ID: 935117336

View in Genome Browser
Species Human (GRCh38)
Location 2:100147547-100147569
Sequence AAATGGGCAAGGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935117324_935117336 9 Left 935117324 2:100147515-100147537 CCCATTCTGTCCTGGTGCTAGGT No data
Right 935117336 2:100147547-100147569 AAATGGGCAAGGAGGGAGGAGGG No data
935117321_935117336 28 Left 935117321 2:100147496-100147518 CCAGGCTGGGTGTTGGTGGCCCA No data
Right 935117336 2:100147547-100147569 AAATGGGCAAGGAGGGAGGAGGG No data
935117328_935117336 -1 Left 935117328 2:100147525-100147547 CCTGGTGCTAGGTTGGGTACAGA No data
Right 935117336 2:100147547-100147569 AAATGGGCAAGGAGGGAGGAGGG No data
935117325_935117336 8 Left 935117325 2:100147516-100147538 CCATTCTGTCCTGGTGCTAGGTT No data
Right 935117336 2:100147547-100147569 AAATGGGCAAGGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935117336 Original CRISPR AAATGGGCAAGGAGGGAGGA GGG Intergenic
No off target data available for this crispr