ID: 935115975

View in Genome Browser
Species Human (GRCh38)
Location 2:100136597-100136619
Sequence ATGGATAAACAGATCAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 302}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935115975 Original CRISPR ATGGATAAACAGATCAATGG GGG (reversed) Intronic
900869239 1:5289973-5289995 ATGGATACATGGATGAATGGTGG + Intergenic
905083385 1:35346157-35346179 ATAGATAAACAGATAAAATGTGG - Intronic
905574672 1:39034311-39034333 CTGGAAAAACAGATCAATTTTGG - Intronic
905946185 1:41903245-41903267 AGGCAAAAACAGATCTATGGAGG + Intronic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
908701228 1:66903251-66903273 AGGGATAAACATAACAAAGGAGG - Intronic
908736204 1:67279396-67279418 ATGGAAAAGCAGATCCATGCTGG - Intergenic
909511721 1:76460927-76460949 ATGGGTAAAGAGAGGAATGGTGG + Intronic
909566611 1:77059837-77059859 ATAAATAAACAAATAAATGGAGG - Intronic
910258706 1:85276097-85276119 CTGGATTGACAGATCACTGGAGG + Intronic
911386638 1:97183674-97183696 ATGTATATACAGATCAATCCAGG + Intronic
912125630 1:106533940-106533962 ATGAATAAACAGATCCAGAGAGG + Intergenic
913082247 1:115399456-115399478 ATGGATGAACAAGTCACTGGTGG + Intergenic
913286713 1:117233262-117233284 ATGGATAAACAAGAAAATGGAGG + Intergenic
915667321 1:157456914-157456936 ATAGATAGACAGATAAAGGGGGG + Intergenic
916861707 1:168812911-168812933 ATGGATAAACAAATGTATAGTGG + Intergenic
917243184 1:172971809-172971831 ATGGATAAATGGATGAATGGAGG - Intergenic
918465573 1:184818454-184818476 ATGAATAGACAGATGAATGGTGG + Intronic
918943851 1:191034926-191034948 ATGGAGAATCAGATTTATGGAGG - Intergenic
918957694 1:191231673-191231695 ATAGATAAACAAATTAAAGGAGG + Intergenic
920406030 1:205711905-205711927 GTGGATAAACAGATGAAGAGAGG - Intergenic
922341587 1:224660845-224660867 ATGGAAAAGCAGATCCATGCTGG + Intronic
922792839 1:228319642-228319664 ATGGATGGATAGATGAATGGTGG - Intronic
923116406 1:230942984-230943006 ATGGATACATAGATCAAGTGAGG - Intronic
1064186750 10:13168446-13168468 ATGGAGAAACAGATCAGTTCAGG - Intronic
1064872705 10:19956659-19956681 ATGGAATAAAAGATCAATGAAGG + Intronic
1070266930 10:74912318-74912340 ATGGATAGACAGATAGATGAAGG + Intronic
1073285119 10:102382838-102382860 ATGGAAAAACAGAACAACAGTGG + Exonic
1073488365 10:103836147-103836169 ATGGAGGAAAAGATCAAAGGTGG + Intronic
1075839919 10:125492738-125492760 CTGAATAAAGAGATCAAAGGAGG + Intergenic
1077280599 11:1743396-1743418 ATGGATAGACGGATGGATGGAGG + Intronic
1077479932 11:2809009-2809031 ATGGATAAATGGAGGAATGGAGG + Intronic
1077640388 11:3876291-3876313 ATGGATAAACAGACCTAGGTAGG + Intronic
1078403741 11:11049431-11049453 GTGGATAAGCAATTCAATGGAGG - Intergenic
1080185323 11:29476536-29476558 ATGAATAAACAGATTCATAGTGG - Intergenic
1080781502 11:35433884-35433906 ATGGATAGACAGATGGGTGGGGG + Intronic
1080898285 11:36463764-36463786 CAGGATAAAGAGATCCATGGTGG + Exonic
1081998548 11:47379268-47379290 ATGGGAAAACAGATGAATGGTGG - Intergenic
1085008590 11:73118560-73118582 ATGGATACACACATCAATGTGGG - Intronic
1085655578 11:78311690-78311712 ATGAATAAACAAATGCATGGAGG - Intronic
1085952949 11:81354851-81354873 ATAGATAAACATATGTATGGAGG + Intergenic
1086525136 11:87715804-87715826 AGGGAAACAGAGATCAATGGAGG - Intergenic
1086613131 11:88780916-88780938 ATGTATGAATAGATCAAAGGAGG - Intronic
1087144193 11:94796010-94796032 AAGGAAAGACAGATCAATGTGGG - Intronic
1087273789 11:96140097-96140119 ATGGATAAAATCATCTATGGAGG - Intronic
1087868030 11:103257583-103257605 ATGGATCAAGAGATCAGTAGGGG - Intronic
1088447302 11:109945868-109945890 ATGGAGAAACAGAAACATGGAGG - Intergenic
1089101103 11:115963291-115963313 ATGGAGACACATTTCAATGGGGG + Intergenic
1089717841 11:120380800-120380822 CTGAATAAACAGATAAATGTGGG - Intronic
1090559519 11:127916216-127916238 ATAGATGAATAGATCAATAGAGG - Intergenic
1092355665 12:7792965-7792987 CTGAATAAGCAGATCCATGGAGG - Exonic
1094487709 12:30938237-30938259 CTGTTTAAAGAGATCAATGGGGG + Intronic
1097348632 12:58523087-58523109 TTGAATGAATAGATCAATGGTGG - Intergenic
1099160593 12:79236721-79236743 ATGGATAAACAGCTTGATGATGG + Intronic
1099848772 12:88064389-88064411 ATGGTTAAACTGATCTATGGTGG + Intronic
1099971904 12:89509174-89509196 ATGAGTAAACAGATAAATGGAGG - Intronic
1100196779 12:92255418-92255440 ATGGATACAGATAACAATGGAGG - Intergenic
1100359709 12:93864985-93865007 ATGAATAAACAAATGAATGAGGG + Intronic
1102514559 12:113437672-113437694 ATGGATAGAGAGATAAAAGGTGG + Intronic
1103064166 12:117883056-117883078 ATGGATGGATAGATGAATGGAGG - Intronic
1103088504 12:118080634-118080656 ATGGATGAACAAATAAATTGTGG + Intronic
1104766135 12:131331374-131331396 ATGGATGGATAGATGAATGGGGG - Intergenic
1104925730 12:132313186-132313208 ATGGATGTACAGATGTATGGAGG - Intronic
1105279634 13:18955886-18955908 ATGGATGAACAAATGCATGGAGG - Intergenic
1105639756 13:22250134-22250156 ATGTATTAACAGCTCAGTGGAGG - Intergenic
1105689878 13:22826734-22826756 ATTGAAAAACAAAACAATGGTGG + Intergenic
1105757445 13:23481292-23481314 AGGGAGAGACAGAGCAATGGAGG - Intergenic
1106900578 13:34351234-34351256 ATGGATAAATGGATGAGTGGAGG + Intergenic
1107015344 13:35704439-35704461 TTGGATAAATAAATAAATGGGGG - Intergenic
1107290199 13:38843242-38843264 ATGGATAAAACAATCAGTGGAGG - Intronic
1107969166 13:45624797-45624819 AAGGAGAAGCAGATCATTGGGGG - Intergenic
1108716390 13:53082346-53082368 ATGCATAGAAAGATCAATGAGGG - Intergenic
1109924928 13:69124249-69124271 ATGGATAAATTCTTCAATGGTGG - Intergenic
1111769328 13:92576771-92576793 TTGGAGAAAGAGATCAATGTGGG - Intronic
1111913747 13:94339577-94339599 ATGCATGAAAAGATCAAGGGTGG + Intronic
1112445911 13:99464116-99464138 ATAGATAGATAGATGAATGGTGG - Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113560456 13:111275069-111275091 ATTGCAAAACAGAACAATGGTGG + Intronic
1113780227 13:112972544-112972566 ATGGATAAATAGATAAATGGAGG + Intronic
1115027787 14:28764451-28764473 ATGGAGAGACAGAGGAATGGAGG + Intergenic
1115041274 14:28932015-28932037 ATGGACAAACAGAAGAATAGTGG - Intergenic
1115447126 14:33503791-33503813 AAGGATAAACAAAGCAATGTAGG - Intronic
1117028184 14:51642854-51642876 ATGAATCAACAAATCAATGATGG + Intronic
1118170179 14:63380884-63380906 ATTGATAAAAAGAGCAATGAGGG - Intronic
1122735760 14:103840171-103840193 AGGGCTAAACAGAGGAATGGTGG - Intronic
1123542240 15:21305731-21305753 AGGAAAAAACAGATCAGTGGTGG + Intergenic
1123632861 15:22274096-22274118 ATGGCAAAACTAATCAATGGTGG - Intergenic
1123915679 15:25023663-25023685 ATGTATAAACATATAAAGGGAGG - Intergenic
1125032300 15:35084922-35084944 CTGAATAAGCAGATCCATGGAGG + Intergenic
1125683886 15:41551027-41551049 ATTAATAAATAAATCAATGGGGG - Intergenic
1126576342 15:50200695-50200717 ATGGAAGAACAGTTCAATTGGGG - Intronic
1127029911 15:54850708-54850730 AAGAATCAAAAGATCAATGGTGG + Intergenic
1128734126 15:70042729-70042751 ATGGATGGATAGATGAATGGGGG - Intergenic
1130358660 15:83159611-83159633 ATAGATATACAGATCAAGGAAGG + Intronic
1131655970 15:94459258-94459280 ATGGGTAAACAGATTAAAAGTGG + Intronic
1131668914 15:94598801-94598823 ATGGATGAAGAGATAAATGATGG - Intergenic
1132194742 15:99905248-99905270 TTGGAGAAAGAGATCAATGTGGG + Intergenic
1133530892 16:6653886-6653908 ATGGATAAAAAGATGAATTTGGG + Intronic
1133841937 16:9417853-9417875 ATGGATAGATGGATGAATGGAGG + Intergenic
1133890766 16:9876697-9876719 CTTGGTAAACAGATCAATAGTGG + Intronic
1134850252 16:17473094-17473116 ACTGATAAACAGATGACTGGTGG - Intergenic
1135187364 16:20326945-20326967 ATGAATAAATAAATCAATGGGGG + Intronic
1137243319 16:46678504-46678526 ATAGACACACAAATCAATGGAGG - Intronic
1137855675 16:51792278-51792300 ATGGATAGACAATTCCATGGAGG + Intergenic
1138123307 16:54418207-54418229 CTGGATAAAAAGTTCTATGGAGG + Intergenic
1138244031 16:55453085-55453107 ATGGATAAAGGGATGGATGGAGG - Intronic
1138246290 16:55469363-55469385 AAGGCTAAACAGAGCACTGGGGG - Intronic
1138281771 16:55777671-55777693 ATGGATGGATGGATCAATGGAGG - Intergenic
1138287099 16:55818744-55818766 ATGGATGGATGGATCAATGGAGG + Intronic
1138332901 16:56229506-56229528 ATGGGTAAAAACAACAATGGGGG - Intronic
1138481586 16:57306907-57306929 TTGGAAAACCAGATAAATGGAGG - Intergenic
1138936065 16:61725086-61725108 ATGTCTAAACAGATCATTAGAGG + Intronic
1140448715 16:75052790-75052812 ACGGACAGACAGATCGATGGAGG - Intronic
1140966300 16:79969309-79969331 ATAGATAGACAGATAGATGGAGG - Intergenic
1141110236 16:81265856-81265878 ATGGATAGATGGATGAATGGTGG - Intronic
1141118290 16:81330535-81330557 ATGAATAAACTAATAAATGGAGG + Intronic
1141314301 16:82946204-82946226 ATGGATACATGGATGAATGGAGG + Intronic
1141483844 16:84325687-84325709 ATGGATGAATAGATCGATGGAGG - Intronic
1141854768 16:86673570-86673592 ATGGACAAATGGATCAAGGGAGG - Intergenic
1141854847 16:86673943-86673965 AGGGATGAACAGATGGATGGGGG - Intergenic
1141854934 16:86674282-86674304 GTGGATGAACAAATGAATGGTGG - Intergenic
1141970200 16:87476669-87476691 ATGGCAAAACTAATCAATGGTGG + Intronic
1142152726 16:88519820-88519842 ATGGATGGACAGATAGATGGTGG + Intronic
1144090379 17:11850903-11850925 ATGGTTAACAAGATAAATGGAGG + Intronic
1144164871 17:12600773-12600795 ATGGATTCTCAGATCAATGGGGG + Intergenic
1144416649 17:15054088-15054110 ATGGATAACCAAAACAAAGGAGG + Intergenic
1145295676 17:21590901-21590923 AGGGTTAAACAGATTAAGGGCGG + Intergenic
1146939193 17:36832296-36832318 ATGGATGGACAGATGGATGGTGG - Intergenic
1149277291 17:55055988-55056010 ATGGATAAAGGGATAAATGGAGG + Intronic
1149449021 17:56735060-56735082 AAGGATAAACAGATGAACAGAGG - Intergenic
1150186126 17:63183190-63183212 ATGGAAAAGCAGATCCATGCTGG - Intronic
1150924788 17:69521671-69521693 ATGAATAAATGGATGAATGGGGG - Intronic
1151222362 17:72622541-72622563 ATCCATAAACAGAGAAATGGAGG - Intergenic
1152513007 17:80803082-80803104 CAGGATAAACAGATCCAAGGAGG - Intronic
1155151128 18:23123815-23123837 ATGAATAAATACATAAATGGAGG + Intergenic
1155601786 18:27557318-27557340 ATGGATAAAGGGATCAAAAGAGG + Intergenic
1156783733 18:40883075-40883097 AAAAATAAACAGTTCAATGGAGG - Intergenic
1156848161 18:41693751-41693773 ATGGATAAAAAGAGCAGAGGTGG - Intergenic
1157554414 18:48603647-48603669 ATGGATGAATGGATGAATGGTGG + Intronic
1159915910 18:74187579-74187601 ATAGATAAATAAATCATTGGTGG + Intergenic
1160047294 18:75398803-75398825 ATAGATAGACAGACCAATGGTGG - Intergenic
1161364534 19:3870581-3870603 ATGAATAAACAAATAAATGGAGG + Intergenic
1161857888 19:6776197-6776219 ATGGATGAGCAGATGGATGGAGG - Intronic
1161982882 19:7638988-7639010 ATGGATGGACAGATGGATGGAGG - Intronic
1162085902 19:8248974-8248996 ATGAATTAACAGATGAATGATGG + Intronic
1162535296 19:11260070-11260092 ATGGATGAACAGATGAATATAGG + Intronic
1163238505 19:16043718-16043740 ATGGATAAAGGGATGAAAGGAGG + Intergenic
1163382631 19:16978931-16978953 ATGGATAAATGGATGGATGGTGG - Intronic
1163382706 19:16979295-16979317 ATGGATGAATAGATGGATGGAGG - Intronic
1163383632 19:16985651-16985673 ATGGATGAATAGATAGATGGAGG + Intronic
1164631871 19:29767348-29767370 ATGGATAGACAGATGACTGATGG + Intergenic
1164880638 19:31729959-31729981 ATGGATAGATAGATAAATAGAGG - Intergenic
1167218680 19:48182875-48182897 ATGAATGAACGGATGAATGGAGG - Intronic
1167233755 19:48301637-48301659 ATGGATGAACAGATGGATGTGGG + Intronic
925470461 2:4155760-4155782 ATGGATAAACAGATGATGGATGG - Intergenic
925777025 2:7345806-7345828 ATGGATGGATAGATGAATGGTGG + Intergenic
927403724 2:22743955-22743977 AGGGATCAACAGATAAAAGGAGG + Intergenic
928226437 2:29452560-29452582 ATGCATAATAAAATCAATGGAGG + Intronic
928338906 2:30424453-30424475 ATGAATAAACACTTCATTGGAGG - Intergenic
928468742 2:31551920-31551942 GTGGAGAAGCAAATCAATGGAGG + Intronic
928532931 2:32210689-32210711 ATAGATAAACAGATCAAAGCTGG + Intronic
929035336 2:37685742-37685764 TTGAATAAATAAATCAATGGGGG + Intronic
929326772 2:40622378-40622400 ATAGACAAATAGATCAATTGAGG + Intergenic
930363171 2:50407585-50407607 ATGGATTAACACATCCATGAGGG - Intronic
930413393 2:51056208-51056230 ATGGATACAGTGATCACTGGGGG + Intergenic
930524114 2:52505108-52505130 ATCCATTAACAGATCACTGGAGG + Intergenic
931160660 2:59686724-59686746 ATGAATGAACAGATGAATAGAGG - Intergenic
931591456 2:63888108-63888130 ATGGAGAAACAAAGCAAGGGTGG + Intronic
931912893 2:66921591-66921613 ATGGCGAAATACATCAATGGAGG + Intergenic
932836182 2:75039973-75039995 AATGATAAAAAGATCAGTGGTGG - Intergenic
933555805 2:83829018-83829040 AAGGAAAAACAAAACAATGGAGG - Intergenic
934613902 2:95759651-95759673 ATGGATAGACAGATGAAAGATGG + Intergenic
935030154 2:99313812-99313834 ATGAATAAACAGAGAAATGTAGG - Intronic
935115975 2:100136597-100136619 ATGGATAAACAGATCAATGGGGG - Intronic
935338362 2:102037237-102037259 ATAGTTAAACAGACCACTGGGGG - Intergenic
937248548 2:120509636-120509658 CTGGATAAACAGCTCAGGGGAGG + Intergenic
943887468 2:193239959-193239981 ATGATTGAACAGATCAATGAGGG - Intergenic
946096253 2:217276996-217277018 CTGGATAAATAAATAAATGGGGG - Intergenic
946169162 2:217884211-217884233 ATGGATGGACAGATTAATGAAGG + Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946558243 2:220883691-220883713 AAGGATAAAGAGAAGAATGGAGG + Intergenic
947909132 2:233790244-233790266 ATGGAAAGACAGAACAATGCAGG - Intronic
948791181 2:240377664-240377686 GTGGAGAAACAGATTAATAGTGG + Intergenic
1169773338 20:9225082-9225104 ATGGATAGACCGATGAATGAAGG + Intronic
1170772365 20:19344117-19344139 GTGAATAAAGAGAACAATGGTGG + Intronic
1171368332 20:24642545-24642567 ATGGATGAACCAATTAATGGAGG - Intronic
1171512617 20:25697532-25697554 ATGCATAATTAGATAAATGGGGG - Intergenic
1172390777 20:34563607-34563629 ATGAATCAATACATCAATGGGGG + Intronic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1175186645 20:57183455-57183477 TTAAATAAACAGAACAATGGCGG - Intronic
1175514855 20:59562733-59562755 ATGGATAGACAGAGCAAATGTGG + Intergenic
1175660356 20:60807428-60807450 TTGGATACACAAATAAATGGGGG - Intergenic
1175809099 20:61848008-61848030 AAGAATAAACAGACGAATGGAGG - Intronic
1176421447 21:6519466-6519488 ATGAATGAACAGATGAAGGGAGG - Intergenic
1177562802 21:22778505-22778527 ATGGATAAATAGATCAGTTTGGG + Intergenic
1178160277 21:29904514-29904536 ATGGATAGACTGATCAGTGCAGG + Intronic
1179136461 21:38684131-38684153 AAGGAGAAAAAGATCAAGGGGGG + Intergenic
1179343407 21:40533630-40533652 ATGGATGGACAGATGGATGGAGG - Intronic
1179696937 21:43127782-43127804 ATGAATGAACAGATGAAGGGAGG - Intergenic
1183794801 22:40107789-40107811 ATGGATAAACAGAGAAAGGGGGG - Intronic
1184444686 22:44540214-44540236 ATGGATAGATGGATGAATGGTGG + Intergenic
1185163414 22:49243286-49243308 ATGGATAGATAGATGGATGGAGG + Intergenic
1185293841 22:50043103-50043125 ATGGATAGACAGATAAACAGTGG + Intronic
950202140 3:11052442-11052464 ATGGCAAAACAGATAGATGGAGG + Intergenic
950526853 3:13529292-13529314 ATGGAGAAAGAGATGAATAGAGG - Intergenic
951265420 3:20560176-20560198 ATTTATAAACAGGTCAATGCAGG - Intergenic
951397845 3:22192040-22192062 ATGGAGAAAGAGATGAATGATGG - Intronic
953324922 3:42004826-42004848 ATGGCTAAAGAGATGGATGGGGG + Intergenic
954828680 3:53399244-53399266 ATGGATTAATAGATGGATGGAGG - Intergenic
955706823 3:61736461-61736483 CTGCTTAGACAGATCAATGGGGG - Intronic
955824263 3:62928672-62928694 ATGGATGAATAGATGGATGGGGG + Intergenic
957441638 3:80255388-80255410 TTGGATAAACACTTAAATGGAGG - Intergenic
958001195 3:87750934-87750956 ATATACAAAAAGATCAATGGAGG - Intergenic
960478628 3:118161114-118161136 ATGAATAAACAGATAAAATGTGG + Intergenic
960988212 3:123294156-123294178 ATAAATAAGCAAATCAATGGAGG + Intronic
962625399 3:137220865-137220887 ATGGATAACCACATTATTGGGGG + Intergenic
962760222 3:138505392-138505414 ATTTATAAACAGACCAAAGGGGG - Exonic
963144966 3:141984076-141984098 ATGGATAAACAGATAAAATGTGG + Intronic
967766866 3:193290604-193290626 CTGGATACACAGGTGAATGGGGG + Intronic
969155548 4:5206575-5206597 ATGGATAGGCCGATGAATGGAGG + Intronic
969612324 4:8234327-8234349 ATGGACAGACAGACGAATGGAGG - Intronic
969674099 4:8605552-8605574 ATGGATAGATATATCAATGATGG - Intronic
970311004 4:14782481-14782503 ATGGATAAACAGATGAATATAGG + Intergenic
972787956 4:42345182-42345204 GTGGAGAGACAGACCAATGGAGG + Intergenic
974631280 4:64492426-64492448 ATGGTTAAACAGATCACAGTGGG - Intergenic
976093011 4:81476358-81476380 ATTGGTAAACGGATCAATGCAGG + Intronic
977018480 4:91727012-91727034 ATGAATAAACAGAAAAATCGAGG - Intergenic
977126911 4:93180873-93180895 AGGGTTCAACAGTTCAATGGAGG - Intronic
978459251 4:108931883-108931905 ATGGACAATCAGATTAAGGGAGG + Intronic
978825043 4:113012309-113012331 ATGCATAACCAAATCAATGAGGG - Intronic
982307302 4:153946056-153946078 ATGGGCACACAGATCAATGTGGG - Intergenic
982810002 4:159813330-159813352 ATGGATAAATACATTAATGCAGG - Intergenic
983121739 4:163894021-163894043 ATGGATAAACAACTTAATTGAGG - Intronic
984136555 4:175947943-175947965 ATGAATAAAAAGATGAATGAAGG + Intronic
984357052 4:178674818-178674840 ACAGACAAATAGATCAATGGAGG + Intergenic
984374077 4:178905047-178905069 ATGGATAATTAAATCAAAGGTGG + Intergenic
984447262 4:179852407-179852429 ATGGATAACCAAATGAAGGGAGG + Intergenic
988374407 5:30415707-30415729 ATGACTAAAGAAATCAATGGCGG + Intergenic
990495142 5:56339689-56339711 AAGGATACACAGAACAGTGGGGG - Intergenic
994366136 5:98919583-98919605 ATATATAAGCAGATAAATGGTGG + Intronic
995203095 5:109447975-109447997 ATGGAAAAACAGATCCATGCTGG + Intergenic
995882349 5:116857247-116857269 ATAAATAAAGAGAGCAATGGAGG - Intergenic
996159283 5:120143124-120143146 ATGAATAAACAAATAAATTGTGG + Intergenic
996443393 5:123516026-123516048 AAGAAAAAACAGATCATTGGTGG - Intronic
997513996 5:134472713-134472735 ATGTCAAAACAGTTCAATGGGGG - Intergenic
997826562 5:137111913-137111935 AGGGATTCACAGATGAATGGGGG - Intronic
998522018 5:142809731-142809753 ATGGATGGACAGATGAATGAAGG - Intronic
1000718027 5:164671044-164671066 ATGGAGAAACTGATCAAAGAGGG - Intergenic
1001517038 5:172363163-172363185 ATGGATGGACAGATGGATGGAGG - Intronic
1001619080 5:173067158-173067180 ACTGATAAACAGATAAATTGTGG - Intronic
1002969349 6:1997799-1997821 AGGTATAAACTGATCAATGTGGG - Intronic
1004775415 6:18838847-18838869 ATGGAGAATCAGACCTATGGAGG - Intergenic
1005153291 6:22776882-22776904 ATGGATAAAGACAACCATGGAGG + Intergenic
1007800274 6:44386503-44386525 GTGGGTAAACAGCTCAAGGGCGG + Intergenic
1008416270 6:51244424-51244446 ATGGAGAAAAAGAGCAATGAAGG - Intergenic
1010725306 6:79326221-79326243 ATGGACAAACAGATCCATGCTGG + Intergenic
1011249093 6:85351618-85351640 ATGGATTAACAAACAAATGGAGG + Intergenic
1011864669 6:91809907-91809929 AAAGAGAAAAAGATCAATGGAGG + Intergenic
1012010826 6:93782722-93782744 ATAAATAAATAGATAAATGGAGG + Intergenic
1012536837 6:100308931-100308953 ATGGATAGAAATATCAATGCAGG - Intergenic
1013018204 6:106180660-106180682 TTGAATAAACAGATGAATCGTGG + Intergenic
1013263639 6:108471958-108471980 ATGGATAAATGGATAAATTGTGG + Intronic
1013333606 6:109132487-109132509 ATGGATAAACAGATAAACTGTGG - Intronic
1013790056 6:113826187-113826209 ATGGAGAAAAAGATAAATAGAGG + Intergenic
1015033125 6:128620351-128620373 ATGGAAAAACAGAACAATGTAGG + Intergenic
1015123374 6:129725414-129725436 AAGGATAAACAGATGAATCCAGG - Intergenic
1015295053 6:131581634-131581656 ATTTATAAACAGGTCAGTGGAGG + Intronic
1017663277 6:156694626-156694648 ATGAATAAACAGATAAATGGTGG + Intergenic
1019710251 7:2515123-2515145 ATGGATGAACAGTTAGATGGAGG - Intronic
1019980255 7:4616160-4616182 ATGGATAGACAAATAAGTGGTGG + Intergenic
1022312728 7:29212466-29212488 CTGAATAAGCAGATCCATGGAGG - Intronic
1024121036 7:46240462-46240484 ATGGAAAAATTGATCAATTGAGG + Intergenic
1024496285 7:50050477-50050499 ATGCAAAAACAACTCAATGGAGG + Intronic
1025120133 7:56294783-56294805 ATGGATGAATGGATGAATGGTGG + Intergenic
1026152826 7:67802674-67802696 ATGCAGAAACAGAGCAATGAGGG - Intergenic
1026281462 7:68925879-68925901 ATATATAAACAGATCAAAGTGGG - Intergenic
1026384824 7:69836023-69836045 CTGAAGAAACAGATAAATGGTGG - Intronic
1026586840 7:71662303-71662325 ATAGATAAACAGAGAGATGGGGG - Intronic
1027407896 7:77881321-77881343 AAGGATAAACATATATATGGAGG - Intronic
1030851345 7:114490181-114490203 ATAGATAAATAGATAAATTGTGG + Intronic
1033611303 7:142965522-142965544 ATGGAGAAACAGATCATGGGGGG + Intergenic
1033633212 7:143181864-143181886 ATGGATAAACAAATCAAATGAGG + Intergenic
1033916970 7:146338095-146338117 ATGGATATACAGATATATGGGGG + Intronic
1034140824 7:148814326-148814348 ATGGAAAAACAACTCAGTGGTGG - Intronic
1035896357 8:3407075-3407097 ATGGAAAGAAAGATGAATGGAGG + Intronic
1037921339 8:22808252-22808274 ATGGATGAATAGATAGATGGAGG - Intronic
1038309189 8:26432660-26432682 ATGGAAAAGCAGATCCATGCTGG + Intronic
1038325079 8:26566971-26566993 ATGGATAGACAGATGACGGGTGG - Intronic
1039235869 8:35502232-35502254 CTGGATAAACAGTCCAATGGTGG + Intronic
1040673961 8:49726326-49726348 ATGAATAAAAAAATAAATGGAGG + Intergenic
1042394360 8:68275068-68275090 TTGCACAAACAGTTCAATGGAGG - Intergenic
1044365607 8:91341907-91341929 ATAAATAAACAAATAAATGGAGG - Intronic
1044953460 8:97455802-97455824 ATGGATAAATAGATGAATAAAGG - Intergenic
1045937686 8:107700413-107700435 ATGGATCAACAGATGGATGATGG + Intergenic
1046092863 8:109524165-109524187 TGGGACAAACAGAACAATGGAGG - Intronic
1048061376 8:130922462-130922484 AGGGTTAAACAGATTAAGGGCGG - Intronic
1049350653 8:142162773-142162795 ATGGATTGACAGATGAATGGAGG + Intergenic
1049350705 8:142163038-142163060 ATGGATTGACAGATGGATGGAGG + Intergenic
1049350736 8:142163213-142163235 ATGGATTGACAGATGGATGGAGG + Intergenic
1049350840 8:142163774-142163796 ATGGATTGACAGATGGATGGAGG + Intergenic
1049405168 8:142449163-142449185 ACGGACACACAGATGAATGGAGG - Intergenic
1049486711 8:142868568-142868590 ATGGATTAATATATTAATGGGGG + Intronic
1050289133 9:4135791-4135813 ATGCAAAAACAGATCGATGAAGG + Intronic
1051123418 9:13776862-13776884 ATGCATATACATATCTATGGTGG - Intergenic
1051200674 9:14618951-14618973 ATGTCTAAACAGATGGATGGTGG - Exonic
1051434464 9:17016488-17016510 ATGGATAATGAGAGCAAAGGAGG - Intergenic
1051656920 9:19392093-19392115 TTGAAAAAACAGTTCAATGGAGG + Intergenic
1052751902 9:32500291-32500313 TTGAATATACAGATCAATGTAGG + Intronic
1055184214 9:73431106-73431128 ATGGATTAACTCATCAAAGGTGG + Intergenic
1056682144 9:88729031-88729053 ATGGATAAACACAGCATTGCTGG + Intergenic
1057366703 9:94428849-94428871 AACGATAAAAAGATCAGTGGTGG - Intronic
1057656631 9:96959213-96959235 AACGATAAAAAGATCAGTGGTGG + Intronic
1058210148 9:102158086-102158108 ATAAAACAACAGATCAATGGAGG + Intergenic
1059646572 9:116274004-116274026 AAGGATACACAGTTAAATGGTGG + Intronic
1061244853 9:129396274-129396296 ATGGGTGAAGAGATTAATGGGGG + Intergenic
1061244930 9:129396683-129396705 ATGGATGAAAAGATGAAGGGTGG + Intergenic
1185695786 X:2193432-2193454 ATGGATAGACAGATACATGATGG - Intergenic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1186030575 X:5365071-5365093 AGGGATAAACATATCCATTGAGG - Intergenic
1186697411 X:12051749-12051771 TTGAATAAACAGATGGATGGAGG - Intergenic
1186742260 X:12530843-12530865 ATGGATGAATAGATGAATGGTGG + Intronic
1187060101 X:15778495-15778517 ATGGATAAAGAGATCAATCAAGG + Intronic
1188489028 X:30716978-30717000 ATGTATAAACAGAACAATTGTGG + Intronic
1188559154 X:31448122-31448144 GTTGATAAACAGATAACTGGGGG + Intronic
1189032545 X:37465145-37465167 ATGAATACATAGCTCAATGGGGG - Intronic
1189670981 X:43408372-43408394 CTGGATAAGCAGATCCATGGCGG + Intergenic
1189707381 X:43772606-43772628 ATGGAGAATCAGATCAAAGGGGG - Intronic
1190769076 X:53500183-53500205 ATGCACAAACAGATCAGTGGAGG + Intergenic
1191032962 X:55995016-55995038 ATGGGTAAACACAACAATAGTGG - Intergenic
1191873820 X:65773445-65773467 CTGAATAAGCAGATCCATGGAGG + Intergenic
1194018312 X:88654703-88654725 ATAGACAAACATACCAATGGAGG + Intergenic
1195879885 X:109581549-109581571 CTGTTTAAACATATCAATGGTGG + Intergenic
1196315491 X:114217524-114217546 ATGAATAAAAAGATCACTGACGG - Intergenic
1199119424 X:144033796-144033818 AGGGACAAACATAACAATGGCGG + Intergenic
1199731094 X:150632779-150632801 CTGGATAACCAGACCGATGGTGG + Intronic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic