1119534532 14:75392175-75392197 AGCACTTGGGGACACCCAGCTGG + Intergenic
1119761655 14:77155847-77155869 AGGACTTGGGGACCAGAAGCTGG + Intronic
1119826184 14:77659016-77659038 GGCACCTGGGGAAGCCCAGCTGG + Intergenic
1121496286 14:94393589-94393611 GGGACTATGGGAGACCCAGCAGG + Intergenic
1121531022 14:94653606-94653628 GGGACTTTGATACTCCCAGCAGG - Intergenic
1121631159 14:95422838-95422860 GAGTCTTGGGGACACCCAGGAGG - Intronic
1122008059 14:98722139-98722161 GGGACTTGTGGAGCCCAGGCAGG - Intergenic
1122627470 14:103091677-103091699 GTGACCTGGGGACGCCCCGCGGG + Intergenic
1122632439 14:103113107-103113129 GGCACTGGGGGAAGCCCAGCTGG - Intergenic
1125581672 15:40790126-40790148 GGGACTTGGGTAAACCCAGCAGG - Intronic
1126109468 15:45167130-45167152 GGGCCTCGGGTGCCCCCAGCCGG + Intergenic
1127605141 15:60579286-60579308 GGGCCTTGGGGCCCCGCAGGGGG + Intronic
1128185672 15:65641799-65641821 GGGACTGGAGGGCCCCCAGCTGG + Intronic
1128586228 15:68852808-68852830 GGGGCGTGGGGATCCCAAGCAGG + Intronic
1129150612 15:73685223-73685245 GGGAGGTGGGGACCCCGAGTGGG + Intronic
1129232480 15:74204430-74204452 GGGACTCTGGGAAGCCCAGCTGG - Intronic
1129263904 15:74383767-74383789 GGGGCTTGGGGAGTCACAGCAGG + Intergenic
1132667957 16:1090555-1090577 GGGACTCTGGGAGCCCCGGCTGG - Exonic
1132698905 16:1213961-1213983 GGGGCTGGGGCACCCCCAGTGGG + Intronic
1132743546 16:1427617-1427639 GGGATATGGGGACCCCCTGGGGG - Intergenic
1133019413 16:2960653-2960675 GGGACTTGCAGCCCCTCAGCAGG + Intergenic
1133051730 16:3120758-3120780 TGGACCTGGGGACCCCTTGCCGG + Intergenic
1133370126 16:5240383-5240405 GCGTCCTGGGGGCCCCCAGCAGG + Intergenic
1137540073 16:49356006-49356028 GGGTCTTGGGAAGCCCGAGCTGG - Intergenic
1137584009 16:49653153-49653175 GGGACTTGGGGTCCCCACTCTGG + Intronic
1137782953 16:51113551-51113573 GTGACTTGTGGAGCCCCAGAGGG + Intergenic
1138528169 16:57620680-57620702 GGGAGCAGGGGACCCTCAGCTGG - Intronic
1141530527 16:84643438-84643460 CGGACTTGGAAACACCCAGCAGG + Intergenic
1141806059 16:86342298-86342320 AGGATTTGGGGATCCCCAGGGGG + Intergenic
1142145846 16:88492657-88492679 GGGACTTGTGGACATCCAGAAGG + Intronic
1142256159 16:89014810-89014832 GGGCCCTGGGGAGCCCCAGCAGG - Intergenic
1142322319 16:89391425-89391447 GGGATTGTGGGACACCCAGCTGG + Intronic
1142400599 16:89856276-89856298 GGGAATGGGGGAACCCCAGCCGG - Intronic
1142508955 17:382599-382621 GGTACTTTGGGTGCCCCAGCAGG - Intronic
1142668920 17:1478472-1478494 AGGACGTGGAGAGCCCCAGCTGG - Exonic
1142901763 17:3016613-3016635 GGAACTGGGAGACCCGCAGCAGG - Intronic
1145242041 17:21245781-21245803 GGGGCTGGGGAACCCTCAGCTGG - Intronic
1145818000 17:27809205-27809227 GGGATTTGGGGAACCCCAAGGGG - Intronic
1147739893 17:42665556-42665578 GGGAGTGGGGGCCCACCAGCTGG - Exonic
1149567290 17:57649103-57649125 TGGACTAGGGGCACCCCAGCTGG - Intronic
1152034439 17:77863548-77863570 GGGACATGGGCAGCCCCAGAAGG - Intergenic
1152333996 17:79690073-79690095 GCGTCTTGGGGAGACCCAGCAGG - Intergenic
1155014255 18:21817014-21817036 AGGACTTGGGGACCTGCAGAAGG + Intronic
1157286224 18:46379122-46379144 GGGGCCTGGGGGCTCCCAGCAGG - Intronic
1159056563 18:63471359-63471381 AGCACTTTGGGAGCCCCAGCCGG + Intergenic
1160727730 19:625024-625046 GGGGGCTGGGGACCCCCAGAGGG - Intronic
1160734400 19:655625-655647 GGGACTTCTGGGCTCCCAGCAGG - Intronic
1160823523 19:1068812-1068834 GGGACTTGGGGAGGCTCAGAAGG + Intronic
1160976104 19:1793464-1793486 GGGACTGGGGGAGCCCCAGCTGG - Intronic
1161310225 19:3589890-3589912 GGGCATTCGGGACCCCGAGCTGG + Exonic
1161706348 19:5823932-5823954 GGCACTCCGGGACCCCCAGATGG + Exonic
1161851697 19:6740691-6740713 GGGATTAGGGGAGCCCGAGCTGG + Intronic
1161984500 19:7646247-7646269 AGGGCTCGGGGACCTCCAGCCGG + Exonic
1162029454 19:7911160-7911182 GTGAGTGGGGGCCCCCCAGCGGG + Intronic
1162744878 19:12792605-12792627 GGCACTTGGTGGCCGCCAGCCGG - Exonic
1163444396 19:17338252-17338274 GGAACCTGGGGACCCTCACCTGG - Exonic
1164717570 19:30404768-30404790 TTGAATTGGGGACACCCAGCTGG - Intronic
1165154368 19:33778210-33778232 GCGGCTTGGGGATCCCCGGCGGG + Intergenic
1166302693 19:41921375-41921397 GGGACATGGGGAACCCCACCAGG + Intronic
1166645676 19:44529998-44530020 AGGACTGGGGGACCTCCAGGAGG + Intergenic
1166892319 19:46000970-46000992 GGGAGTTGGGGACCACGAGTGGG + Intronic
1168298051 19:55387425-55387447 GGCACTTGGGGACCCCGTTCTGG + Intronic
1202649239 1_KI270706v1_random:165817-165839 GGACCTTGGGGAGTCCCAGCTGG - Intergenic
926001206 2:9334294-9334316 GGGACTTGGGGAGGCCAAGGTGG - Intronic
926757824 2:16250237-16250259 GGGTCCTGAGGACCCCCAGGAGG + Intergenic
933702644 2:85266637-85266659 GGGACTTGGGAACCACCAGGGGG + Intronic
935113202 2:100110664-100110686 GGGACTTGGGGACCCCCAGCAGG - Intronic
936955836 2:118021263-118021285 GGACCTTGGGGACCACCAGGAGG + Intergenic
938127445 2:128684753-128684775 AGGCCTGGGGGACCCCCACCAGG + Intergenic
938421779 2:131152503-131152525 GGGACCTGTGGGACCCCAGCAGG + Intronic
943642180 2:190371690-190371712 GGGACTTGGGGAGGCCAAGACGG + Intergenic
945029337 2:205649090-205649112 GGAACATGGGGGTCCCCAGCAGG + Intergenic
946043252 2:216800529-216800551 GAGACTTGGGTACTCCCAGCTGG + Intergenic
946527148 2:220532918-220532940 GGAATTTGGGGACGACCAGCAGG + Intergenic
947761469 2:232606542-232606564 GGGGCTGGGGGACCCTGAGCAGG + Intronic
947909098 2:233790018-233790040 GGGGCTTGAGGGCCCTCAGCCGG + Intronic
947984925 2:234439826-234439848 GGGTGCTGGGGACCCCCAGTAGG + Intergenic
948751478 2:240135946-240135968 GGGCCGTGGGGGCACCCAGCAGG + Intronic
948830971 2:240598098-240598120 GGGACTTGGGGGCGGCCAGCTGG + Intronic
948941408 2:241198650-241198672 GGCACTTAGGGAACCCCAGATGG + Intronic
1172781312 20:37438438-37438460 GGCCACTGGGGACCCCCAGCAGG - Intergenic
1172930153 20:38580779-38580801 TGGACGTGGGCACCCACAGCTGG + Intergenic
1173594785 20:44251666-44251688 GGGACCTGGGGAGCCACTGCAGG - Intronic
1173752356 20:45487402-45487424 TGGACGTGGGGGCCACCAGCGGG - Intergenic
1175299469 20:57932751-57932773 GGAATTAGGGGACACCCAGCTGG - Intergenic
1176098032 20:63353154-63353176 GGGATTTGGCCACCCCCAGTTGG - Intronic
1177968511 21:27759381-27759403 GGGCCTTGGGGAACCCCACCTGG + Intergenic
1179158175 21:38869318-38869340 GTGACTTGGGGCCCCTCAGTTGG + Intergenic
1181456047 22:23060808-23060830 GGGGCTTCAGGACCCTCAGCTGG + Intronic
1181477900 22:23180140-23180162 GGGGCTTGGGGACACGCGGCTGG + Intronic
1181478390 22:23182009-23182031 GGGGCTTGGGGACACGCGGCTGG - Exonic
1181592361 22:23893343-23893365 GGGCCATGGGGCCTCCCAGCTGG + Intronic
1181703739 22:24635132-24635154 GTCACTTGGGGAGACCCAGCAGG - Intergenic
1182477668 22:30584937-30584959 GTGTCTTGAGGACCCCCATCGGG - Intronic
1183418498 22:37696787-37696809 GCTCCCTGGGGACCCCCAGCGGG + Intronic
1183508018 22:38220176-38220198 GGGCCTCCGGAACCCCCAGCAGG - Exonic
1183544622 22:38448905-38448927 AGGCCTGGGGGGCCCCCAGCAGG - Intronic
1183951612 22:41355879-41355901 GGGGCTGGGGGTCCCCCAGGAGG + Intronic
1184334234 22:43844027-43844049 TGGACTGGGGGACATCCAGCTGG + Intronic
1184361234 22:44020074-44020096 TGGACTGGGGGACACCCAGCTGG - Intronic
1184648630 22:45909439-45909461 GGGACTAGGGGACCCCGATGAGG - Intergenic
1184747753 22:46465865-46465887 GGGAGCTGGGCATCCCCAGCCGG - Intronic
1184981801 22:48100578-48100600 GGAACATGGGGACCTCCAGGGGG - Intergenic
1185337226 22:50276088-50276110 GGCACTTGGGGCCCCCCATGTGG + Intronic
949929596 3:9068298-9068320 GGGAATTGAGAACACCCAGCTGG - Intronic
949987906 3:9553963-9553985 GATACCTGGGGTCCCCCAGCCGG + Intergenic
950478358 3:13228152-13228174 GGCACCTGGGCACTCCCAGCAGG - Intergenic
954106407 3:48412023-48412045 GGCAGTTAGGGCCCCCCAGCAGG + Intronic
957072804 3:75579678-75579700 GCGTCCTGGGGGCCCCCAGCAGG - Intergenic
960648740 3:119921888-119921910 AGTACTTGGGGAGTCCCAGCTGG + Intronic
960864263 3:122184233-122184255 GGCAGTTGGGGACCCCGAGGGGG + Intronic
961168576 3:124780150-124780172 GGACCATGGGGACCCTCAGCAGG + Intronic
961681382 3:128602594-128602616 CCCACTTTGGGACCCCCAGCTGG - Intergenic
961786345 3:129349501-129349523 GGCACCTGGGCACTCCCAGCAGG + Intergenic
961873107 3:130002506-130002528 GCGTCCTGGGGGCCCCCAGCAGG - Intergenic
964816096 3:160719504-160719526 GGGAATTGTGGATCCCCAGGAGG - Intergenic
967980321 3:195061522-195061544 GAGACGGGGGGAGCCCCAGCTGG + Intergenic
968193772 3:196690399-196690421 GGGAGCTGGGAAACCCCAGCTGG + Intronic
968498374 4:931724-931746 GGGGCTTGGGGAACCCCCTCAGG - Intronic
968741302 4:2333031-2333053 GGGAGTGAGGGACCCCCAGGAGG - Intronic
968904507 4:3445180-3445202 GGGGCATCGGAACCCCCAGCAGG - Intronic
969016416 4:4106988-4107010 GCGTCCTGGGGGCCCCCAGCAGG - Intergenic
969042098 4:4307135-4307157 AGGACTTGGTGAATCCCAGCAGG - Intronic
969474336 4:7412721-7412743 GGTGCTTGGGGAGACCCAGCAGG - Intronic
969720981 4:8892971-8892993 GGGACGTGGGCACCAACAGCAGG + Intergenic
969737539 4:9001336-9001358 GCGTCCTGGGGGCCCCCAGCAGG + Intergenic
986307380 5:6525674-6525696 GGGACTTGGGGATCCCTGGGGGG - Intergenic
986721068 5:10562428-10562450 GGGCCTTGGTGACCCGCAGCCGG + Intergenic
991700625 5:69313261-69313283 GGGGCTGGGGGAATCCCAGCAGG - Intronic
997619117 5:135273286-135273308 GGCCCTTGGGGTCCCTCAGCTGG - Intronic
998391938 5:141792793-141792815 AGGACTGGGGGAGCCCCAGAAGG - Intergenic
999364787 5:151015332-151015354 GTGATCTGGGGACCCCCAACAGG + Intergenic
1001734873 5:173989482-173989504 GGGTCGTGGGGACCCTGAGCTGG - Exonic
1002771121 6:291933-291955 GGGATCTGGAGACCCCCGGCCGG + Intronic
1003099309 6:3164974-3164996 GGAAGTTGAGGACACCCAGCTGG - Intergenic
1003925265 6:10871571-10871593 GGGACTTGAGGAATCCCGGCAGG - Intronic
1004185620 6:13419006-13419028 TGGAGTTTGGGAGCCCCAGCAGG + Intronic
1004931058 6:20463753-20463775 TGAACTGGGGGACACCCAGCTGG - Intronic
1006173803 6:32109911-32109933 GGGACTTGGGGTCCCAGAGACGG - Intronic
1007976040 6:46102286-46102308 TGGAGTTGGGAAACCCCAGCAGG + Intergenic
1010474998 6:76276152-76276174 GGTACTTGGTGACCACCAACTGG - Intergenic
1013677710 6:112484538-112484560 GGGACTTTGGGACGCCAAGGTGG - Intergenic
1017073809 6:150600071-150600093 GGGACCCGGGGACCTCCGGCGGG + Intronic
1017724198 6:157265521-157265543 GTGACCTGGGGACCCCGACCAGG + Intergenic
1018023862 6:159789277-159789299 GGGCCTCGGGGCCCCGCAGCCGG - Intronic
1018701856 6:166433440-166433462 GGGACTTAGGCACCTCCAGAGGG - Intronic
1019350245 7:551151-551173 TGGACGTGGGGTCCCCCAGAGGG - Intronic
1019466520 7:1192587-1192609 GGGACATGGGGAGCACCAGCAGG + Intergenic
1019699960 7:2470039-2470061 GGGACCTGTGGACCCAGAGCAGG - Intergenic
1021705467 7:23363492-23363514 AGCACTTGGGGAGGCCCAGCTGG - Intronic
1023888620 7:44377385-44377407 GGGCCTAGCTGACCCCCAGCTGG + Intergenic
1023927107 7:44677499-44677521 GGGAATTGGGGACACAGAGCAGG + Intronic
1023951217 7:44847813-44847835 GGGACATGGCGCCCCCCGGCGGG + Intronic
1023989081 7:45117451-45117473 GGGTCTTTTGCACCCCCAGCAGG + Intergenic
1026899630 7:74029647-74029669 GGGACATGGGTACCCACAGGCGG + Intronic
1027592606 7:80134919-80134941 GGGACTTGGGGGCGCTGAGCCGG + Exonic
1028553657 7:92099688-92099710 AGTACTTGGGGACACCAAGCTGG - Exonic
1029279154 7:99425514-99425536 TGGCCTAGGGGACCCCCAGGTGG - Exonic
1034411662 7:150945403-150945425 GGGAGGTGAGGGCCCCCAGCTGG + Exonic
1035260262 7:157656586-157656608 TGGCATTGGGGACACCCAGCAGG + Intronic
1035783478 8:2246481-2246503 GGTACGTGGGGACACCCTGCAGG - Intergenic
1035808645 8:2473105-2473127 GGTACGTGGGGACACCCTGCAGG + Intergenic
1036242640 8:7092598-7092620 GTGTCCTGGGGGCCCCCAGCAGG + Intergenic
1038453274 8:27653465-27653487 GGGACTTGGGATACCCAAGCTGG - Intronic
1038612828 8:29070620-29070642 GGGCCTCGGGGGCACCCAGCCGG + Exonic
1043363634 8:79504706-79504728 GGGACTAGGGGACCCCTGACAGG - Intergenic
1044857860 8:96494413-96494435 GGGACTGGGGGTTCCCCAGGTGG - Intronic
1047506230 8:125482859-125482881 GGGAGATGGGGACCCACATCAGG + Intergenic
1049573106 8:143378694-143378716 AGGCCATGCGGACCCCCAGCCGG + Exonic
1049662261 8:143824733-143824755 GGGCATGGGGGACACCCAGCCGG - Intronic
1056808736 9:89747887-89747909 GGGATGCGGGGGCCCCCAGCTGG + Intergenic
1057035320 9:91807670-91807692 TGGACTGGAGGACACCCAGCTGG + Intronic
1057211852 9:93204820-93204842 GGGGTATGGGGACCCCAAGCTGG + Intronic
1057551491 9:96054011-96054033 GGGGCCGGGGGAGCCCCAGCAGG - Intergenic
1060659769 9:125397970-125397992 GAGAATTGGGGAACCCCATCTGG + Intergenic
1060666503 9:125435220-125435242 AGGTCGTGGGGACCCACAGCTGG + Intergenic
1061483433 9:130908558-130908580 GGGGTTGGGGGAGCCCCAGCAGG - Intronic
1062273728 9:135721126-135721148 TGGACTGGGGGACCCCCAGAAGG + Intronic
1062526519 9:136980101-136980123 GGGTCTTGGGGAGCCCCCTCTGG - Intronic
1062543904 9:137053418-137053440 GGGGCTTGTGGATCCCCATCTGG + Intronic
1062612586 9:137381755-137381777 AGGTCTTGGGGACCCCCATATGG - Intronic
1185644869 X:1609417-1609439 GGGACATGGGGACACCACGCTGG + Intergenic
1186247638 X:7631500-7631522 GGGAGGTGGGGAGCCCCAGGGGG - Intergenic
1197762990 X:130040593-130040615 GGGGCTTGGGAACCCAGAGCTGG - Intronic
1199076850 X:143534970-143534992 GGTAGTTGGGTACCCCTAGCAGG - Intergenic
1200124946 X:153808804-153808826 GTGACTTGGTGATCCCCAGCTGG - Intronic
1200926596 Y:8660209-8660231 GGAACTTGGGGAAACACAGCTGG - Intergenic