ID: 935113826

View in Genome Browser
Species Human (GRCh38)
Location 2:100116601-100116623
Sequence CTAAGGTCCTTGAATTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 8, 3: 25, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935113826 Original CRISPR CTAAGGTCCTTGAATTTTCC TGG (reversed) Intronic
900724277 1:4205056-4205078 CTGAGGGCCTGGATTTTTCCTGG - Intergenic
901950077 1:12737739-12737761 CTAAGGTCCTTGAGTTTTCTGGG + Intergenic
902088519 1:13882932-13882954 CTAAGGTCCTTGCATTGTCCAGG - Intergenic
902177024 1:14658038-14658060 CTAAGGACACTGACTTTTCCAGG - Intronic
902981321 1:20125489-20125511 CTAAGGTTTGTGCATTTTCCTGG + Intergenic
903368869 1:22821986-22822008 CTAAGGTCCTTGGATGATGCTGG + Intronic
903638276 1:24835653-24835675 CTAAGGTCTTTGCATTATCCTGG + Intronic
903724982 1:25434764-25434786 CTAAGGTCCTTTGGTTTTCTGGG + Intronic
906183814 1:43844408-43844430 CTAAATTCCTTCAAATTTCCTGG - Intronic
906574799 1:46878667-46878689 GTAAGATCCTTGCATTTTCAGGG + Intergenic
906597174 1:47089236-47089258 GTAAGATCCTTGCATTTTCAGGG - Intronic
907950669 1:59180208-59180230 CTGAGATCCTTGCATTTTTCTGG + Intergenic
908423561 1:63983109-63983131 CTAAGGTCCTCCAATGTGCCAGG + Intronic
909060344 1:70871847-70871869 CTAGGGTCATTCAATTTTCAAGG + Intronic
910732432 1:90412488-90412510 CAAGGGTCCCTGAATTTCCCTGG - Intergenic
911889192 1:103345250-103345272 CTAAGTTCCTTGGAATTTCCTGG - Intergenic
912573971 1:110647452-110647474 ATAAGGACCTTGAAGTTTCCTGG + Intergenic
913059497 1:115191843-115191865 CCAAGTTCCTTGATTTGTCCTGG + Intergenic
915788261 1:158639774-158639796 GCAATTTCCTTGAATTTTCCTGG - Intronic
917021583 1:170594174-170594196 CCAAGGCCCTGGAATTTCCCTGG + Intergenic
917571217 1:176267210-176267232 CTAAGGCCTTTGTATTGTCCTGG + Intergenic
920121098 1:203659052-203659074 CTAAGGTCCTTATATTTTCTAGG + Intronic
921202755 1:212823029-212823051 ATAAGAACTTTGAATTTTCCAGG + Intergenic
923067761 1:230535477-230535499 CTAAGGTCTTTGCATTGTCCAGG + Intergenic
1063961794 10:11312492-11312514 CTCAGATCCTTGAATTGTTCTGG + Intronic
1067210451 10:44256519-44256541 CTGGGGTTCTTTAATTTTCCAGG + Intergenic
1070127332 10:73632873-73632895 CTAAGGAGCCTGGATTTTCCAGG - Intronic
1071879876 10:89885573-89885595 CAAAGGTTCTAGGATTTTCCTGG + Intergenic
1074741573 10:116489558-116489580 CAAAGGCCCATGAATTTTCGAGG + Intergenic
1077033763 11:483754-483776 GTACTGTCCTTTAATTTTCCTGG + Intronic
1079208244 11:18436784-18436806 CTAAGATCTTTGTATTATCCCGG - Intronic
1079802424 11:24887126-24887148 CTATGGACCTTGTGTTTTCCTGG + Intronic
1079881552 11:25933935-25933957 TTAAGGTCCATCAAGTTTCCTGG + Intergenic
1080063858 11:27986534-27986556 CTATGATCCTTGCATTATCCTGG + Intergenic
1080831528 11:35897588-35897610 CTAAGGTTCTTCCATTGTCCAGG + Intergenic
1081957496 11:47106384-47106406 CCTAGGTCCCTGAATTTTCAAGG - Intronic
1086174229 11:83870784-83870806 CTAACGTCTCTGAGTTTTCCGGG + Intronic
1086268732 11:85034023-85034045 CCATGGTTCTTGCATTTTCCTGG - Intronic
1087979044 11:104587911-104587933 GTAAGGTCCTTGCATTGTCCAGG + Intergenic
1088039058 11:105354213-105354235 CTAAGAACCTTGAAATTTTCAGG - Intergenic
1088388448 11:109287065-109287087 CTAAGGTCACTGCATTATCCAGG + Intergenic
1088547795 11:110978645-110978667 CTAAGATCTTTGTATTTTTCTGG + Intergenic
1089561202 11:119344091-119344113 TTAAGGACCTTTAATTTACCTGG + Intronic
1091620198 12:2081790-2081812 CTAAGGTCTTGGTATTTTTCAGG + Intronic
1094780161 12:33782018-33782040 GTAAGGTCATTGAAATATCCAGG + Intergenic
1098120828 12:67236492-67236514 CTAATGACCTTATATTTTCCAGG + Intergenic
1098416075 12:70237012-70237034 CTAAGCCCCTTGGAATTTCCTGG + Intergenic
1098607498 12:72409903-72409925 TGAAGGTCCTTGCATTATCCAGG + Intronic
1098690148 12:73477250-73477272 ATAATGGCTTTGAATTTTCCTGG - Intergenic
1100380082 12:94053830-94053852 CTAAGTTCCTGGAATTTCCCAGG + Intergenic
1102855326 12:116288555-116288577 CTAAGATCTTTGAATATGCCAGG + Intergenic
1103666710 12:122573138-122573160 CTATGGTGGTTGTATTTTCCTGG - Exonic
1104440902 12:128792267-128792289 CTAAGGCCTTTGTAATTTCCTGG - Intergenic
1105602476 13:21899637-21899659 CTAAGGTCCCTGAGTTTGGCAGG - Intergenic
1105986752 13:25574836-25574858 TTAATGTCCTGGAATTTTCTAGG + Exonic
1106661614 13:31805893-31805915 CTAATTTCATTTAATTTTCCTGG - Intergenic
1107115953 13:36745639-36745661 CTGAGGTCCTTGACCTATCCTGG - Intergenic
1109002850 13:56828608-56828630 CTAGGGTTCTTGAATGTTCTAGG - Intergenic
1109050569 13:57476226-57476248 CTCAGGTCCTGGCTTTTTCCTGG + Intergenic
1112539952 13:100299025-100299047 CTAACTTGCTTCAATTTTCCAGG - Intronic
1112876464 13:104046173-104046195 CAAATGTCTTTGAATTTTACAGG - Intergenic
1114175611 14:20317148-20317170 CTAAGGTGCTGGAATTATACAGG - Intronic
1114685315 14:24525260-24525282 CTAATGTTCTTGAATTCTCCAGG - Intergenic
1114922624 14:27352003-27352025 TTATGGTCCATGAATATTCCTGG - Intergenic
1117168479 14:53065984-53066006 CTAAGGACCATGAATTGTACCGG + Intronic
1117335827 14:54756494-54756516 CTAAGGTGCTTGCAGTTTCTGGG - Intronic
1117408293 14:55426420-55426442 CTAAGGTCATTCAGTTTCCCAGG - Intronic
1121157815 14:91703413-91703435 CTAAACTCCTTGGAATTTCCTGG + Intronic
1202836238 14_GL000009v2_random:79336-79358 CTAACTGCCTTGTATTTTCCAGG - Intergenic
1124500200 15:30221496-30221518 CTAAGGTCTTTGAATTATCCTGG + Intergenic
1124743375 15:32317170-32317192 CTAAGGTCTTTGAATTATCCTGG - Intergenic
1124871769 15:33550544-33550566 CTATGCTCCTTGCACTTTCCAGG - Intronic
1124905738 15:33866994-33867016 TTGAGATCCTTTAATTTTCCAGG - Intronic
1126201933 15:45996281-45996303 CTAGGGGCCTGGAATTTCCCTGG + Intergenic
1130290951 15:82600601-82600623 GTAAGGTCCTTGCATTTTCTAGG + Intronic
1130416340 15:83697975-83697997 CTAAATTCCTTGGAATTTCCTGG - Intronic
1131070450 15:89462421-89462443 CTAAGGACCTTCACTTTACCAGG + Intergenic
1132096980 15:98993951-98993973 TTAAGGTCCTTGTATTCTACAGG - Intronic
1132124995 15:99215343-99215365 CAAAGGTCCTTGCATTGTTCAGG + Intronic
1132237072 15:100230046-100230068 CTGAAGTCCTAGAAGTTTCCTGG + Intronic
1135673357 16:24393474-24393496 CTAGGCGCCTGGAATTTTCCTGG + Intergenic
1136993378 16:35170760-35170782 CCCAGGTTCTTGAATTTTCAGGG - Intergenic
1138935852 16:61721769-61721791 CTAAAGTCCCTGAAATTTCTAGG - Intronic
1139483101 16:67241448-67241470 CTAGGGTCCCAGAATCTTCCAGG - Intronic
1140047534 16:71452112-71452134 CTGAAGTCTTTGACTTTTCCAGG - Intronic
1140766316 16:78161863-78161885 CTAAGGTTCTTGTCTTCTCCAGG - Intronic
1141051796 16:80772415-80772437 CTAAGGTCTCTGAATTGTCTGGG + Intronic
1144231422 17:13208260-13208282 CTAAGGGGCATGACTTTTCCAGG + Intergenic
1144778855 17:17798025-17798047 CCAAGGTCCTTGAAGTTGGCCGG - Exonic
1149146186 17:53496516-53496538 CTAAATCCCTTGAAATTTCCTGG + Intergenic
1153048395 18:877625-877647 ATAAGGTCCTTGGATTTTCCTGG + Intergenic
1153418308 18:4875268-4875290 CTAATGTCCTAGAGTTTTCCGGG + Intergenic
1153737874 18:8091311-8091333 ATATGCTCCTTGAATTTGCCAGG + Intronic
1153737968 18:8092572-8092594 ATATGCTCCTTGAATTTGCCAGG - Intronic
1155909689 18:31493851-31493873 TGTAGGTCCTTGAATTTTACTGG - Intergenic
1156838034 18:41579051-41579073 CTAAGGTCTTTGCACTTTCTGGG + Intergenic
1157215314 18:45777958-45777980 CTAAGGTCCTTGCATTGTCTGGG - Intergenic
1158584118 18:58715267-58715289 CTAAGATTCTAAAATTTTCCTGG + Intronic
1158902558 18:61979502-61979524 GTAAGGTCTTTGCATTGTCCAGG - Intergenic
1159131805 18:64288342-64288364 CTAAAGCCCTTGTAATTTCCTGG + Intergenic
1159572356 18:70131424-70131446 CTAAGGTCCTTGCATTGTCTGGG + Intronic
1164772813 19:30824788-30824810 TTAAGGTCCTTATATTTTCAAGG - Intergenic
1167960357 19:53099941-53099963 AGAAGATCCTGGAATTTTCCAGG - Intronic
1202636400 1_KI270706v1_random:48029-48051 CTAATTGCCTTGTATTTTCCAGG + Intergenic
925395587 2:3531199-3531221 TTAATTTCCTTGAGTTTTCCAGG - Intergenic
926803013 2:16678716-16678738 CTAAGCTAGTTGAGTTTTCCAGG - Intergenic
927384927 2:22521884-22521906 CTAAAGTCCTTGGAATCTCCAGG - Intergenic
928001590 2:27527526-27527548 CTAAAGTCCTTTATCTTTCCAGG - Intergenic
929548079 2:42869489-42869511 CTAAGGTTCTTGCATTATCCAGG + Intergenic
931792294 2:65674785-65674807 CTAAGGTCCTTGAATTGCTTGGG - Intergenic
933637908 2:84727018-84727040 GTAATGTGCTAGAATTTTCCTGG - Intronic
934919519 2:98331634-98331656 TGGAGGTCCTTGAATTCTCCTGG - Exonic
935113826 2:100116601-100116623 CTAAGGTCCTTGAATTTTCCTGG - Intronic
936788833 2:116125835-116125857 CAAAGGTCTTTGAAATTCCCTGG + Intergenic
938332844 2:130461009-130461031 CTAATTGCCTTGTATTTTCCAGG + Exonic
938356963 2:130659662-130659684 CTAATTGCCTTGTATTTTCCAGG - Intergenic
938433399 2:131266468-131266490 CTAATTGCCTTGTATTTTCCAGG - Intronic
939706054 2:145455078-145455100 CTAAGGTCCTTTTTTGTTCCAGG - Intergenic
939746895 2:145983886-145983908 CTAAAGTCCTTGCATTTTTATGG - Intergenic
941629680 2:167870071-167870093 CTAAGGTGTTGGTATTTTCCAGG + Exonic
943918585 2:193672299-193672321 CTAAAGTCCTTGAATTTTATAGG + Intergenic
945459715 2:210091622-210091644 CTGAGGTGCTTGAATTATTCAGG - Intronic
947171116 2:227312410-227312432 CTGAGGTTCATGGATTTTCCAGG + Exonic
947254959 2:228152807-228152829 CTAAGATCCTTGTACTTACCAGG - Intronic
947826074 2:233106986-233107008 CTAAGCTGCTTGAATCTTCAAGG + Intronic
948914459 2:241025445-241025467 CCAAGGTCATTGCATTTCCCAGG - Intronic
1168836435 20:880858-880880 CTAAGGCCCTGGAATTTTGGGGG + Intronic
1169056849 20:2629165-2629187 CCAAAGTTCTTGAATCTTCCAGG + Intronic
1169168602 20:3445275-3445297 CTAAGGTCCTTGCATTGCCCAGG + Intergenic
1169175525 20:3508849-3508871 TTAAGGTCCTTGAATTGCCCAGG + Intronic
1169512957 20:6284676-6284698 CTAAGGTCCTGGCATTGTCTGGG + Intergenic
1173949809 20:46982034-46982056 TTAAGGACCTTGCATTTTCTTGG - Intronic
1175087281 20:56470548-56470570 CTAAATTCCTTGTAATTTCCTGG + Intronic
1178290149 21:31360384-31360406 CTAATGTCCTTGTATTATCTAGG + Intronic
1178290152 21:31360411-31360433 CTAATGTCCTTGTATTATCTAGG + Intronic
1179238688 21:39569374-39569396 CTTTGGTCCTTGAATATGCCAGG + Intronic
1181537690 22:23555132-23555154 CTCAGGCCCTTGTACTTTCCAGG - Intergenic
1182707338 22:32293526-32293548 GTTAGGTCCTTGGATTGTCCAGG - Intergenic
1183595760 22:38809512-38809534 CTAATGTCCTTACATTGTCCTGG - Intergenic
1184367728 22:44063153-44063175 CTAAGAACCTTGTAATTTCCAGG - Intronic
949878960 3:8647009-8647031 CTAAGAACCTTGTTTTTTCCTGG + Intronic
950243859 3:11396856-11396878 CTAAGGTTCTTGCATTGTCTTGG + Intronic
951365220 3:21773287-21773309 CTAAGAGGCTTGAACTTTCCAGG - Intronic
952541635 3:34373316-34373338 CTAGTGTCCTTGAATTGACCTGG - Intergenic
953664085 3:44913562-44913584 CGTATGTCTTTGAATTTTCCAGG + Exonic
955931365 3:64060539-64060561 TTAAGCTGCTTGACTTTTCCAGG - Intergenic
956488104 3:69742456-69742478 TTAAGAACCTTGAATTTTACTGG - Intronic
962459956 3:135601872-135601894 CTAAGGTCCTTGCATTATTTTGG + Intergenic
963351962 3:144162886-144162908 CTAAGGTCCTCTGATTTTGCTGG + Intergenic
964610350 3:158607768-158607790 CTAAGGTCCTTGTATTCTTAAGG + Intergenic
965354776 3:167660235-167660257 ATTAGTTCCTTTAATTTTCCTGG + Intergenic
966299928 3:178467166-178467188 CTAAGTACCTTGAAATGTCCAGG + Intronic
967776477 3:193391351-193391373 CTAAATTCCTAGAAATTTCCTGG - Intergenic
969140997 4:5071650-5071672 CTAAGCTCCTTTGATTCTCCAGG - Intronic
971125257 4:23747014-23747036 CTAAGGTCCAAGAATTATTCTGG - Intergenic
972251342 4:37305292-37305314 CCAAGGTCCCTGAAATTCCCTGG + Intronic
974011645 4:56612902-56612924 CTAAGTGCCTGGAATTTCCCAGG + Intergenic
976048394 4:80981032-80981054 CTAAGTTACTTGAACTTTCCCGG - Intergenic
977060067 4:92247088-92247110 GTAAAGTGCTTGAAATTTCCTGG + Intergenic
979944098 4:126804255-126804277 CTAAGATCCTCACATTTTCCTGG - Intergenic
981506900 4:145511691-145511713 CTAAGGTCCTTGTGTTATCCAGG - Intronic
982045939 4:151445631-151445653 CTAAAGCCCTTAAAATTTCCTGG - Intronic
982386997 4:154817980-154818002 CTAAGTTCCTTGTATTATCTAGG - Intronic
982802946 4:159726744-159726766 ATAAGAAACTTGAATTTTCCAGG - Intergenic
984043477 4:174767888-174767910 CTAAGAACATAGAATTTTCCAGG + Intronic
984901966 4:184593442-184593464 CCAAAGCCCATGAATTTTCCAGG + Intergenic
1202763718 4_GL000008v2_random:133896-133918 CTAACTGCCTTGTATTTTCCAGG + Intergenic
986658826 5:10041041-10041063 CTAAGTTCCTGGAATGTTCTAGG - Intergenic
987235253 5:15936029-15936051 CTGAGCTCCTGGAACTTTCCAGG + Intronic
987742603 5:21929225-21929247 GTAATGTGCTTGAATCTTCCTGG - Intronic
992425312 5:76650933-76650955 CACAGGTGCTTTAATTTTCCTGG + Intronic
993043459 5:82841322-82841344 CTAAGTTCATTTTATTTTCCAGG - Intergenic
993523313 5:88932778-88932800 CTAATGTCCTTGGATGTTCAGGG - Intergenic
994727998 5:103459219-103459241 AGAAGCTCCTTGAATTGTCCAGG + Intergenic
996995134 5:129686647-129686669 CTATGCTCCTTGAATATTCTTGG - Intronic
997641882 5:135454744-135454766 CCAAGGTCCTTGCATTGTCCAGG + Intergenic
999431678 5:151530387-151530409 CTCAGGTCCTTGTATTTCCTAGG - Intronic
999901241 5:156088989-156089011 ATTTGGTCCTTGATTTTTCCAGG + Intronic
1000508368 5:162149983-162150005 ATAAGGTCCTTGAAGTTTCAAGG + Intronic
1000681967 5:164196270-164196292 CCAACCTCCTTAAATTTTCCAGG + Intergenic
1001152131 5:169240960-169240982 CTAAGATCCTTAAATTATTCAGG - Intronic
1003056903 6:2829456-2829478 CTAAAGTCCTTGCATTGTCTGGG - Intergenic
1003056930 6:2829918-2829940 CTAAGGTCCTTGCATTGTCTGGG - Intergenic
1007058564 6:38914251-38914273 TTAAGGTCCCTGTATGTTCCAGG + Intronic
1013335186 6:109151147-109151169 CTAATATCCTTGCATTTTCTTGG + Intronic
1014530571 6:122554278-122554300 CAAAGATTCTTGAATTTTCCAGG + Intronic
1015017112 6:128426890-128426912 TTCAGGGCCTTGACTTTTCCTGG + Intronic
1017106343 6:150892103-150892125 CTATTGCCCTTGAATTTTCTTGG - Intronic
1020518345 7:9154307-9154329 CTCAGTTATTTGAATTTTCCCGG - Intergenic
1020714971 7:11661896-11661918 TTAAGGTCCTTGCATTTTCTAGG + Intronic
1023536013 7:41211798-41211820 CTAAGGTCCTTGCATATACTTGG - Intergenic
1024026913 7:45418554-45418576 CTAAAGTCCTTGAATTATTAGGG - Intergenic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026418904 7:70212117-70212139 ATAAGGTCCTTCTATTTTCATGG - Intronic
1027974498 7:85133600-85133622 ATAAAATTCTTGAATTTTCCAGG + Intronic
1028290167 7:89055926-89055948 CTCAGGTGGTTGATTTTTCCTGG + Intronic
1033567213 7:142590917-142590939 CTAAGGTCTTTACACTTTCCAGG + Intergenic
1034569011 7:151940339-151940361 ATGAGTTCCTTGAATTTTCTAGG - Intergenic
1034645811 7:152646208-152646230 CTAAGGTCCTTGCATTGTCCGGG - Intronic
1034677696 7:152903330-152903352 CCCAGGTGCTTGAATATTCCAGG + Intergenic
1037489890 8:19388142-19388164 CTAGGCTCATGGAATTTTCCTGG - Intronic
1038654836 8:29440040-29440062 CTAAGGTCATTGCATTGTCTGGG + Intergenic
1042402774 8:68368999-68369021 CTAAAATCCTTGCATTATCCAGG - Intronic
1044991014 8:97795892-97795914 CTAAGGTCCTTGCATTGTCTAGG - Intronic
1045372377 8:101537460-101537482 CTTAACTCCTTGAATTTTCTTGG - Intronic
1047428729 8:124771831-124771853 CGTAGGTCCTTGCATTTTCTGGG - Intergenic
1047535570 8:125716611-125716633 TCAAGGTCCTTGCATTTTTCAGG - Intergenic
1049892336 9:82342-82364 CTTTGTTCCTTTAATTTTCCAGG + Intergenic
1051731890 9:20152384-20152406 CTAAAGAACTTGGATTTTCCAGG - Intergenic
1053400233 9:37812953-37812975 CTAAGGTTCTTGCATCATCCAGG + Intronic
1053733755 9:41083419-41083441 CTTTGTTCCTTTAATTTTCCAGG + Intergenic
1055055355 9:72018616-72018638 CCAAGGTCCTTGAATTTAGGTGG - Intergenic
1055464592 9:76551725-76551747 GTAAGTCCCCTGAATTTTCCAGG - Intergenic
1059981744 9:119780582-119780604 CTAAGGCCCTTGTATTTTCCAGG + Intergenic
1203544471 Un_KI270743v1:118769-118791 CTAACTGCCTTGTATTTTCCAGG + Intergenic
1187148291 X:16657490-16657512 GCAAGGTGCTTGAAATTTCCTGG + Intronic
1187308255 X:18116496-18116518 CTGATGTCCTTGAACTCTCCAGG + Intergenic
1189629518 X:42937545-42937567 CAAAGGTCCTTGAATTTTCTGGG - Intergenic
1190204228 X:48389438-48389460 CCAAGGTACTTGGATTTCCCGGG - Exonic
1190206308 X:48405965-48405987 CCAAGGTACTTGGATTTCCCGGG + Exonic
1190974260 X:55384599-55384621 CTAATATCATAGAATTTTCCAGG + Intergenic
1193202631 X:78710007-78710029 CTATGGTACTAGAATTCTCCGGG + Intergenic
1194413987 X:93588214-93588236 CTATGGTCATTTAATTCTCCAGG - Intergenic
1195498637 X:105567754-105567776 ATAAAGTCCGTAAATTTTCCAGG - Intronic
1197955427 X:131941737-131941759 CTAAGGTCCTTATATTGTCCAGG - Intergenic
1200928080 Y:8672430-8672452 GCAGGGCCCTTGAATTTTCCTGG + Intergenic
1202030754 Y:20572051-20572073 CTAACTTGCTTTAATTTTCCAGG - Intergenic