ID: 935119364

View in Genome Browser
Species Human (GRCh38)
Location 2:100168888-100168910
Sequence CGATATGTGAAGGTAGTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935119364_935119370 24 Left 935119364 2:100168888-100168910 CCTTATACTACCTTCACATATCG No data
Right 935119370 2:100168935-100168957 CCTGCTTCATCTCCAATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935119364 Original CRISPR CGATATGTGAAGGTAGTATA AGG (reversed) Intergenic
No off target data available for this crispr